>gb|AY108500.1| Zea mays PCO136059 mRNA sequence
          Length = 1188

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 358 tcacaggccgagcaggatgtantanacgagcgtgatgggcagggcgatgag 408
           ||||||||||||||||||||| || ||||||||||| ||||||||||||||
Sbjct: 571 tcacaggccgagcaggatgtagtagacgagcgtgatcggcagggcgatgag 521

>gb|AY496058.1| Triticum aestivum auxin transporter PIN1 mRNA, complete cds
          Length = 1764

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 358  tcacaggccgagcaggatgtantanacgagcgtgatgggcagggcgatgag 408
            ||||||||||||||||||||| || || |||||||||||||| ||||||||
Sbjct: 1764 tcacaggccgagcaggatgtagtagaccagcgtgatgggcagcgcgatgag 1714

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                  
Query: 358     tcacaggccgagcaggatgtantanacgagcgtgatgggcagggcgatgag 408
               |||||| || ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 6879785 tcacagccccagcaggatgtagtacaccagcgtgatgggcagcgcgatgag 6879735

>dbj|AP005522.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0479H10
          Length = 139874

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                
Query: 358   tcacaggccgagcaggatgtantanacgagcgtgatgggcagggcgatgag 408
             |||||| || ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 69310 tcacagccccagcaggatgtagtacaccagcgtgatgggcagcgcgatgag 69260

>dbj|AK103208.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033122I23, full
            insert sequence
          Length = 2470

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 358  tcacaggccgagcaggatgtantanacgagcgtgatgggcagggcgatgag 408
            |||||| || ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 1917 tcacagccccagcaggatgtagtacaccagcgtgatgggcagcgcgatgag 1867

>gb|AY110494.1| Zea mays CL464_-1 mRNA sequence
          Length = 2737

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 355  ggctcacaggccgagcaggatgtantanacgagcgtgatgggcagggcgatgag 408
            ||||||||| || |||| |||||| || || || ||||||||||| ||||||||
Sbjct: 2212 ggctcacagccccagcaagatgtagtagaccagggtgatgggcagagcgatgag 2159

>gb|AC091769.6| Homo sapiens chromosome 10 clone RP11-205A8, complete sequence
          Length = 173450

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 305    ctgctcctgagcccgcagcagc 326
              ||||||||||||||||||||||
Sbjct: 138619 ctgctcctgagcccgcagcagc 138598

>emb|AL645469.18| Mouse DNA sequence from clone RP23-340E18 on chromosome 11 Contains the
              Mylc2a gene for myosin light chain, regulatory A, the Gck
              gene for glucokinase, a novel gene, the gene for prenylated
              SNARE protein (Ykt6), the Camk2d gene for
              calcium/calmodulin-dependent protein kinase II delta and
              two CpG islands, complete sequence
          Length = 172356

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 273    tgaagagccccctggtggtca 293
              |||||||||||||||||||||
Sbjct: 103086 tgaagagccccctggtggtca 103066

>gb|AC103896.3| