ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet70g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 864 0.0
2gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 204 2e-49
3gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 204 2e-49
4gb|AY103580.1| Zea mays PCO072544 mRNA sequence 204 2e-49
5gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 196 5e-47
6gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 188 1e-44
7ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 184 2e-43
8dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
9dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
10dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
11dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
12gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 180 3e-42
13gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 180 3e-42
14gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 180 3e-42
15emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 174 2e-40
16dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
17dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
18dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
19gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 174 2e-40
20dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 174 2e-40
21emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 170 3e-39
22gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 170 3e-39
23dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 161 2e-36
24emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 157 4e-35
25dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 145 1e-31
26emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 131 2e-27
27gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 131 2e-27
28gb|AY107675.1| Zea mays PCO112712 mRNA sequence 131 2e-27
29gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 129 9e-27
30gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 129 9e-27
31gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 129 9e-27
32gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 117 3e-23
33ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 109 8e-21
34gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 109 8e-21
35dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 8e-21
36dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 109 8e-21
37emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 103 5e-19
38dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 103 5e-19
39dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 100 8e-18
40dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 100 8e-18
41dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 100 8e-18
42gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 98 3e-17
43gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 98 3e-17
44gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 98 3e-17
45gb|AY109332.1| Zea mays CL502_5 mRNA sequence 98 3e-17
46gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 96 1e-16
47gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 96 1e-16
48gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 90 8e-15
49gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 90 8e-15
50gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 90 8e-15
51gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 88 3e-14
52ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 86 1e-13
53emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 86 1e-13
54dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
55ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
56ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 2e-12
57ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 82 2e-12
58ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
59ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 82 2e-12
60dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
61dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 82 2e-12
62dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
63dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
64dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
65dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
66dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
67dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
68dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
69dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
70gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 82 2e-12
71ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 80 7e-12
72dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
73dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
74dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
75dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 7e-12
76emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 78 3e-11
77gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 78 3e-11
78gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 78 3e-11
79gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 78 3e-11
80dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 76 1e-10
81ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 74 4e-10
82emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 74 4e-10
83gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 74 4e-10
84gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 74 4e-10
85dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 74 4e-10
86emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 74 4e-10
87emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 74 4e-10
88emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 74 4e-10
89gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 74 4e-10
90ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 70 7e-09
91emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major... 70 7e-09
92gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 70 7e-09
93dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 70 7e-09
94dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
95gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 70 7e-09
96gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 68 3e-08
97dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
98dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 68 3e-08
99dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 68 3e-08
100emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
101dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
102gb|AY107589.1| Zea mays PCO085320 mRNA sequence 66 1e-07
103dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 66 1e-07
104emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 64 4e-07
105ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 62 2e-06
106emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 62 2e-06
107gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 62 2e-06
108dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
109dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 62 2e-06
110gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 62 2e-06
111dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
112dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
113dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
114dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
115dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
116dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
117dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 62 2e-06
118gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 60 7e-06
119emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 60 7e-06
120emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 60 7e-06
121gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR... 58 3e-05
122emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 58 3e-05
123gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 58 3e-05
124gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 58 3e-05
125gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 58 3e-05
126dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 58 3e-05
127gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 58 3e-05
128gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 58 3e-05
129gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 58 3e-05
130ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 56 1e-04
131emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 56 1e-04
132gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 56 1e-04
133gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 56 1e-04
134gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 56 1e-04
135gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 56 1e-04
136emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
137gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 56 1e-04
138ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 54 4e-04
139gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 54 4e-04
140dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
141ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
142gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 52 0.002
143emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 52 0.002
144gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 52 0.002
145gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein ... 52 0.002
146dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
147dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
148dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 52 0.002
149gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 50 0.007
150emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 50 0.007
151ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 48 0.026
152gb|AY019116.1| Oryza sativa microsatellite MRG1441 containing (A... 48 0.026
153emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 48 0.026
154emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 48 0.026
155dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
156dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
157dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
158dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
159dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 48 0.026
160gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins... 48 0.026
161dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 48 0.026
162ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA 46 0.10
163gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1... 46 0.10
164ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood g... 46 0.10
165ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1),... 46 0.10
166gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 46 0.10
167gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 46 0.10
168ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA 46 0.10
169gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, compl... 46 0.10
170gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:1290... 46 0.10
171gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocula... 46 0.10
172gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mR... 46 0.10
173gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-... 46 0.10
174gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 m... 46 0.10
175emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chro... 46 0.10
176dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, p... 46 0.10
177dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, c... 46 0.10
178gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA 44 0.40
179gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 44 0.40
180emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 44 0.40
181gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete s... 44 0.40
182gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete s... 44 0.40
183gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 44 0.40
184emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1 44 0.40
185emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 44 0.40
186gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell ... 44 0.40
187ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA 44 0.40
188gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA 44 0.40
189gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 44 0.40
190emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 44 0.40
191gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 ... 44 0.40
192gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 44 0.40
193gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 44 0.40
194gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 44 0.40
195gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 44 0.40
196gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 42 1.6
197gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 42 1.6
198emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.6
199emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.6
200emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.6
201emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.6
202emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 42 1.6
203emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for... 42 1.6
204gb|AC022118.5| Homo sapiens chromosome 5 clone CTC-548H10, compl... 42 1.6
205gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN... 42 1.6
206gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 42 1.6
207gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Canc... 42 1.6
208gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.6
209gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete c... 42 1.6
210ref|NM_211463.1| Eremothecium gossypii AGL266Cp (AGL266C), mRNA 42 1.6
211gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 42 1.6
212gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 42 1.6
213gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Can... 42 1.6
214gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 42 1.6
215gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 42 1.6
216gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 42 1.6
217gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 42 1.6
218gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 42 1.6
219gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 42 1.6
220gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 6.3
221ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 40 6.3
222gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 40 6.3
223ref|XM_550604.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.3
224ref|XM_521983.1| PREDICTED: Pan troglodytes similar to expressed... 40 6.3
225gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 40 6.3
226ref|NM_001005210.1| Homo sapiens leucine rich repeat containing ... 40 6.3
227gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 40 6.3
228gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete se... 40 6.3
229gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 40 6.3
230gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds 40 6.3
231emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in... 40 6.3
232gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Can... 40 6.3
233emb|CR733851.2|CNS0GT0Q Tetraodon nigroviridis full-length cDNA 40 6.3
234emb|X62669.1|MMHOX4 M.musculus genes HOX-4.4 and Hox-4.5 40 6.3
235emb|AL355384.6| Human DNA sequence from clone RP11-626C11 on chr... 40 6.3
236emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037... 40 6.3
237emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 40 6.3
238emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 40 6.3
239emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 40 6.3
240gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 40 6.3
241emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 40 6.3
242gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 40 6.3
243gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 6.3
244gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 40 6.3
245emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 40 6.3
246gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 6.3
247gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromo... 40 6.3
248dbj|AK127591.1| Homo sapiens cDNA FLJ45686 fis, clone FCBBF3012443 40 6.3
249gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 6.3
250gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 40 6.3
251gb|AC016493.14| Homo sapiens chromosome 18, clone RP11-58G13, co... 40 6.3
252gb|AC079064.6| Homo sapiens chromosome 11, clone RP11-485O14, co... 40 6.3
253gb|AC093246.3| Homo sapiens chromosome 5 clone RP11-117L6, compl... 40 6.3
254gb|AC091980.4| Homo sapiens chromosome 5 clone RP11-546B8, compl... 40 6.3
255gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 6.3
256gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 40 6.3
257gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 40 6.3
258dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial... 40 6.3
259gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 40 6.3
260dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
261emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 40 6.3
262emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 40 6.3
263emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 40 6.3
264emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 40 6.3
265gb|AC011500.7| Homo sapiens chromosome 19 clone CTB-60E11, compl... 40 6.3
266gb|AE009619.1| Brucella melitensis 16M chromosome I, section 176... 40 6.3
267gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 40 6.3
268gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 40 6.3
269gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 40 6.3
270gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 40 6.3
271gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 40 6.3
272dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
273dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
274dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
275emb|AJ243257.1|SNA243257 Streptomyces natalensis plasmid pSNA1 i... 40 6.3
276emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 40 6.3
277dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
278dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
279dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
280dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
281dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
282dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
283dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
284dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
285gb|AY109715.1| Zea mays CL333_1 mRNA sequence 40 6.3
286dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.3
287gb|DQ151348.1| Petromyzon marinus clone T.D8 variable lymphocyte... 40 6.3
288gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 40 6.3
289emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 40 6.3
290gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 40 6.3
291gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 40 6.3
292dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 40 6.3
293dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 40 6.3

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  864 bits (436), Expect = 0.0
 Identities = 456/460 (99%), Gaps = 2/460 (0%)
 Strand = Plus / Minus

                                                                        
Query: 7    aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 66
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1199 aacaactttgctggatttgcacaacaacgagcagtactacacaacaactgagcactgatg 1140

                                                                        
Query: 67   agattacatacaagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagc 126
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1139 agattacatacaagtcctctgtctgggttcaggtgaatacagagcaagagcaagagtagt 1080

                                                                        
Query: 127  acatcaaacttggaagacaaattggaattccacggtaacacggacgatgggaagagaggg 186
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1079 acatcaaacttggaagacaaattggaattccacggtaacagggacgatgggaagagaggg 1020

                                                                        
Query: 187  ccgcccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatgg 246
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1019 ccgcccccatcagaaagaaattcactcagaacacgcagtttgctcttcgggttgggatgg 960

                                                                        
Query: 247  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 306
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 959  catctttctttgtagcagcagcttaggacttggtcttgaatgggatcgctctgatgacca 900

                                                                        
Query: 307  cctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagt 366
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 899  cctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagt 840

                                                                        
Query: 367  ggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggt 426
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 839  ggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggt 780

                                                    
Query: 427  tgaatgccg-tgccggtgatggggatggtggccaggtgga 465
            ||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 779  tga-tgccggtgccggtgatggggatggtggccaggtgga 741



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  204 bits (103), Expect = 2e-49
 Identities = 180/203 (88%), Gaps = 2/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 984 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 925

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 924 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 865

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggt 442
           |||| ||||||||||||||| ||||| |||||||| |||||||||| ||||| |||||||
Sbjct: 864 tcccggttgtagatgatggcggcgccaaggctcctagccgggttga-tgccggtgccggt 806

                                  
Query: 443 gatggggatggtggccaggtgga 465
           ||||||||||||||| |||||||
Sbjct: 805 gatggggatggtggcaaggtgga 783



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  204 bits (103), Expect = 2e-49
 Identities = 180/203 (88%), Gaps = 2/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 979 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 920

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 919 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 860

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggt 442
           |||| ||||||||||||||| ||||| |||||||| |||||||||| ||||| |||||||
Sbjct: 859 tcccggttgtagatgatggcggcgccaaggctcctagccgggttga-tgccggtgccggt 801

                                  
Query: 443 gatggggatggtggccaggtgga 465
           ||||||||||||||| |||||||
Sbjct: 800 gatggggatggtggcaaggtgga 778



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  204 bits (103), Expect = 2e-49
 Identities = 180/203 (88%), Gaps = 2/203 (0%)
 Strand = Plus / Minus

                                                                        
Query: 264  gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
            |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 1308 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 1249

                                                                        
Query: 324  gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
            ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 1248 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 1189

                                                                        
Query: 384  tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggt 442
            |||| ||||||||||||||| ||||| |||||||| |||||||||| ||||| |||||||
Sbjct: 1188 tcccggttgtagatgatggcggcgccaaggctcctagccgggttga-tgccggtgccggt 1130

                                   
Query: 443  gatggggatggtggccaggtgga 465
            ||||||||||||||| |||||||
Sbjct: 1129 gatggggatggtggcaaggtgga 1107



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  196 bits (99), Expect = 5e-47
 Identities = 179/203 (88%), Gaps = 2/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| |||||||||| |||||||||||||||||| 
Sbjct: 935 gcagcttaagacctgctcttgaacgggatggctctgatgatcacctggtggtagatggca 876

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| || ||||| |||||||||||||||||||||||||| |||||   ||||||||| 
Sbjct: 875 gccagggcagcgccaatgaaggggccgacccagaagatccaatggtcgttccaggcgtga 816

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggt 442
           |||||||||||||||||||| ||||| |||||||| || ||||||| |||| ||||| ||
Sbjct: 815 tccctgttgtagatgatggcagcgccaaggctcctagctgggttga-tgccagtgccagt 757

                                  
Query: 443 gatggggatggtggccaggtgga 465
            |||||||||||||| |||||||
Sbjct: 756 aatggggatggtggcaaggtgga 734



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score =  188 bits (95), Expect = 1e-44
 Identities = 166/187 (88%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| ||||| || ||||||| ||||||||||||||||||||| || || ||||| |
Sbjct: 412 tcttgaacgggatggccctgatgatcacctggtggtagatggcggctagggcagcgccaa 353

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||| |||||   ||||||||||||||||||||||||||
Sbjct: 352 tgaaggggccgacccagaagatccaatggtcattccaggcgtgctccctgttgtagatga 293

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
           |||| ||||| |||||||| || ||||||| |||| ||||| || |||||||||||||| 
Sbjct: 292 tggcagcgccaaggctcctagctgggttga-tgccagtgccagtaatggggatggtggca 234

                  
Query: 459 aggtgga 465
           |||||||
Sbjct: 233 aggtgga 227



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  184 bits (93), Expect = 2e-43
 Identities = 164/185 (88%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 838 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 779

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 778 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 719

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
           |||| ||||| ||||||||||| ||||||| ||||| |||||||||||||||||||||||
Sbjct: 718 tggcagcgccaaggctcctcgctgggttga-tgccggtgccggtgatggggatggtggcc 660

                
Query: 459 aggtg 463
           |||||
Sbjct: 659 aggtg 655



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  184 bits (93), Expect = 2e-43
 Identities = 164/185 (88%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 915 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 856

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 855 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 796

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
           |||| ||||| ||||||||||| ||||||| ||||| |||||||||||||||||||||||
Sbjct: 795 tggcagcgccaaggctcctcgctgggttga-tgccggtgccggtgatggggatggtggcc 737

                
Query: 459 aggtg 463
           |||||
Sbjct: 736 aggtg 732



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  184 bits (93), Expect = 2e-43
 Identities = 164/185 (88%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 916 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 857

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 856 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 797

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
           |||| ||||| ||||||||||| ||||||| ||||| |||||||||||||||||||||||
Sbjct: 796 tggcagcgccaaggctcctcgctgggttga-tgccggtgccggtgatggggatggtggcc 738

                
Query: 459 aggtg 463
           |||||
Sbjct: 737 aggtg 733



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  184 bits (93), Expect = 2e-43
 Identities = 164/185 (88%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 918 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 859

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 858 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 799

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
           |||| ||||| ||||||||||| ||||||| ||||| |||||||||||||||||||||||
Sbjct: 798 tggcagcgccaaggctcctcgctgggttga-tgccggtgccggtgatggggatggtggcc 740

                
Query: 459 aggtg 463
           |||||
Sbjct: 739 aggtg 735



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  184 bits (93), Expect = 2e-43
 Identities = 164/185 (88%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 1214 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 1155

                                                                        
Query: 340  tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
            |||||||||| |||||||||||||| |||||   |||||| ||  |||||||||||||||
Sbjct: 1154 tgaaggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 1095

                                                                        
Query: 400  tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
            |||| ||||| ||||||||||| ||||||| ||||| |||||||||||||||||||||||
Sbjct: 1094 tggcagcgccaaggctcctcgctgggttga-tgccggtgccggtgatggggatggtggcc 1036

                 
Query: 459  aggtg 463
            |||||
Sbjct: 1035 aggtg 1031



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  180 bits (91), Expect = 3e-42
 Identities = 177/203 (87%), Gaps = 2/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 834 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 775

                                                                       
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgc 383
           ||||| ||||||||||||||||||||||||||||||||||| |||||   ||| || || 
Sbjct: 774 gccagggcggcgccgatgaaggggccgacccagaagatccaatggtcgctccacgcatga 715

                                                                       
Query: 384 tccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggt 442
           |||| ||||||||||||||| ||||| ||||||||    |||||| ||||| ||||||||
Sbjct: 714 tcccggttgtagatgatggcggcgccaaggctcctaaaggggttg-atgccggtgccggt 656

                                  
Query: 443 gatggggatggtggccaggtgga 465
           ||||||||||||||| |||||||
Sbjct: 655 gatggggatggtggcaaggtgga 633



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  180 bits (91), Expect = 3e-42
 Identities = 165/187 (88%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 425 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 366

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||||||||| | |||||| || | |  |||||| || |
Sbjct: 365 tgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatta 306

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
            ||| ||||| ||||||| ||| ||||||| ||||| |||||||||| ||||||||||||
Sbjct: 305 cggcggcgccaaggctccgcgcggggttga-tgccggtgccggtgatagggatggtggcc 247

                  
Query: 459 aggtgga 465
           |||||||
Sbjct: 246 aggtgga 240



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  180 bits (91), Expect = 3e-42
 Identities = 165/187 (88%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 856 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 797

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||||||||| | |||||| || | |  |||||| || |
Sbjct: 796 tgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatta 737

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
            ||| ||||| ||||||| ||| ||||||| ||||| |||||||||| ||||||||||||
Sbjct: 736 cggcggcgccaaggctccgcgcggggttga-tgccggtgccggtgatagggatggtggcc 678

                  
Query: 459 aggtgga 465
           |||||||
Sbjct: 677 aggtgga 671



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  174 bits (88), Expect = 2e-40
 Identities = 174/200 (87%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 896 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 837

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 836 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 777

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgat 445
            |||||||||||||||| ||||| |||||||| || |||||| ||||| || ||||||||
Sbjct: 776 ttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgccagtaccggtgat 718

                               
Query: 446 ggggatggtggccaggtgga 465
           ||||||||||||||||||||
Sbjct: 717 ggggatggtggccaggtgga 698



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  174 bits (88), Expect = 2e-40
 Identities = 174/200 (87%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgat 445
            |||||||||||||||| ||||| |||||||| || |||||| ||||| || ||||||||
Sbjct: 809 ttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgccagtaccggtgat 751

                               
Query: 446 ggggatggtggccaggtgga 465
           ||||||||||||||||||||
Sbjct: 750 ggggatggtggccaggtgga 731



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  174 bits (88), Expect = 2e-40
 Identities = 174/200 (87%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 984 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 925

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 924 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 865

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgat 445
            |||||||||||||||| ||||| |||||||| || |||||| ||||| || ||||||||
Sbjct: 864 ttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgccagtaccggtgat 806

                               
Query: 446 ggggatggtggccaggtgga 465
           ||||||||||||||||||||
Sbjct: 805 ggggatggtggccaggtgga 786



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  174 bits (88), Expect = 2e-40
 Identities = 174/200 (87%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 929 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 870

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 869 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 810

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgat 445
            |||||||||||||||| ||||| |||||||| || |||||| ||||| || ||||||||
Sbjct: 809 ttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgccagtaccggtgat 751

                               
Query: 446 ggggatggtggccaggtgga 465
           ||||||||||||||||||||
Sbjct: 750 ggggatggtggccaggtgga 731



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  174 bits (88), Expect = 2e-40
 Identities = 174/200 (87%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 924 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 865

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 864 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 805

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgat 445
            |||||||||||||||| ||||| |||||||| || |||||| ||||| || ||||||||
Sbjct: 804 ttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgccagtaccggtgat 746

                               
Query: 446 ggggatggtggccaggtgga 465
           ||||||||||||||||||||
Sbjct: 745 ggggatggtggccaggtgga 726



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  174 bits (88), Expect = 2e-40
 Identities = 174/200 (87%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 267 gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
           ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 927 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 868

                                                                       
Query: 327 agcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctcc 386
           || || ||||| | |||||| || |||||||||||||| |||||   |||||| || |||
Sbjct: 867 agggcagcgccaacgaagggaccaacccagaagatccaatggtcattccaggcatggtcc 808

                                                                       
Query: 387 ctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgat 445
            |||||||||||||||| ||||| |||||||| || |||||| ||||| || ||||||||
Sbjct: 807 ttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgccagtaccggtgat 749

                               
Query: 446 ggggatggtggccaggtgga 465
           ||||||||||||||||||||
Sbjct: 748 ggggatggtggccaggtgga 729



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score =  170 bits (86), Expect = 3e-39
 Identities = 100/102 (98%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                       
Query: 365 gtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgg 424
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 680 gtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgg 621

                                                     
Query: 425 gttgaatgccg-tgccggtgatggggatggtggccaggtgga 465
           ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 620 gttga-tgccggtgccggtgatggggatggtggccaggtgga 580



 Score =  113 bits (57), Expect = 5e-22
 Identities = 57/57 (100%)
 Strand = Plus / Minus

                                                                     
Query: 308  ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 1235



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score =  170 bits (86), Expect = 3e-39
 Identities = 175/202 (86%), Gaps = 2/202 (0%)
 Strand = Plus / Minus

                                                                       
Query: 265 cagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcgg 324
           ||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| |
Sbjct: 359 cagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggcag 300

                                                                       
Query: 325 ccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgct 384
           |||| || || || |||||||||||||||||||||||||| |||||   |||||| || |
Sbjct: 299 ccagggcagcaccaatgaaggggccgacccagaagatccaatggtcgctccaggcatgat 240

                                                                       
Query: 385 ccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtg 443
           ||||||||||||||||||| ||||| |||||||| || ||||||| |||| ||||| || 
Sbjct: 239 ccctgttgtagatgatggcagcgccaaggctcctagctgggttga-tgccagtgccagta 181

                                 
Query: 444 atggggatggtggccaggtgga 465
           |||||||||||||| |||||||
Sbjct: 180 atggggatggtggcaaggtgga 159



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  161 bits (81), Expect = 2e-36
 Identities = 152/173 (87%), Gaps = 2/173 (1%)
 Strand = Plus / Minus

                                                                       
Query: 294 gctctgatgaccacctggtggtagatggcggccagcgcggcgccgatgaaggggccgacc 353
           |||||||||| |||||||||||||| ||| ||||| |||||||| | ||||||||| |||
Sbjct: 927 gctctgatgatcacctggtggtagacggctgccagggcggcgccaacgaaggggcccacc 868

                                                                       
Query: 354 cagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgagg 413
           ||||||||||| |||||   |||||| || |||||||||||||||||||| || || |||
Sbjct: 867 cagaagatccaatggtcattccaggcatggtccctgttgtagatgatggcagccccaagg 808

                                                                
Query: 414 ctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtgga 465
           ||||| || ||||||| ||||| ||||||||||||| ||||||||||||||||
Sbjct: 807 ctcctagctgggttga-tgccggtgccggtgatgggaatggtggccaggtgga 756



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  157 bits (79), Expect = 4e-35
 Identities = 162/187 (86%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||||| |||||||||||||||||| |||||||| |||||||
Sbjct: 913 tcttgaacgggatcgccctgatgatcacctggtggtagatggcagccagcgcagcgccga 854

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           ||||||||||||||||||||||||||||||| | |||||| || | |  |||||| || |
Sbjct: 853 tgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaaatta 794

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
            ||| ||||| ||||||| ||| ||||||| ||||| ||||||||||    |||||||||
Sbjct: 793 cggcggcgccaaggctccgcgcggggttga-tgccggtgccggtgatacccatggtggcc 735

                  
Query: 459 aggtgga 465
           |||||||
Sbjct: 734 aggtgga 728



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  145 bits (73), Expect = 1e-31
 Identities = 159/185 (85%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| |||||||| ||||| ||||||  ||||||||| || |||||||| |||||||
Sbjct: 945 tcttgaaggggatcgccctgatcaccaccacgtggtagatcgccgccagcgccgcgccga 886

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||||||||   ||| || |||| | ||||||||||||
Sbjct: 885 tgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 826

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcc 458
           |||| |||||||||  |||||||||||||| ||||| |||| ||||||||||| || |||
Sbjct: 825 tggcggcgccgagggacctcgccgggttga-tgccggtgcccgtgatggggatcgtcgcc 767

                
Query: 459 aggtg 463
           |||||
Sbjct: 766 aggtg 762



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score =  131 bits (66), Expect = 2e-27
 Identities = 134/154 (87%), Gaps = 2/154 (1%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 906 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 847

                                                                       
Query: 371 tgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaa 430
              ||| |||||   ||||||||||| |||||| ||||||||||| | ||| |||||| |
Sbjct: 846 gttccatgcgtgggacctgttgtagacgatggcggcgccgaggctgcgcgcggggttg-a 788

                                             
Query: 431 tgcc-gtgccggtgatggggatggtggccaggtg 463
           |||| |||||||||||||||||||| ||||||||
Sbjct: 787 tgccggtgccggtgatggggatggtcgccaggtg 754



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score =  131 bits (66), Expect = 2e-27
 Identities = 134/154 (87%), Gaps = 2/154 (1%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 897 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 838

                                                                       
Query: 371 tgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaa 430
              ||| |||||   ||||||||||| |||||| ||||||||||| | ||| |||||| |
Sbjct: 837 gttccatgcgtgggacctgttgtagacgatggcggcgccgaggctgcgcgcggggttg-a 779

                                             
Query: 431 tgcc-gtgccggtgatggggatggtggccaggtg 463
           |||| |||||||||||||||||||| ||||||||
Sbjct: 778 tgccggtgccggtgatggggatggtcgccaggtg 745



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score =  131 bits (66), Expect = 2e-27
 Identities = 134/154 (87%), Gaps = 2/154 (1%)
 Strand = Plus / Minus

                                                                       
Query: 311 gtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||||||||||||| || || || |||||||||||||| ||||||||||||||||||||
Sbjct: 330 gtggtagatggcggcaagagcagcaccgatgaaggggccaacccagaagatccagtggtc 271

                                                                       
Query: 371 tgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaa 430
              ||| |||||   ||||||||||| |||||| ||||||||||| | ||| |||||| |
Sbjct: 270 gttccatgcgtgggacctgttgtagacgatggcggcgccgaggctgcgcgcggggttg-a 212

                                             
Query: 431 tgcc-gtgccggtgatggggatggtggccaggtg 463
           |||| |||||||||||||||||||| ||||||||
Sbjct: 211 tgccggtgccggtgatggggatggtcgccaggtg 178



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score =  129 bits (65), Expect = 9e-27
 Identities = 92/101 (91%)
 Strand = Plus / Plus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 244 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 303

                                                    
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatcca 364
           ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 304 gccagggcggcgccgatgaaggggccgacccagaagatcca 344



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score =  129 bits (65), Expect = 9e-27
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                       
Query: 264 gcagcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcg 323
           |||||||| ||| || ||||||| ||||| || ||||||| |||||||||||||||||| 
Sbjct: 533 gcagcttaagacctgctcttgaacgggatggccctgatgatcacctggtggtagatggca 474

                                                    
Query: 324 gccagcgcggcgccgatgaaggggccgacccagaagatcca 364
           ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 473 gccagggcggcgccgatgaaggggccgacccagaagatcca 433



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  129 bits (65), Expect = 9e-27
 Identities = 157/185 (84%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| ||||| || ||||| ||||||  |||||||||||| |||||||| || ||||
Sbjct: 930 tcttgaaggggatggccctgatcaccaccacgtggtagatggccgccagcgccgcaccga 871

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||||||||   ||| || |||| | ||||||||||||
Sbjct: 870 tgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtagatga 811

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
           |||| |||||||||  ||||||||||||| ||||| || || ||||||||||| || |||
Sbjct: 810 tggcggcgccgagggacctcgccgggttg-atgccggtccccgtgatggggatcgtcgcc 752

                
Query: 459 aggtg 463
           |||||
Sbjct: 751 aggtg 747



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score =  117 bits (59), Expect = 3e-23
 Identities = 157/187 (83%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           |||||| |||||| || || ||||||||||||||||||||||| |  || || || ||||
Sbjct: 887 acttggacttgaagggaatggctctgatgaccacctggtggtataaagctgctagtgcgg 828

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           | || ||||| || || ||||||||||||||||||||   ||| ||||| ||| ||||||
Sbjct: 827 ccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttgttgt 768

                                                                       
Query: 394 agatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatg 452
           ||||||||||||| || |||||||  || |||||| ||||| || ||||| |||||||||
Sbjct: 767 agatgatggccgcacccaggctccgagctgggttg-atgccggttccggttatggggatg 709

                  
Query: 453 gtggcca 459
           |||||||
Sbjct: 708 gtggcca 702



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score =  109 bits (55), Expect = 8e-21
 Identities = 156/187 (83%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1008 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 949

                                                                        
Query: 340  tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
            |||| || || |||||||| |||||||||||   ||| |||||  | | ||| |||| ||
Sbjct: 948  tgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatagacga 889

                                                                        
Query: 400  tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
            |||| ||||||||||| |  || |||||| ||||| ||||||||||||||||||||||| 
Sbjct: 888  tggcggcgccgaggctgcgggcggggttg-atgccggtgccggtgatggggatggtggcg 830

                   
Query: 459  aggtgga 465
            |||||||
Sbjct: 829  aggtgga 823



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score =  109 bits (55), Expect = 8e-21
 Identities = 135/159 (84%), Gaps = 2/159 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 890 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 831

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||  ||||||||
Sbjct: 830 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctccgggccgggtt 771

                                                  
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtgga 465
           || ||||| ||||||||||||||||||||||||||||||
Sbjct: 770 ga-tgccggtgccggtgatggggatggtggccaggtgga 733



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
            insert sequence
          Length = 1318

 Score =  109 bits (55), Expect = 8e-21
 Identities = 156/187 (83%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 1007 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 948

                                                                        
Query: 340  tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
            |||| || || |||||||| |||||||||||   ||| |||||  | | ||| |||| ||
Sbjct: 947  tgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatagacga 888

                                                                        
Query: 400  tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
            |||| ||||||||||| |  || |||||| ||||| ||||||||||||||||||||||| 
Sbjct: 887  tggcggcgccgaggctgcgggcggggttg-atgccggtgccggtgatggggatggtggcg 829

                   
Query: 459  aggtgga 465
            |||||||
Sbjct: 828  aggtgga 822



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score =  109 bits (55), Expect = 8e-21
 Identities = 156/187 (83%), Gaps = 2/187 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 985 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 926

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || |||||||| |||||||||||   ||| |||||  | | ||| |||| ||
Sbjct: 925 tgaacggaccaacccagaaaatccagtggtcgtgccatgcgtgggcgcggttatagacga 866

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
           |||| ||||||||||| |  || |||||| ||||| ||||||||||||||||||||||| 
Sbjct: 865 tggcggcgccgaggctgcgggcggggttg-atgccggtgccggtgatggggatggtggcg 807

                  
Query: 459 aggtgga 465
           |||||||
Sbjct: 806 aggtgga 800



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score =  103 bits (52), Expect = 5e-19
 Identities = 75/80 (93%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                         
Query: 385   ccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtg 443
             ||||||||||||||||||| ||||| ||||||||||| ||||||| ||||| ||||||||
Sbjct: 28003 ccctgttgtagatgatggcagcgccaaggctcctcgctgggttga-tgccggtgccggtg 27945

                                 
Query: 444   atggggatggtggccaggtg 463
             ||||||||||||||||||||
Sbjct: 27944 atggggatggtggccaggtg 27925



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 76/85 (89%)
 Strand = Plus / Minus

                                                                         
Query: 280   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
             |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28669 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28610

                                      
Query: 340   tgaaggggccgacccagaagatcca 364
             |||||||||| ||||||||||||||
Sbjct: 28609 tgaaggggccaacccagaagatcca 28585



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  103 bits (52), Expect = 5e-19
 Identities = 75/80 (93%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                            
Query: 385      ccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtg 443
                ||||||||||||||||||| ||||| ||||||||||| ||||||| ||||| ||||||||
Sbjct: 28020777 ccctgttgtagatgatggcagcgccaaggctcctcgctgggttga-tgccggtgccggtg 28020719

                                    
Query: 444      atggggatggtggccaggtg 463
                ||||||||||||||||||||
Sbjct: 28020718 atggggatggtggccaggtg 28020699



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 76/85 (89%)
 Strand = Plus / Minus

                                                                            
Query: 280      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
                |||||||||| || || |||||||||||||||||||||||||| || || || ||||| |
Sbjct: 28021443 tcttgaatggaattgccctgatgaccacctggtggtagatggcagcaagggcagcgccaa 28021384

                                         
Query: 340      tgaaggggccgacccagaagatcca 364
                |||||||||| ||||||||||||||
Sbjct: 28021383 tgaaggggccaacccagaagatcca 28021359



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                           
Query: 389     gttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggg 448
               ||||||||||| ||| ||||||| |||||  || |||||||   ||||||||||||||||
Sbjct: 8906918 gttgtagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggg 8906977

                              
Query: 449     gatggtggccaggtg 463
               |||||||||||||||
Sbjct: 8906978 gatggtggccaggtg 8906992



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 308      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
                ||||||||||  |||||| |  ||||||||||||| ||| || ||||||||||||||
Sbjct: 26074808 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 43/48 (89%), Gaps = 2/48 (4%)
 Strand = Plus / Minus

                                                                
Query: 413      gctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcca 459
                |||||| |||||||||| ||||| |||||||||| ||||| |||||||
Sbjct: 26074194 gctccttgccgggttga-tgccggtgccggtgatcgggatcgtggcca 26074148



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                            
Query: 267      gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
                ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 27065653 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 27065594

                                                      
Query: 327      agcgcggcgccgatgaaggggccgacccagaagatcca 364
                || || ||||| | |||||| || ||||||||||||||
Sbjct: 27065593 agggcagcgccaacgaagggaccaacccagaagatcca 27065556



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 83/93 (89%), Gaps = 2/93 (2%)
 Strand = Plus / Minus

                                                                            
Query: 374      ccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgc 433
                |||||| || ||| |||||||||||||||| ||||| |||||||| || |||||| ||||
Sbjct: 27065059 ccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgc 27065001

                                                 
Query: 434      c-gtgccggtgatggggatggtggccaggtgga 465
                | || ||||||||||||||||||||||||||||
Sbjct: 27065000 cagtaccggtgatggggatggtggccaggtgga 27064968



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 51/54 (94%), Gaps = 2/54 (3%)
 Strand = Plus / Minus

                                                                      
Query: 413      gctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtgga 465
                ||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||
Sbjct: 25183994 gctcctcgccgggtt-aatgccggtgccggtgatggggatggtggccagatgga 25183942



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                            
Query: 280      tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
                ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 35369403 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 35369344

                                         
Query: 340      tgaaggggccgacccagaagatcca 364
                |||| || || |||||||| |||||
Sbjct: 35369343 tgaacggaccaacccagaaaatcca 35369319



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 65/74 (87%), Gaps = 2/74 (2%)
 Strand = Plus / Minus

                                                                            
Query: 393      tagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggat 451
                |||| |||||| ||||||||||| |  || ||||||| ||||| ||||||||||||||||
Sbjct: 35369057 tagacgatggcggcgccgaggctgcgggcggggttga-tgccggtgccggtgatggggat 35368999

                              
Query: 452      ggtggccaggtgga 465
                |||||| |||||||
Sbjct: 35368998 ggtggcgaggtgga 35368985



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                         
Query: 308      ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
                ||||||||||  |||||| |  ||||||||||| | |||||| ||||||||||||||
Sbjct: 25184661 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 25184605



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                         
Query: 267   gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
             ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 37302 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 37243

                                                   
Query: 327   agcgcggcgccgatgaaggggccgacccagaagatcca 364
             || || ||||| | |||||| || ||||||||||||||
Sbjct: 37242 agggcagcgccaacgaagggaccaacccagaagatcca 37205



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 83/93 (89%), Gaps = 2/93 (2%)
 Strand = Plus / Minus

                                                                         
Query: 374   ccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgc 433
             |||||| || ||| |||||||||||||||| ||||| |||||||| || |||||| ||||
Sbjct: 36708 ccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgc 36650

                                              
Query: 434   c-gtgccggtgatggggatggtggccaggtgga 465
             | || ||||||||||||||||||||||||||||
Sbjct: 36649 cagtaccggtgatggggatggtggccaggtgga 36617



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                          
Query: 267    gcttaggacttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggcc 326
              ||||| ||| || |||||||||||||||| ||||||| |||||||||||||||||| |||
Sbjct: 118855 gcttaagacctgctcttgaatgggatcgccctgatgatcacctggtggtagatggcagcc 118796

                                                    
Query: 327    agcgcggcgccgatgaaggggccgacccagaagatcca 364
              || || ||||| | |||||| || ||||||||||||||
Sbjct: 118795 agggcagcgccaacgaagggaccaacccagaagatcca 118758



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 83/93 (89%), Gaps = 2/93 (2%)
 Strand = Plus / Minus

                                                                          
Query: 374    ccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgc 433
              |||||| || ||| |||||||||||||||| ||||| |||||||| || |||||| ||||
Sbjct: 118261 ccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg-atgc 118203

                                               
Query: 434    c-gtgccggtgatggggatggtggccaggtgga 465
              | || ||||||||||||||||||||||||||||
Sbjct: 118202 cagtaccggtgatggggatggtggccaggtgga 118170



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/121 (86%), Gaps = 2/121 (1%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggc 403
           |||||| ||||||||||||||||||||   |||||  |  ||| |||||||||||| |||
Sbjct: 833 ggggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggc 774

                                                                       
Query: 404 cgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggt 462
            ||||| |||||||| |||||||||| ||||| ||||||||| |||||||||||||||||
Sbjct: 773 ggcgcccaggctcctggccgggttga-tgccggtgccggtgacggggatggtggccaggt 715

            
Query: 463 g 463
           |
Sbjct: 714 g 714



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 132/157 (84%), Gaps = 2/157 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  |||||||| || |  ||||| |||||||||||||| ||
Sbjct: 900 ctggtggtaggcggcggcgatggcggcgccaatcagtgggcccacccagaagatccattg 841

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| ||||||||||||  || || || |||||||||||||||||
Sbjct: 840 gtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaggctcctcgccgggtt 781

                                                
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtg 463
           || ||||| ||||||||||||||||||||||||||||
Sbjct: 780 ga-tgccggtgccggtgatggggatggtggccaggtg 745



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 132/157 (84%), Gaps = 2/157 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  ||||| |||||||||||||| ||
Sbjct: 890 ctggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatccattg 831

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| ||||||||||||  || || || | |||||||||||||||
Sbjct: 830 gtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgggtt 771

                                                
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtg 463
           || ||||| ||||||||||||||||||||||||||||
Sbjct: 770 ga-tgccggtgccggtgatggggatggtggccaggtg 735



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 132/157 (84%), Gaps = 2/157 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  ||||| |||||||||||||| ||
Sbjct: 318 ctggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatccattg 259

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| ||||||||||||  || || || | |||||||||||||||
Sbjct: 258 gtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgggtt 199

                                                
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtg 463
           || ||||| ||||||||||||||||||||||||||||
Sbjct: 198 ga-tgccggtgccggtgatggggatggtggccaggtg 163



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 71/79 (89%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                        
Query: 388  tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
            ||||||||| || ||| ||||| |||||||| |||||||||| ||||| ||||||||| |
Sbjct: 1511 tgttgtagacgacggcggcgcccaggctcctggccgggttga-tgccggtgccggtgacg 1453

                               
Query: 447  gggatggtggccaggtgga 465
            |||||||||||||||||||
Sbjct: 1452 gggatggtggccaggtgga 1434



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 104/120 (86%), Gaps = 2/120 (1%)
 Strand = Plus / Minus

                                                                       
Query: 345 gggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggcc 404
           ||||| ||||||||||||||||||||   |||||  |  ||| |||||||||||| ||| 
Sbjct: 780 gggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcg 721

                                                                       
Query: 405 gcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
           ||||| |||||||| |||||||||| ||||| ||||||||| ||||||||||||||||||
Sbjct: 720 gcgcccaggctcctggccgggttga-tgccggtgccggtgacggggatggtggccaggtg 662



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 104/120 (86%), Gaps = 2/120 (1%)
 Strand = Plus / Minus

                                                                       
Query: 345 gggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggcc 404
           ||||| ||||||||||||||||||||   |||||  |  ||| |||||||||||| ||| 
Sbjct: 851 gggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcg 792

                                                                       
Query: 405 gcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
           ||||| |||||||| |||||||||| ||||| ||||||||| ||||||||||||||||||
Sbjct: 791 gcgcccaggctcctggccgggttga-tgccggtgccggtgacggggatggtggccaggtg 733



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 116/137 (84%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||||||| || || ||||||||||||||||||||   |||||| |  ||  ||
Sbjct: 782 gcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggccttgtcgttg 723

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||||||||||  || ||||| | |||||| |||||||||| ||||| |||||||||||||
Sbjct: 722 ttgtagatgacagcagcgcccaagctcctggccgggttga-tgccggtgccggtgatggg 664

                            
Query: 449 gatggtggccaggtgga 465
           ||| |||||||| ||||
Sbjct: 663 gatcgtggccagatgga 647



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 116/137 (84%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||||||| || || ||||||||||||||||||||   |||||| |  ||  ||
Sbjct: 837 gcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggccttgtcgttg 778

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||||||||||  || ||||| | |||||| |||||||||| ||||| |||||||||||||
Sbjct: 777 ttgtagatgacagcagcgcccaagctcctggccgggttga-tgccggtgccggtgatggg 719

                            
Query: 449 gatggtggccaggtgga 465
           ||| |||||||| ||||
Sbjct: 718 gatcgtggccagatgga 702



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 152/185 (82%), Gaps = 2/185 (1%)
 Strand = Plus / Minus

                                                                       
Query: 277 tggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgc 336
           |||||||||||||||| |||||||| || | ||||||||| | ||| || || || || |
Sbjct: 907 tggtcttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctc 848

                                                                       
Query: 337 cgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtaga 396
           | |||||||| || |||||||| |||||   |||   |||||| ||||| ||||||||||
Sbjct: 847 caatgaagggtcccacccagaaaatccacatgtcatcccaggcatgctctctgttgtaga 788

                                                                       
Query: 397 tgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtg 455
           ||||||| || || || ||||| || |||||| ||||| || ||||||||||||||||| 
Sbjct: 787 tgatggcggcccccagactcctagcagggttg-atgccggttccggtgatggggatggtt 729

                
Query: 456 gccag 460
           |||||
Sbjct: 728 gccag 724



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds
          Length = 1325

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 151/184 (82%), Gaps = 2/184 (1%)
 Strand = Plus / Minus

                                                                        
Query: 281  cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
            |||||| ||||| || |||| ||| ||||||||||| |  || || ||||| || |||  
Sbjct: 1074 cttgaaggggatggccctgaggacgacctggtggtacaccgccgcaagcgccgctccggc 1015

                                                                        
Query: 341  gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
            ||| ||||| |||||||||||||||||| |   |||  |||||    ||| |||||||||
Sbjct: 1014 gaacgggcccacccagaagatccagtggccgtgccacccgtgcgggttgtcgtagatgat 955

                                                                        
Query: 401  ggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcca 459
            ||| |||||||||||||| || ||||||| ||||| |||||||||||||||||||||| |
Sbjct: 954  ggcggcgccgaggctcctggcggggttga-tgccggtgccggtgatggggatggtggcga 896

                
Query: 460  ggtg 463
            ||||
Sbjct: 895  ggtg 892



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 132/159 (83%), Gaps = 2/159 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| | |||||| |||||||||||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| |||||||||| |  || |  || | |||||||||||||||
Sbjct: 820 gtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtt 761

                                                  
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtgga 465
            ||||||| ||||||||||||||||||||||||| ||||
Sbjct: 760 -aatgccggtgccggtgatggggatggtggccagatgga 723



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           ||||| ||||||||||||| |||||||| ||||||   ||||| |  || ||||  || |
Sbjct: 847 acttgttcttgaatgggatagctctgatcaccaccacatggtacagagctgccaatgctg 788

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           |||| ||||| || || ||||||||||||||||||||   ||||||||| ||||||||||
Sbjct: 787 cgccaatgaatggtccaacccagaagatccagtggtcatcccaggcgtggtccctgttgt 728

                  
Query: 394 agatgat 400
           |||||||
Sbjct: 727 agatgat 721



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 132/159 (83%), Gaps = 2/159 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| | |||||| |||||||||||||| ||
Sbjct: 880 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatccattg 821

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||| |||||||||| |  || |  || | |||||||||||||||
Sbjct: 820 gtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtt 761

                                                  
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtgga 465
            ||||||| ||||||||||||||||||||||||| ||||
Sbjct: 760 -aatgccggtgccggtgatggggatggtggccagatgga 723



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 842

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 841 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 783

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 782 gatcgtcgccaggtgga 766



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 844

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 843 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 785

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 784 gatcgtcgccaggtgga 768



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 845

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 844 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 786

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 785 gatcgtcgccaggtgga 769



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 70/77 (90%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatg 446
           ||||||||| || ||| |||||||||||||||||||||||| ||||| |||||||||| |
Sbjct: 718 tgttgtagacgacggcggcgccgaggctcctcgccgggttg-atgccggtgccggtgacg 660

                            
Query: 447 gggatggtggccaggtg 463
           |||||||| ||||||||
Sbjct: 659 gggatggtcgccaggtg 643



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 70/77 (90%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatg 446
           ||||||||| || ||| |||||||||||||||||||||||| ||||| |||||||||| |
Sbjct: 276 tgttgtagacgacggcggcgccgaggctcctcgccgggttg-atgccggtgccggtgacg 218

                            
Query: 447 gggatggtggccaggtg 463
           |||||||| ||||||||
Sbjct: 217 gggatggtcgccaggtg 201



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 70/77 (90%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                            
Query: 388      tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatg 446
                ||||||||| || ||| |||||||||||||||||||||||| ||||| |||||||||| |
Sbjct: 15324235 tgttgtagacgacggcggcgccgaggctcctcgccgggttg-atgccggtgccggtgacg 15324177

                                 
Query: 447      gggatggtggccaggtg 463
                |||||||| ||||||||
Sbjct: 15324176 gggatggtcgccaggtg 15324160



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 69/77 (89%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                            
Query: 388      tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
                ||||||| |||| ||| ||||||||||||||||||||||||| ||||| |||||||||| 
Sbjct: 15316355 tgttgtacatgacggcggcgccgaggctcctcgccgggttga-tgccggtgccggtgatc 15316297

                                 
Query: 447      gggatggtggccaggtg 463
                ||||| || ||||||||
Sbjct: 15316296 gggatcgtcgccaggtg 15316280



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 69/79 (87%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                            
Query: 388      tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
                ||||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| 
Sbjct: 15355593 tgttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatc 15355535

                                   
Query: 447      gggatggtggccaggtgga 465
                ||||| || ||||||||||
Sbjct: 15355534 gggatcgtcgccaggtgga 15355516



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 330      gcggcgccgatgaaggggccgacccagaagatcca 364
                |||||||||| ||| ||||||||||||||||||||
Sbjct: 15355775 gcggcgccgacgaacgggccgacccagaagatcca 15355741



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/59 (89%), Gaps = 2/59 (3%)
 Strand = Plus / Minus

                                                                           
Query: 406      cgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
                ||||||||||||| |||||||||| ||||| |||||||||| ||||| || ||||||||
Sbjct: 15306286 cgccgaggctcctggccgggttga-tgccggtgccggtgatcgggatcgtcgccaggtg 15306229



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 336      ccgatgaaggggccgacccagaagatcca 364
                |||||||| || |||||||||||||||||
Sbjct: 15316506 ccgatgaacggcccgacccagaagatcca 15316478



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 333      gcgccgatgaaggggccgacccagaagatcca 364
                ||||||||||| || || ||||||||||||||
Sbjct: 15306473 gcgccgatgaacggcccaacccagaagatcca 15306442



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 127/153 (83%), Gaps = 2/153 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||| | |||||| |  ||||| |||||||| || || |||||||| ||||||||
Sbjct: 886 ctggtggtacaaggcggcgatggcggccccgatgaatggccccacccagaacatccagtg 827

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| | |||  |||||||||| | ||| || |||| |||||||||||||||
Sbjct: 826 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggtt 767

                                            
Query: 428 gaatgccg-tgccggtgatggggatggtggcca 459
           || ||||| |||||||||| ||||| |||||||
Sbjct: 766 ga-tgccggtgccggtgatcgggatagtggcca 735



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 70/77 (90%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatg 446
             ||||||||| || ||| |||||||||||||||||||||||| ||||| |||||||||| |
Sbjct: 31234 tgttgtagacgacggcggcgccgaggctcctcgccgggttg-atgccggtgccggtgacg 31176

                              
Query: 447   gggatggtggccaggtg 463
             |||||||| ||||||||
Sbjct: 31175 gggatggtcgccaggtg 31159



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 69/77 (89%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
             ||||||| |||| ||| ||||||||||||||||||||||||| ||||| |||||||||| 
Sbjct: 23354 tgttgtacatgacggcggcgccgaggctcctcgccgggttga-tgccggtgccggtgatc 23296

                              
Query: 447   gggatggtggccaggtg 463
             ||||| || ||||||||
Sbjct: 23295 gggatcgtcgccaggtg 23279



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 69/79 (87%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                         
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
             ||||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| 
Sbjct: 62592 tgttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatc 62534

                                
Query: 447   gggatggtggccaggtgga 465
             ||||| || ||||||||||
Sbjct: 62533 gggatcgtcgccaggtgga 62515



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 330   gcggcgccgatgaaggggccgacccagaagatcca 364
             |||||||||| ||| ||||||||||||||||||||
Sbjct: 62774 gcggcgccgacgaacgggccgacccagaagatcca 62740



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/59 (89%), Gaps = 2/59 (3%)
 Strand = Plus / Minus

                                                                        
Query: 406   cgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
             ||||||||||||| |||||||||| ||||| |||||||||| ||||| || ||||||||
Sbjct: 13285 cgccgaggctcctggccgggttga-tgccggtgccggtgatcgggatcgtcgccaggtg 13228



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 336   ccgatgaaggggccgacccagaagatcca 364
             |||||||| || |||||||||||||||||
Sbjct: 23505 ccgatgaacggcccgacccagaagatcca 23477



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 333   gcgccgatgaaggggccgacccagaagatcca 364
             ||||||||||| || || ||||||||||||||
Sbjct: 13472 gcgccgatgaacggcccaacccagaagatcca 13441



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 70/77 (90%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                          
Query: 388    tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatg 446
              ||||||||| || ||| |||||||||||||||||||||||| ||||| |||||||||| |
Sbjct: 110248 tgttgtagacgacggcggcgccgaggctcctcgccgggttg-atgccggtgccggtgacg 110190

                               
Query: 447    gggatggtggccaggtg 463
              |||||||| ||||||||
Sbjct: 110189 gggatggtcgccaggtg 110173



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 69/77 (89%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                          
Query: 388    tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
              ||||||| |||| ||| ||||||||||||||||||||||||| ||||| |||||||||| 
Sbjct: 102368 tgttgtacatgacggcggcgccgaggctcctcgccgggttga-tgccggtgccggtgatc 102310

                               
Query: 447    gggatggtggccaggtg 463
              ||||| || ||||||||
Sbjct: 102309 gggatcgtcgccaggtg 102293



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/59 (89%), Gaps = 2/59 (3%)
 Strand = Plus / Minus

                                                                        
Query: 406   cgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
             ||||||||||||| |||||||||| ||||| |||||||||| ||||| || ||||||||
Sbjct: 92299 cgccgaggctcctggccgggttga-tgccggtgccggtgatcgggatcgtcgccaggtg 92242



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 336    ccgatgaaggggccgacccagaagatcca 364
              |||||||| || |||||||||||||||||
Sbjct: 102519 ccgatgaacggcccgacccagaagatcca 102491



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 333   gcgccgatgaaggggccgacccagaagatcca 364
             ||||||||||| || || ||||||||||||||
Sbjct: 92486 gcgccgatgaacggcccaacccagaagatcca 92455



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 842

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 841 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 783

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 782 gatcgtcgccaggtgga 766



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 70/77 (90%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatg 446
           ||||||||| || ||| |||||||||||||||||||||||| ||||| |||||||||| |
Sbjct: 275 tgttgtagacgacggcggcgccgaggctcctcgccgggttg-atgccggtgccggtgacg 217

                            
Query: 447 gggatggtggccaggtg 463
           |||||||| ||||||||
Sbjct: 216 gggatggtcgccaggtg 200



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 495 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 436

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 435 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 377

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 376 gatcgtcgccaggtgga 360



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 901 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 842

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 841 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 783

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 782 gatcgtcgccaggtgga 766



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 903 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 844

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 843 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 785

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 784 gatcgtcgccaggtgga 768



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 904 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 845

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 844 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 786

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 785 gatcgtcgccaggtgga 769



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 115/137 (83%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    ||| || | |||  ||
Sbjct: 891 gcggcgccgacgaacgggccgacccagaagatccaatggttgtgccacgccttctcgttg 832

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggg 448
           ||| |||||| |||||| |||| |||||| |||||||||| ||||| |||||||||| ||
Sbjct: 831 ttgaagatgacggccgctccgatgctcctggccgggttga-tgccggtgccggtgatcgg 773

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||||||||
Sbjct: 772 gatcgtcgccaggtgga 756



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                                               
Query: 412 ggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
            |||||  || |||||||   |||||||||||||||||||||||||||||||
Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtg 631



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                                               
Query: 412 ggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
            |||||  || |||||||   |||||||||||||||||||||||||||||||
Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtg 617



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                                               
Query: 412 ggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
            |||||  || |||||||   |||||||||||||||||||||||||||||||
Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtg 730



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                                               
Query: 412 ggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
            |||||  || |||||||   |||||||||||||||||||||||||||||||
Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtg 724



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 352 cccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccga 411
           |||||||||||||||||||   ||| || | || |  ||||||||||| ||| |||||||
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                                               
Query: 412 ggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
            |||||  || |||||||   |||||||||||||||||||||||||||||||
Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtg 718



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                         
Query: 389   gttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggg 448
             ||||||||||| ||| ||||||| |||||  || |||||||   ||||||||||||||||
Sbjct: 91227 gttgtagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatggg 91286

                            
Query: 449   gatggtggccaggtg 463
             |||||||||||||||
Sbjct: 91287 gatggtggccaggtg 91301



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 71/79 (89%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
           |||||||||||| ||| ||||||| |||||| || ||||||| ||||| |||||||||||
Sbjct: 747 tgttgtagatgacggcggcgccgaagctcctggcggggttga-tgccggtgccggtgatg 689

                              
Query: 447 gggatggtggccaggtgga 465
           ||||||||||| |||||||
Sbjct: 688 gggatggtggcaaggtgga 670



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 71/79 (89%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
           ||||||||| || ||| ||||| |||||||| |||||||||| ||||| ||||||||| |
Sbjct: 861 tgttgtagacgacggcggcgcccaggctcctggccgggttga-tgccggtgccggtgacg 803

                              
Query: 447 gggatggtggccaggtgga 465
           |||||||||||||||||||
Sbjct: 802 gggatggtggccaggtgga 784



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 140/171 (81%), Gaps = 2/171 (1%)
 Strand = Plus / Minus

                                                                       
Query: 282 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 341
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 936 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 877

                                                                       
Query: 342 aaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatg 401
           || || || |||||||| ||||| |||||   ||| |||||    |||||||||||||||
Sbjct: 876 aatggcccaacccagaatatccaatggtcattccatgcgtgggatctgttgtagatgatg 817

                                                              
Query: 402 gccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggat 451
           || || || |||||||| || |||||| ||||| ||||||||||| |||||
Sbjct: 816 gcagctcccaggctccttgcagggttg-atgccggtgccggtgatcgggat 767



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 94/110 (85%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||| |||||||||||   |||||| |||  | |||||||||||||||| ||||||
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           || ||||| || |||||| ||||| || ||||||| ||||||||||||||
Sbjct: 814 agactcctggctgggttg-atgccagttccggtgacggggatggtggcca 766



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 787 gatgatggcagctccgagactcctggccgggtt 755



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 147/181 (81%), Gaps = 2/181 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           ||||||| || || ||||||||||| | |||||||||||  ||||| || || || || |
Sbjct: 931 tcttgaaaggaatggctctgatgactatctggtggtagacagcggcaagagcagctccaa 872

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| ||||| ||||||||||||||||||||   ||| || || ||  ||||| ||||||
Sbjct: 871 tgaaagggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatga 812

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
           |||| || || || ||||| |||||||| |||||| || || || ||||||||||| |||
Sbjct: 811 tggcggctccaagactccttgccgggtt-aatgccagttccagttatggggatggtagcc 753

            
Query: 459 a 459
           |
Sbjct: 752 a 752



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 858 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 799

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 798 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 739

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 738 gatgatggcagctccgagactcctggccgggtt 706



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 907 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 848

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 847 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 788

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 787 gatgatggcagctccgagactcctggccgggtt 755



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 163 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 104

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 103 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 44

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 43  gatgatggcagctccgagactcctggccgggtt 11



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 231 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 172

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 171 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 112

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 111 gatgatggcagctccgagactcctggccgggtt 79



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 490 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 431

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 430 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 371

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 370 gatgatggcagctccgagactcctggccgggtt 338



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 871 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 812

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 811 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 752

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 751 gatgatggcagctccgagactcctggccgggtt 719



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 905 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 846

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||
Sbjct: 845 accaatgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgta 786

                                            
Query: 395 gatgatggccgcgccgaggctcctcgccgggtt 427
           ||||||||| || ||||| ||||| ||||||||
Sbjct: 785 gatgatggcagctccgagactcctggccgggtt 753



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggg 448
           |||||||| || ||| ||||||| |||||||||||| ||||   ||||||||||||| ||
Sbjct: 588 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 529

                          
Query: 449 gatggtggccaggtg 463
           ||||||||| |||||
Sbjct: 528 gatggtggcgaggtg 514



to top

>emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major intrinsic protein PIPa2
          Length = 1189

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 gcggccagcgcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcg 380
           ||||| ||||| ||||||||||| || |||||||| || | |||||||||   ||| |||
Sbjct: 880 gcggcgagcgctgcgccgatgaatggtccgacccaaaatacccagtggtcgtgccacgcg 821

                                                          
Query: 381 tgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
            | ||   |||||| |||||||| |||||||||||||||||||||||
Sbjct: 820 cggtcgtggttgtatatgatggcggcgccgaggctcctcgccgggtt 774



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggg 448
             |||||||| || ||| ||||||| |||||||||||| ||||   ||||||||||||| ||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

                            
Query: 449   gatggtggccaggtg 463
             ||||||||| |||||
Sbjct: 47713 gatggtggcgaggtg 47727



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                            
Query: 389      gttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggg 448
                |||||||| || ||| ||||||| |||||||||||| ||||   ||||||||||||| ||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                               
Query: 449      gatggtggccaggtg 463
                ||||||||| |||||
Sbjct: 17626918 gatggtggcgaggtg 17626904



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggg 448
           |||||||| || ||| ||||||| |||||||||||| ||||   ||||||||||||| ||
Sbjct: 770 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 711

                          
Query: 449 gatggtggccaggtg 463
           ||||||||| |||||
Sbjct: 710 gatggtggcgaggtg 696



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                            
Query: 389      gttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggg 448
                |||||||| || ||| ||||||| |||||||||||| ||||   ||||||||||||| ||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959

                               
Query: 449      gatggtggccaggtg 463
                ||||||||| |||||
Sbjct: 17635958 gatggtggcgaggtg 17635944



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 96/114 (84%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||||||||| |||||   |||||| |  ||| ||||||||||||  || || || 
Sbjct: 865 acccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcggctccc 806

                                                                 
Query: 411 aggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
           ||| ||||||||||||||| ||||| ||||||||||| |||||||| |||||||
Sbjct: 805 aggatcctcgccgggttga-tgccggtgccggtgatgcggatggtgtccaggtg 753



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 51/54 (94%), Gaps = 2/54 (3%)
 Strand = Plus / Minus

                                                                   
Query: 413   gctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtgga 465
             ||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||
Sbjct: 84387 gctcctcgccgggtt-aatgccggtgccggtgatggggatggtggccagatgga 84335



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 308   ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
             ||||||||||  |||||| |  ||||||||||| | |||||| ||||||||||||||
Sbjct: 85054 ctggtggtaggcggcggcgatggcggcgccgatcagggggcccacccagaagatcca 84998



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 93/110 (84%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||| |||||||||||   |||||| |||| | |||||||||||||||| ||||| 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           || || || || |||||| ||||| || ||||||| ||||||||||||||
Sbjct: 818 agacttcttgctgggttg-atgccagttccggtgacggggatggtggcca 770



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 93/110 (84%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                        
Query: 351  acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
            |||||||| | |||||||||   |||||| |||| | |||||||||||||||| ||||| 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                                              
Query: 411  aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
            || ||||| || |||||| ||||| || ||||||| ||||||||||||||
Sbjct: 955  agactcctggctgggttg-atgccagttccggtgacggggatggtggcca 907



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 339 atgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatg 398
           ||||| || ||||||||||||||||| |||||   ||| || || ||| |||||||||||
Sbjct: 832 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 773

                                        
Query: 399 atggccgcgccgaggctcctcgccgggtt 427
           ||||| || ||||| ||||| ||||||||
Sbjct: 772 atggcagctccgagactcctggccgggtt 744



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                         
Query: 280   tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
             ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 29951 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 29892

                                      
Query: 340   tgaaggggccgacccagaagatcca 364
             |||| || || |||||||| |||||
Sbjct: 29891 tgaacggaccaacccagaaaatcca 29867



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 65/74 (87%), Gaps = 2/74 (2%)
 Strand = Plus / Minus

                                                                         
Query: 393   tagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggat 451
             |||| |||||| ||||||||||| |  || ||||||| ||||| ||||||||||||||||
Sbjct: 29605 tagacgatggcggcgccgaggctgcgggcggggttga-tgccggtgccggtgatggggat 29547

                           
Query: 452   ggtggccaggtgga 465
             |||||| |||||||
Sbjct: 29546 ggtggcgaggtgga 29533



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 411 aggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
           |||||||| ||||||||||   |||||||||||| ||||||||||||||||||
Sbjct: 128 aggctccttgccgggttgatgcccgtgccggtgacggggatggtggccaggtg 76



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtg 367
           |||||||||||||  |||||||||||||| ||||||||
Sbjct: 209 gcggcgccgatgagtgggccgacccagaatatccagtg 172



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                        
Query: 280  tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
            ||||||| ||||| |||||||| ||||||  |||||||||||| ||||| || || ||||
Sbjct: 4906 tcttgaaggggattgctctgatcaccaccacgtggtagatggccgccagtgccgctccga 4847

                                     
Query: 340  tgaaggggccgacccagaagatcca 364
            |||| || || |||||||| |||||
Sbjct: 4846 tgaacggaccaacccagaaaatcca 4822



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 65/74 (87%), Gaps = 2/74 (2%)
 Strand = Plus / Minus

                                                                        
Query: 393  tagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggat 451
            |||| |||||| ||||||||||| |  || ||||||| ||||| ||||||||||||||||
Sbjct: 4559 tagacgatggcggcgccgaggctgcgggcggggttga-tgccggtgccggtgatggggat 4501

                          
Query: 452  ggtggccaggtgga 465
            |||||| |||||||
Sbjct: 4500 ggtggcgaggtgga 4487



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 137/172 (79%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 881 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 822

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 821 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 762

                                                               
Query: 401 ggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatg 452
            || || || || ||||| || ||||||| | | || |||||||| ||||||
Sbjct: 761 tgcagctccaagactcctagctgggttgattcctgttccggtgattgggatg 710



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||||| ||| || |||||||||||||||||
Sbjct: 816 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatccagtg 757

              
Query: 368 gtc 370
           |||
Sbjct: 756 gtc 754



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 43/48 (89%), Gaps = 2/48 (4%)
 Strand = Plus / Minus

                                                           
Query: 413 gctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcca 459
           |||||| |||||||||| ||||| |||||||||| ||||| |||||||
Sbjct: 711 gctccttgccgggttga-tgccggtgccggtgatcgggatcgtggcca 665



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 278 ggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgcc 337
           |||||||||||| || ||||||||||| | |||||||||||| || || || || || ||
Sbjct: 874 ggtcttgaatggaattgctctgatgactatctggtggtagattgcagcaagggcagctcc 815

                                  
Query: 338 gatgaaggggccgacccagaaga 360
            |||||||| || ||||||||||
Sbjct: 814 aatgaagggaccaacccagaaga 792



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 435 gtgccggtgatggggatggtggccaggtg 463
           ||||| ||||||||||||||||| |||||
Sbjct: 714 gtgccagtgatggggatggtggcaaggtg 686



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 69/79 (87%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccg-tgccggtgatg 446
           ||||||||||||  || || || | ||| ||||||||||||| ||||| |||||||||||
Sbjct: 388 tgttgtagatgacagcagctcccaagcttctcgccgggttga-tgccggtgccggtgatg 330

                              
Query: 447 gggatggtggccaggtgga 465
           ||||||||||| |||||||
Sbjct: 329 gggatggtggctaggtgga 311



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                           
Query: 405      gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
                |||||||||||||||||||||||||   ||||||||||||| || || || ||||||||
Sbjct: 21009482 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 21009424



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 129/159 (81%), Gaps = 2/159 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  || || |||||||||||||| ||
Sbjct: 942 ctggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccattg 883

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||  ||||||||||||  || || || | ||| ||||| |||||
Sbjct: 882 gtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcggggtt 823

                                                  
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtgga 465
           || ||||| |||||||||||||||||||||||| |||||
Sbjct: 822 ga-tgccggtgccggtgatggggatggtggccaagtgga 785



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 123/151 (81%), Gaps = 2/151 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  || || |||||||||||||| ||
Sbjct: 854 ctggtggtaggcggcggcgatggcggcgccgatcagcggccccacccagaagatccattg 795

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||  ||||||||||||  || || || | ||| |||||||||||
Sbjct: 794 gtcatcccaggccttgtctttgttgtagatgacagcagctcccaagcttctcgccgggtt 735

                                          
Query: 428 gaatgccg-tgccggtgatggggatggtggc 457
           || ||||| ||||||||||||||||||||||
Sbjct: 734 ga-tgccggtgccggtgatggggatggtggc 705



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                         
Query: 405    gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
              |||||||||||||||||||||||||   ||||||||||||| || || || ||||||||
Sbjct: 101571 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 101513



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||||   ||||||||||||| || || || ||||||||
Sbjct: 744 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 686



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 351 acccagaagatccagtggtct 371
           |||||||||||||||||||||
Sbjct: 798 acccagaagatccagtggtct 778



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||||   ||||||||||||| || || || ||||||||
Sbjct: 642 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 584



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||||   ||||||||||||| || || || ||||||||
Sbjct: 742 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 684



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 351 acccagaagatccagtggtct 371
           |||||||||||||||||||||
Sbjct: 796 acccagaagatccagtggtct 776



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 405 gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||||   ||||||||||||| || || || ||||||||
Sbjct: 737 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 679



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 351 acccagaagatccagtggtct 371
           |||||||||||||||||||||
Sbjct: 791 acccagaagatccagtggtct 771



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                        
Query: 405   gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccaggtg 463
             |||||||||||||||||||||||||   ||||||||||||| || || || ||||||||
Sbjct: 30782 gcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgccaggtg 30724



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 129/159 (81%), Gaps = 2/159 (1%)
 Strand = Plus / Minus

                                                                       
Query: 308 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 367
           ||||||||||  |||||| |  ||||||||||| |  || || |||||||||||||| ||
Sbjct: 862 ctggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccattg 803

                                                                       
Query: 368 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           |||   |||||| |  ||  ||||||||||||  || || || | ||| ||||| |||||
Sbjct: 802 gtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcggggtt 743

                                                  
Query: 428 gaatgccg-tgccggtgatggggatggtggccaggtgga 465
           || ||||| |||||||||||||||||||||||| |||||
Sbjct: 742 ga-tgccggtgccggtgatggggatggtggccaagtgga 705



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 92/110 (83%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |||||   |||||||||||| || || || 
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           || ||||| || ||||||| |||| || ||||||||||||||||||||||
Sbjct: 794 agactcctggcggggttga-tgccagttccggtgatggggatggtggcca 746



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 92/110 (83%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |||||   |||||||||||| || || || 
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           || ||||| || ||||||| |||| || ||||||||||||||||||||||
Sbjct: 734 agactcctggcggggttga-tgccagttccggtgatggggatggtggcca 686



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 92/110 (83%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |||||   |||||||||||| || || || 
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           || ||||| || ||||||| |||| || ||||||||||||||||||||||
Sbjct: 545 agactcctggcggggttga-tgccagttccggtgatggggatggtggcca 497



to top

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 ttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgatg 341
           ||||| ||||| ||||||||||| ||||||||||| |  || ||||| || || ||||||
Sbjct: 176 ttgaaggggattgctctgatgacgacctggtggtacagcgcagccagtgcagctccgatg 117

                                        
Query: 342 aaggggccgacccagaagatccagtggtc 370
           || || || |||||||| ||||| |||||
Sbjct: 116 aatggcccaacccagaaaatccaatggtc 88



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 435 gtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||||||||
Sbjct: 766 gtgccggtgatggggatggtggccaggtg 738



to top

>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 145/181 (80%), Gaps = 2/181 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 909 tcttgaatggaatggctctgatgactatctgatggtacatggcagcaagagcagctccaa 850

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||   |||   ||| || ||||| |||||| ||||||
Sbjct: 849 tgaaaggtcccacccagaagatccacatgtcatcccatgcatgctctctgttgaagatga 790

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
           | || || || || ||||| || ||||| |||||| || || ||||||||||||||||||
Sbjct: 789 tagcagctccaagactcctggctgggtt-aatgccagttcctgtgatggggatggtggcc 731

            
Query: 459 a 459
           |
Sbjct: 730 a 730



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 145/181 (80%), Gaps = 2/181 (1%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| |||||||| || | ||||||||| | ||| || || || || || ||
Sbjct: 911 cttgaatgggatggctctgattactatctggtggtacaaggcagcaagagcagctccaat 852

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           |||||| || |||||||| |||||   |||   |||||| |||||  ||||||||| |||
Sbjct: 851 gaagggtccaacccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgat 792

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           ||| || || || ||||| || |||||| ||||| || || |||||||||||||| ||||
Sbjct: 791 ggcggcccccagactcctagcagggttg-atgccggttccagtgatggggatggttgcca 733

            
Query: 460 g 460
           |
Sbjct: 732 g 732



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 106/129 (82%), Gaps = 2/129 (1%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgt-gctccctgttgta 394
           |||||||| ||||| |||||||||||||| |||||   |||||| | |||   |||||||
Sbjct: 872 ccgatgaacgggcccacccagaagatccactggtcgctccaggctttgctgt-tgttgta 814

                                                                       
Query: 395 gatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggt 454
            | || ||| |||||||||||||||||||||||||   | ||||| ||||| ||||| ||
Sbjct: 813 cacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtgatcgggatcgt 754

                    
Query: 455 ggccaggtg 463
            ||||||||
Sbjct: 753 cgccaggtg 745



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 112/137 (81%), Gaps = 2/137 (1%)
 Strand = Plus / Minus

                                                                       
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctg 389
           |||||||||| ||| |||||||||||||||||||| ||||    |||||| | |||  ||
Sbjct: 467 gcggcgccgacgaacgggccgacccagaagatccattggttgtgccaggccttctcgttg 408

                                                                       
Query: 390 ttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggg 448
           ||| |||||| |||||  |||  | |||| ||||||||| ||||| ||||||||||| ||
Sbjct: 407 ttgaagatgacggccggtccggtggtcctggccgggttg-atgccggtgccggtgatcgg 349

                            
Query: 449 gatggtggccaggtgga 465
           ||| || ||||| ||||
Sbjct: 348 gatcgtcgccagttgga 332



to top

>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 145/181 (80%), Gaps = 2/181 (1%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccga 339
           |||||||||| || ||||||||||| | ||| ||||| ||||| || || || || || |
Sbjct: 910 tcttgaatggaatggctctgatgactatctgctggtacatggcagcaagagcagctccaa 851

                                                                       
Query: 340 tgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatga 399
           |||| || || ||||||||||||||   |||   ||| || ||||| |||||| ||||||
Sbjct: 850 tgaacggtcccacccagaagatccacatgtcatcccatgcatgctctctgttgaagatga 791

                                                                       
Query: 400 tggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcc 458
           | || || || || ||||| || ||||| |||||| || || ||||||||||||||||||
Sbjct: 790 tagcagctccaagactcctggctgggtt-aatgccagttcctgtgatggggatggtggcc 732

            
Query: 459 a 459
           |
Sbjct: 731 a 731



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 435 gtgccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||||||||||||
Sbjct: 766 gtgccggtgatggggatggtggccaggtg 738



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 792 gcggcgccgatgaacgggccaacccagaagatccactggtc 752



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 975 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 916

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 915 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 856



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 862 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 803

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 802 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 743



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 903 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 844

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 843 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 784



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 100/124 (80%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
           ||||||||||| || |||||||| ||||| || ||   |||||| || ||| ||||||||
Sbjct: 473 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 414

                                                                       
Query: 396 atgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtg 455
           ||||| || || || |||||||| || |||||||   | || || ||||| |||||||||
Sbjct: 413 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggatggtg 354

               
Query: 456 gcca 459
           ||||
Sbjct: 353 gcca 350



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 100/124 (80%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
           ||||||||||| || |||||||| ||||| || ||   |||||| || ||| ||||||||
Sbjct: 803 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 744

                                                                       
Query: 396 atgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtg 455
           ||||| || || || |||||||| || |||||||   | || || ||||| |||||||||
Sbjct: 743 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattgggatggtg 684

               
Query: 456 gcca 459
           ||||
Sbjct: 683 gcca 680



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 893 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 834

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 833 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 774



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           ||||||||| || ||||||||||| |  |||||||| |  || || || || || || ||
Sbjct: 849 cttgaatggaatggctctgatgacaagttggtggtaaagagccgcaagagctgctccaat 790

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || ||||||||||| |||||||||||   ||| ||||| ||| |||||||||||||
Sbjct: 789 gaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgat 730



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/59 (89%), Gaps = 2/59 (3%)
 Strand = Plus / Minus

                                                                      
Query: 406 cgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
           ||||||||||||| |||||||||| ||||| |||||||||| ||||| || ||||||||
Sbjct: 803 cgccgaggctcctggccgggttga-tgccggtgccggtgatcgggatcgtcgccaggtg 746



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 141/179 (78%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| |||||||| || ||||||||||| |  || ||||| || || || | 
Sbjct: 937 cttgaatgggatggctctgatcacaacctggtggtacagtgcagccagtgctgccccaac 878

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
            || || || |||||||||||||| || ||   ||| ||||| ||  |||||||||||||
Sbjct: 877 aaatggtccaacccagaagatccaatgatcattccatgcgtgttcattgttgtagatgat 818

                                                                      
Query: 401 ggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggcca 459
           ||| || ||||| || |  |||||||| |   ||||||||||||| || ||||| ||||
Sbjct: 817 ggctgcaccgagacttcgggccgggttaatacccgtgccggtgatcggaatggtagcca 759



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/59 (89%), Gaps = 2/59 (3%)
 Strand = Plus / Minus

                                                                      
Query: 406 cgccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggccaggtg 463
           ||||||||||||| |||||||||| ||||| |||||||||| ||||| || ||||||||
Sbjct: 803 cgccgaggctcctggccgggttga-tgccggtgccggtgatcgggatcgtcgccaggtg 746



to top

>ref|XM_470514.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 843

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
           |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 755 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 706



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 435 gtgccggtgatggggatggtggccaggtg 463
           ||||||||||||||||||||||| |||||
Sbjct: 644 gtgccggtgatggggatggtggcaaggtg 616



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                  
Query: 330      gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
                |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 36057599 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 36057550



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 435      gtgccggtgatggggatggtggccaggtg 463
                ||||||||||||||||||||||| |||||
Sbjct: 36057488 gtgccggtgatggggatggtggcaaggtg 36057460



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 137/174 (78%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || ||||| || |||||
Sbjct: 867 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 808

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || |||||||| |||| ||| |||||   ||| ||||  ||| ||||| |||||||
Sbjct: 807 gaatggtccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 748

                                                                 
Query: 401 ggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggt 454
           ||| || || || ||||| || ||||||| | | || || || |||||||||||
Sbjct: 747 ggcagctccaagactccttgctgggttgattccagttccagtaatggggatggt 694



to top

>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
              sequence
          Length = 164179

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 330    gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
              |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 119110 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 119061



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 435    gtgccggtgatggggatggtggccaggtg 463
              ||||||||||||||||||||||| |||||
Sbjct: 118999 gtgccggtgatggggatggtggcaaggtg 118971



to top

>gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete
           cds
          Length = 1123

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 104/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           |||||| ||||||||| || |||||||| || || |||||||| |  || || || || |
Sbjct: 907 acttggacttgaatggaattgctctgatcacaacttggtggtatagagctgctagagctg 848

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           | || ||||| || || |||||||| |||||||||||   ||| ||||| |||  |||||
Sbjct: 847 ccccaatgaatggtccaacccagaatatccagtggtcattccatgcgtgttcctggttgt 788

                     
Query: 394 agatgatggc 403
           ||||||||||
Sbjct: 787 agatgatggc 778



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                  
Query: 330      gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
                |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 36147673 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 36147624



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 435      gtgccggtgatggggatggtggccaggtg 463
                ||||||||||||||||||||||| |||||
Sbjct: 36147562 gtgccggtgatggggatggtggcaaggtg 36147534



to top

>dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-B04, full
           insert sequence
          Length = 1099

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtctgaccaggc 379
           |||||||||  ||||||||| ||||||||||||||| |||  ||||||||
Sbjct: 843 gcggcgccggcgaaggggcccacccagaagatccagaggtgggaccaggc 794



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 435 gtgccggtgatggggatggtggccaggtg 463
           ||||||||||||||||||||||| |||||
Sbjct: 732 gtgccggtgatggggatggtggcaaggtg 704



to top

>dbj|AB002147.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1112

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 122/154 (79%)
 Strand = Plus / Minus

                                                                       
Query: 274 acttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcgg 333
           |||||| ||| |||||||| || ||||| |||||||| ||||| |  || || || || |
Sbjct: 901 acttggacttaaatgggattgccctgatcaccacctgttggtacagagctgctagtgctg 842

                                                                       
Query: 334 cgccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgt 393
           | || ||||| || || |||||||| |||||||||||   ||| ||||| ||   |||||
Sbjct: 841 ctccaatgaaaggtccaacccagaaaatccagtggtcatcccatgcgtggtcttggttgt 782

                                             
Query: 394 agatgatggccgcgccgaggctcctcgccgggtt 427
           |||||||||| ||||| || ||||| || |||||
Sbjct: 781 agatgatggctgcgccaagactcctagctgggtt 748



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 145/185 (78%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || || || || |||||
Sbjct: 885 cttgaatgggatggctctgatgacgatcacgtggtacagagcagcaagtgcagcaccgat 826

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || || |||||||||| ||| |||||   ||| ||||  ||| ||||| |||||||
Sbjct: 825 gaatggtccaacccagaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 766

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccag 460
           ||| || || || || || || ||||||| | | || || |||||||||||||| |||| 
Sbjct: 765 ggcagcaccaagacttcttgctgggttgattccagttccagtgatggggatggttgccaa 706

                
Query: 461 gtgga 465
           |||||
Sbjct: 705 gtgga 701



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 308    ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 364
              ||||||||||  |||||| |  ||||||||||||| ||| || ||||||||||||||
Sbjct: 109135 ctggtggtaggcggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 43/48 (89%), Gaps = 2/48 (4%)
 Strand = Plus / Minus

                                                              
Query: 413    gctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcca 459
              |||||| |||||||||| ||||| |||||||||| ||||| |||||||
Sbjct: 108521 gctccttgccgggttga-tgccggtgccggtgatcgggatcgtggcca 108475



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 683 gcggcgccgacgaaggggccgagccagtagacccagtggt 644



to top

>gb|AY019116.1| Oryza sativa microsatellite MRG1441 containing (AT)X27, closest to
           marker S733, genomic sequence
          Length = 254

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 374 ccaggcgtgctccctgttgtagatgatggccgcgcc 409
           |||||| || |||||||||||||||||||| |||||
Sbjct: 39  ccaggcatggtccctgttgtagatgatggcagcgcc 4



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
             |||||||||||||||| || ||||| ||||| ||||||||
Sbjct: 75485 tgttgtagatgatggcagctccgagactcctggccgggtt 75446



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                         
Query: 275   cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
             ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 75731 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 75672

                                           
Query: 335   gccgatgaaggggccgacccagaagatcca 364
              || ||||| || |||||||||||||||||
Sbjct: 75671 accaatgaatggaccgacccagaagatcca 75642



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 388   tgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
             |||||||||||||||| || ||||| ||||| ||||||||
Sbjct: 33953 tgttgtagatgatggcagctccgagactcctggccgggtt 33914



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                         
Query: 275   cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
             ||||| |||||| || || ||||||||||| | ||| ||||| |  || || ||||| ||
Sbjct: 34199 cttggacttgaaaggaatagctctgatgactatctgatggtacagagcagcaagcgcagc 34140

                                           
Query: 335   gccgatgaaggggccgacccagaagatcca 364
              || ||||| || |||||||||||||||||
Sbjct: 34139 accaatgaatggaccgacccagaagatcca 34110



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                        
Query: 330      gcggcgccgatgaaggggccgacccagaagatccagtggt 369
                |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 43108744 gcggcgccgacgaaggggccgagccagtagacccagtggt 43108783



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 330    gcggcgccgatgaaggggccgacccagaagatccagtggt 369
              |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 105773 gcggcgccgacgaaggggccgagccagtagacccagtggt 105812



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 707 gcggcgccgacgaaggggccgagccagtagacccagtggt 668



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 756 gcggcgccgacgaaggggccgagccagtagacccagtggt 717



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggt 369
           |||||||||| ||||||||||| |||| ||| ||||||||
Sbjct: 693 gcggcgccgacgaaggggccgagccagtagacccagtggt 654



to top

>gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrinsic protein 3 mRNA,
           complete cds
          Length = 1292

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 339 atgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||||||||||||
Sbjct: 878 atgaagggtcccacccagaagatccagtggtc 847



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 276 ttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcg 335
           |||||||||||||| || ||||||||||  | ||||||||| |  || || || || || 
Sbjct: 890 ttggtcttgaatggaatggctctgatgattatctggtggtaaactgcagcgagagcagct 831

                                           
Query: 336 ccgatgaaggggccgacccagaagatccagtg 367
           || ||||| || || |||||||||||||||||
Sbjct: 830 ccaatgaatggtccaacccagaagatccagtg 799



to top

>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA
          Length = 823

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete
           cds
          Length = 2695

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 704 ccgatgaacggccccacccagaagatccagtggtc 670



to top

>ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1), mRNA
          Length = 945

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 122/155 (78%)
 Strand = Plus / Minus

                                                                       
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggc 334
           |||| ||||||| || || ||||||||||| | |||||| ||||  ||||| |  || ||
Sbjct: 292 cttgctcttgaaaggaatggctctgatgacaatctggtgatagagtgcggctaaagctgc 233

                                                                       
Query: 335 gccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgta 394
            || ||||| || ||||||||||| ||||| |||||   ||| | ||| ||| |||||||
Sbjct: 232 tccaatgaatggtccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgta 173

                                              
Query: 395 gatgatggccgcgccgaggctcctcgccgggttga 429
           ||| ||||| || || ||||| || || |||||||
Sbjct: 172 gataatggcggctccaaggcttctagctgggttga 138



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 317    gatggcggccagcgcggcgccga 339
              |||||||||||||||||||||||
Sbjct: 310343 gatggcggccagcgcggcgccga 310365



to top

>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA
          Length = 2703

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 669 ccgatgaacggccccacccagaagatccagtggtc 635



to top

>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557),
           complete cds
          Length = 2703

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 678 ccgatgaacggccccacccagaagatccagtggtc 644



to top

>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium,
           mRNA, 1211 nt, segment 1 of 2]
          Length = 1211

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 694 ccgatgaacggccccacccagaagatccagtggtc 660



to top

>gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mRNA, complete cds
          Length = 1136

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 94/115 (81%), Gaps = 2/115 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           |||||||| ||||| |||||   ||| || || |||||||||||||| ||||| || || 
Sbjct: 844 acccagaaaatccattggtcatcccatgcatggtccctgttgtagataatggcagctcca 785

                                                                  
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggccaggtgg 464
           || ||||| || ||||| |||||| || || |||||||| |||||||||| ||||
Sbjct: 784 agactcctagcagggtt-aatgccagttcctgtgatgggaatggtggccaagtgg 731



to top

>gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-1 mRNA, partial cds
          Length = 477

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 341 ccgatgaacggcccgacccagaaaatccagtggtc 307



to top

>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds
          Length = 826

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || || ||||||||||||||||||||
Sbjct: 672 ccgatgaacggccccacccagaagatccagtggtc 638



to top

>emb|AL772318.6| Mouse DNA sequence from clone RP23-77I17 on chromosome 4, complete
              sequence
          Length = 249534

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 84     tctgtctgggttcaggtgaatacagag 110
              ||||||||||| |||||||||||||||
Sbjct: 225070 tctgtctgggtacaggtgaatacagag 225044



to top

>dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, partial cds
          Length = 273

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 233 ccgatgaacggcccgacccagaaaatccagtggtc 199



to top

>dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, complete cds
          Length = 945

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 336 ccgatgaaggggccgacccagaagatccagtggtc 370
           |||||||| || ||||||||||| |||||||||||
Sbjct: 693 ccgatgaacggcccgacccagaaaatccagtggtc 659



to top

>gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 438 ccggtgatggggatggtggcca 459
           ||||||||||||||||||||||
Sbjct: 751 ccggtgatggggatggtggcca 730



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 438 ccggtgatggggatggtggccaggtg 463
           |||||||||||||||||||| |||||
Sbjct: 756 ccggtgatggggatggtggcaaggtg 731



to top

>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1
          Length = 1204

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 90/110 (81%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||| ||||||||||||||   ||| || || ||  ||||||||||||| || || || 
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           || ||||| || ||||||| |||| || ||||||||||| ||||||||||
Sbjct: 794 agactcctagcggggttga-tgccagttccggtgatgggaatggtggcca 746



to top

>gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete sequence
          Length = 95941

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 336  ccgatgaaggggccgacccagaagatccagtggt 369
            |||||||| || || |||||||||||||||||||
Sbjct: 8298 ccgatgaatggaccaacccagaagatccagtggt 8265



to top

>gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete sequence
          Length = 164457

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 336    ccgatgaaggggccgacccagaagatccagtggt 369
              |||||||| || || |||||||||||||||||||
Sbjct: 110004 ccgatgaatggaccaacccagaagatccagtggt 109971



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 90/110 (81%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||| ||||||||||||||   |||||| || || |  ||||| || ||||| || || 
Sbjct: 440 acccaaaagatccagtggtcatcccaggcatggtctcgattgtaaataatggctgctcca 381

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           |||||||| || ||||||| |||| ||||||||||| || ||||||||||
Sbjct: 380 aggctcctggcagggttga-tgccagtgccggtgataggtatggtggcca 332



to top

>emb|AL031227.1|DMC66A1 Drosophila melanogaster cosmid 66A1
          Length = 34127

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  tgaccacctggtggtagatggc 322
            ||||||||||||||||||||||
Sbjct: 9156 tgaccacctggtggtagatggc 9135



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  tgaccacctggtggtagatggc 322
            ||||||||||||||||||||||
Sbjct: 5054 tgaccacctggtggtagatggc 5033



to top

>emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial
          Length = 1051

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 438 ccggtgatggggatggtggcca 459
           ||||||||||||||||||||||
Sbjct: 699 ccggtgatggggatggtggcca 678



to top

>gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 167097

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 301   tgaccacctggtggtagatggc 322
             ||||||||||||||||||||||
Sbjct: 34675 tgaccacctggtggtagatggc 34654



to top

>ref|NM_131946.3| Drosophila melanogaster CG12184-RA (CG12184), mRNA
          Length = 3292

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  tgaccacctggtggtagatggc 322
            ||||||||||||||||||||||
Sbjct: 2313 tgaccacctggtggtagatggc 2292



to top

>gb|AY051507.1| Drosophila melanogaster GH15731 full length cDNA
          Length = 2897

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  tgaccacctggtggtagatggc 322
            ||||||||||||||||||||||
Sbjct: 1897 tgaccacctggtggtagatggc 1876



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 136/174 (78%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || ||||| || |||||
Sbjct: 868 cttgaatgggatggctctgatgactatcacgtggtaaagagcagcaagcgcagcaccgat 809

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || || ||||| |||| ||| |||||   ||| ||||  ||| ||||| |||||||
Sbjct: 808 gaatggtccaacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgat 749

                                                                 
Query: 401 ggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggt 454
           ||| || || || ||||| || ||||||| | | || || || |||||||||||
Sbjct: 748 ggcagctccaagactccttgctgggttgattccagttccagtaatggggatggt 695



to top

>emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1 gene)
          Length = 1163

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 275 cttggtcttgaatgggatcgctctgatgaccacctggtggta 316
           ||||| |||||||||||| |||||||| || | |||||||||
Sbjct: 969 cttggacttgaatgggatggctctgataacaatctggtggta 928



to top

>gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 of 74 of the complete
              sequence
          Length = 310993

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 301    tgaccacctggtggtagatggc 322
              ||||||||||||||||||||||
Sbjct: 239024 tgaccacctggtggtagatggc 239045



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 438 ccggtgatggggatggtggcca 459
           ||||||||||||||||||||||
Sbjct: 759 ccggtgatggggatggtggcca 738



to top

>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds
          Length = 1158

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 90/110 (81%), Gaps = 2/110 (1%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||| ||||||||||||||   ||| || || ||  ||||||||||||| || || || 
Sbjct: 854 acccaaaagatccagtggtcgtcccatgcctggtctgtgttgtagatgatcgcagctcca 795

                                                             
Query: 411 aggctcctcgccgggttgaatgcc-gtgccggtgatggggatggtggcca 459
           || ||||| || ||||||| |||| || ||||||||||| ||||||||||
Sbjct: 794 agactcctagcggggttga-tgccagttccggtgatgggaatggtggcca 746



to top

>gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mip-1) mRNA, complete cds
          Length = 1213

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 306 acctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccag 365
           |||||||||||||  || || || || || |||||||| || || |||||||||||||||
Sbjct: 867 acctggtggtagagtgcagcgagagccgcaccgatgaatggtcccacccagaagatccag 808

             
Query: 366 tg 367
           ||
Sbjct: 807 tg 806



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 438 ccggtgatggggatggtggcca 459
           ||||||||||||||||||||||
Sbjct: 735 ccggtgatggggatggtggcca 714



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                       
Query: 336 ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
           ||||||||||| || |||||||| |||||||| ||   ||| |||||  || ||||| ||
Sbjct: 820 ccgatgaagggtccaacccagaaaatccagtgatcatcccaagcgtggcccttgttgaag 761

                                             
Query: 396 atgatggccgcgccgaggctcctcgccgggttga 429
           ||||| || || ||||| ||||| || |||||||
Sbjct: 760 atgatagcagcaccgagactccttgctgggttga 727



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 435 gtgccggtgatggggatggtggcca 459
           |||||||| ||||||||||||||||
Sbjct: 737 gtgccggtaatggggatggtggcca 713



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccagaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 824 acccagaagatccagtggtc 805



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||| || |||||||| ||||||||||| ||||| |||||
Sbjct: 910 gcggcaccaatgaagggtccgacccagaaaatccattggtc 870



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 144/185 (77%)
 Strand = Plus / Minus

                                                                       
Query: 281 cttgaatgggatcgctctgatgaccacctggtggtagatggcggccagcgcggcgccgat 340
           |||||||||||| ||||||||||| | |  |||||| |  || || || || || |||||
Sbjct: 886 cttgaatgggatggctctgatgacgatcacgtggtacagagcagcaagtgcagcaccgat 827

                                                                       
Query: 341 gaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgat 400
           ||| || || |||||||||| ||| |||||   ||| ||||  ||| ||||  |||||||
Sbjct: 826 gaatggtccaacccagaagacccaatggtcatcccaagcgttgtccttgttcaagatgat 767

                                                                       
Query: 401 ggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggccag 460
           ||| || || || || || || ||||||| | | || || |||||||||||||| |||| 
Sbjct: 766 ggcagcaccaagacttcttgctgggttgattccagttccagtgatggggatggttgccaa 707

                
Query: 461 gtgga 465
           |||||
Sbjct: 706 gtgga 702



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 330 gcggcgccgatgaaggggccgacccagaagatccagtggtc 370
           ||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 827 gcggccccaatgaaaggcccgacccagaagatccaatggtc 787



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 341 gaaggggccgacccagaagatccagtggt 369
           |||||| || |||||||||||||||||||
Sbjct: 781 gaagggtccaacccagaagatccagtggt 753



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 339 atgaaggggccgacccagaagatccagtg 367
           ||||||||||| |||||||| ||||||||
Sbjct: 888 atgaaggggccaacccagaaaatccagtg 860



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 345 gggccgacccagaagatccagtggt 369
           |||||||||||| ||||||||||||
Sbjct: 744 gggccgacccagtagatccagtggt 720



to top

>emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for putative aquaporin, exon 1
          Length = 880

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 435 gtgccggtgatggggatggtggccaggtg 463
           ||||| ||||||||||||||||| |||||
Sbjct: 692 gtgccagtgatggggatggtggcaaggtg 664



to top

>gb|AC022118.5| Homo sapiens chromosome 5 clone CTC-548H10, complete sequence
          Length = 104094

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 349   cgacccagaagatccagtggt 369
             |||||||||||||||||||||
Sbjct: 41186 cgacccagaagatccagtggt 41166



to top

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 405 gcgccgaggctcctcgccgggttgaatgccgtgccggtgatggggatggtggc 457
           ||||| || ||||| |||||||||| | | ||||||||||| || ||||||||
Sbjct: 726 gcgccaagactcctagccgggttgattccggtgccggtgatcggaatggtggc 674



to top

>gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (PIP1;1) mRNA, complete cds
          Length = 1160

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 62/73 (84%), Gaps = 2/73 (2%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatg 446
           |||||||||||||||| || || || ||||| || ||||| |||||| || || ||||||
Sbjct: 829 tgttgtagatgatggcagctccaagactcctggctgggtt-aatgccagttccagtgatg 771

                        
Query: 447 gggatggtggcca 459
           || ||||||||||
Sbjct: 770 ggaatggtggcca 758



to top

>gb|AC153823.5| Mus musculus 10 BAC RP23-11M21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 210101

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 127   acatcaaacttggaagacaaa 147
             |||||||||||||||||||||
Sbjct: 24157 acatcaaacttggaagacaaa 24177



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 341    gaaggggccgacccagaagatccagtggt 369
              ||||||||||| |||| ||||||||||||
Sbjct: 208925 gaaggggccgatccagtagatccagtggt 208953



to top

>gb|AY957387.1| Pseudomonas stutzeri DnrE (dnrE) gene, complete cds; NarL-like (narL)
            and NarX-like (narX) genes, complete sequence; NarK
            (narK), NarM (narM), NarG (narG), NarH (narH), NarJ
            (narJ), and NarI (narI) genes, complete cds; and unknown
            gene
          Length = 15150

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 332  ggcgccgatgaaggggccgacccag 356
            |||||||||||||||||||| ||||
Sbjct: 5753 ggcgccgatgaaggggccgatccag 5729



to top

>ref|NM_211463.1| Eremothecium gossypii AGL266Cp (AGL266C), mRNA
          Length = 1353

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 341  gaaggggccgacccagaagatccagtggt 369
            ||||||||||| |||| ||||||||||||
Sbjct: 1260 gaaggggccgatccagtagatccagtggt 1232



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 435 gtgccggtgatggggatggtggccaggtg 463
           ||||| ||||| |||||||||||||||||
Sbjct: 729 gtgcctgtgattgggatggtggccaggtg 701



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 47/53 (88%), Gaps = 2/53 (3%)
 Strand = Plus / Minus

                                                                
Query: 408 ccgaggctcctcgccgggttgaatgccg-tgccggtgatggggatggtggcca 459
           ||||| ||||| |||||||||| ||||| |||||||||  |||||||||||||
Sbjct: 757 ccgagactcctggccgggttga-tgccggtgccggtgactgggatggtggcca 706



to top

>gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 171960

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 127    acatcaaacttggaagacaaa 147
              |||||||||||||||||||||
Sbjct: 121183 acatcaaacttggaagacaaa 121203



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 87/109 (79%)
 Strand = Plus / Minus

                                                                       
Query: 351 acccagaagatccagtggtctgaccaggcgtgctccctgttgtagatgatggccgcgccg 410
           ||||||||||||||||||||   ||| || |  ||  ||||||||||||| || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                                                            
Query: 411 aggctcctcgccgggttgaatgccgtgccggtgatggggatggtggcca 459
           || ||||| || |||||||   | || |||||||| |||||||||||||
Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggcca 717



to top

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 435 gtgccggtgatggggatggtggcca 459
           ||||| |||||||||||||||||||
Sbjct: 787 gtgccagtgatggggatggtggcca 763



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 435 gtgccggtgatggggatggtggcca 459
           ||||||||||| |||||||||||||
Sbjct: 754 gtgccggtgattgggatggtggcca 730



to top

>gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, complete cds
          Length = 1278

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 101/125 (80%), Gaps = 2/125 (1%)
 Strand = Plus / Minus

                                                                        
Query: 336  ccgatgaaggggccgacccagaagatccagtggtctgaccaggcgtgctccctgttgtag 395
            ||||||||||| || |||||||| ||||| ||||| | ||| || ||   ||||||||| 
Sbjct: 1012 ccgatgaagggtcccacccagaaaatccaatggtcagcccaagcatggggcctgttgtaa 953

                                                                        
Query: 396  atgatggccgcgccgaggctcctcgccgggttgaatgcc-gtgccggtgatggggatggt 454
            ||||| || || || || ||||| || |||||| ||||| ||||| || | |||||||||
Sbjct: 952  atgatagcagcaccaagactcctggctgggttg-atgccagtgccagtaacggggatggt 894

                 
Query: 455  ggcca 459
            |||||
Sbjct: 893  ggcca 889



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 435 gtgccggtgatggggatggtggcca 459
           ||||||||||| |||||||||||||
Sbjct: 270 gtgccggtgattgggatggtggcca 246



to top

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 435 gtgccggtgatggggatggtggcca 459
           ||||| |||||||||||||||||||
Sbjct: 571 gtgccagtgatggggatggtggcca 547



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 315     tagatggcggccagcgcggcgccgatga 342
               ||||| ||||||||| ||||||||||||
Sbjct: 3446908 tagatcgcggccagcccggcgccgatga 3446881



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 988 cttgaatgggatggctctgatgac 965



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 336 ccgatgaaggggccgacccagaagatccagtg 367
           |||||||| || ||||||||||| ||||||||
Sbjct: 840 ccgatgaatggcccgacccagaaaatccagtg 809



to top

>ref|XM_550604.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 ggcgccgatgaaggggccga 351
           ||||||||||||||||||||
Sbjct: 987 ggcgccgatgaaggggccga 968



to top

>ref|XM_521983.1| PREDICTED: Pan troglodytes similar to expressed sequence AI841794
           (LOC466584), mRNA
          Length = 1269

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 15  tgctggatttgcacaacaac 34
           ||||||||||||||||||||
Sbjct: 407 tgctggatttgcacaacaac 426



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 59/72 (81%)
 Strand = Plus / Minus

                                                                       
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggttgaatgccgtgccggtgatgg 447
           ||||||||||||| || || || || ||||| || |||||||   | || |||||||| |
Sbjct: 778 tgttgtagatgatagcagctccaagactcctggcagggttgataccagttccggtgattg 719

                       
Query: 448 ggatggtggcca 459
           ||||||||||||
Sbjct: 718 ggatggtggcca 707



to top

>ref|NM_001005210.1| Homo sapiens leucine rich repeat containing 55 (LRRC55), mRNA
          Length = 3797

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 15  tgctggatttgcacaacaac 34
           ||||||||||||||||||||
Sbjct: 554 tgctggatttgcacaacaac 573



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   cggtgatggggatggtggcc 458
             ||||||||||||||||||||
Sbjct: 96319 cggtgatggggatggtggcc 96338



to top

>gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete sequence
          Length = 136866

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 332   ggcgccgatgaaggggccga 351
             ||||||||||||||||||||
Sbjct: 82946 ggcgccgatgaaggggccga 82927



to top

>gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic protein 1B-like
           protein mRNA, complete cds
          Length = 833

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 671 cttgaatgggattgctctgatgac 648



to top

>gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds
          Length = 358

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccagaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 91  acccagaagatccagtggtc 72



to top

>emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in linkage group 10,
             complete sequence
          Length = 127879

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   cagaaagaaattcactcaga 216
             ||||||||||||||||||||
Sbjct: 53978 cagaaagaaattcactcaga 53997



to top

>gb|AC007528.5| Homo sapiens 12 BAC RP11-473N11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188451

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    cagagcaagagcaagagtag 125
              ||||||||||||||||||||
Sbjct: 155822 cagagcaagagcaagagtag 155841



to top

>emb|CR733851.2|CNS0GT0Q Tetraodon nigroviridis full-length cDNA
          Length = 502

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 358 agatccagtggtctgaccag 377
           ||||||||||||||||||||
Sbjct: 365 agatccagtggtctgaccag 384



to top

>emb|X62669.1|MMHOX4 M.musculus genes HOX-4.4 and Hox-4.5
          Length = 8601

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  cgccgaggctcctcgccggg 425
            ||||||||||||||||||||
Sbjct: 6403 cgccgaggctcctcgccggg 6384



to top

>emb|AL355384.6| Human DNA sequence from clone RP11-626C11 on chromosome 10 Contains a
             CpG island, complete sequence
          Length = 159305

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 350   gacccagaagatccagtggt 369
             ||||||||||||||||||||
Sbjct: 96077 gacccagaagatccagtggt 96058



to top

>emb|AL117377.18|HSJ1037B9 Human DNA sequence from clone RP5-1037B9 on chromosome 20p12.1-13
             Contains STSs, GSSs and a putative CpG island, complete
             sequence
          Length = 82183

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   cacatcaaacttggaagaca 145
             ||||||||||||||||||||
Sbjct: 72891 cacatcaaacttggaagaca 72872



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 908 cttgaatgggatggctctgatgac 885



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 336 ccgatgaaggggccgacccagaagatccagtg 367
           |||||||| || ||||||||||| ||||||||
Sbjct: 806 ccgatgaatggcccgacccagaaaatccagtg 775



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 acccagaagatccagtggtc 370
           ||||||||||||||||||||
Sbjct: 863 acccagaagatccagtggtc 844



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 849 cttgaatgggatggctctgatgac 826



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 903 cttgaatgggatggctctgatgac 880



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 281 cttgaatgggatcgctctgatgac 304
           |||||||||||| |||||||||||
Sbjct: 909 cttgaatgggatggctctgatgac 886



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 317    gatggcggccagcgcggcgc 336
              ||||||||||||||||||||
Sbjct: 539763 gatggcggccagcgcggcgc 539782



to top

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 190     cccccatcagaaagaaattcactc 213
               ||||||||||||| ||||||||||
Sbjct: 1961051 cccccatcagaaacaaattcactc 1961028



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 388 tgttgtagatgatggccgcgccgaggctcctcgccgggtt 427
           ||||| |||| | ||| ||||||| |||||||||||||||
Sbjct: 464 tgttgaagatcacggcggcgccgaagctcctcgccgggtt 425



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 317     gatggcggccagcgcggcgccgat 340
               |||||| |||||||||||||||||
Sbjct: 1468545 gatggccgccagcgcggcgccgat 1468568



to top

>gb|AC182472.3| Pan troglodytes BAC clone CH251-394C9 from chromosome 19, complete
              sequence
          Length = 165954

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 247    catctttctttgtagcagcagctt 270
              |||||||| |||||||||||||||
Sbjct: 108793 catctttcattgtagcagcagctt 108770



to top

>dbj|AK127591.1| Homo sapiens cDNA FLJ45686 fis, clone FCBBF3012443
          Length = 3797

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 15  tgctggatttgcacaacaac 34
           ||||||||||||||||||||
Sbjct: 554 tgctggatttgcacaacaac 573



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 319     tggcggccagcgcggcgccg 338
               ||||||||||||||||||||
Sbjct: 4507898 tggcggccagcgcggcgccg 4507879



to top

>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 281   cttgaatgggatcgctctgatgac 304
             |||||||||||| |||||||||||
Sbjct: 15226 cttgaatgggatggctctgatgac 15249


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,459,655
Number of Sequences: 3902068
Number of extensions: 4459655
Number of successful extensions: 88080
Number of sequences better than 10.0: 293
Number of HSP's better than 10.0 without gapping: 285
Number of HSP's successfully gapped in prelim test: 11
Number of HSP's that attempted gapping in prelim test: 86871
Number of HSP's gapped (non-prelim): 1148
length of query: 465
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 443
effective length of database: 17,147,199,772
effective search space: 7596209498996
effective search space used: 7596209498996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top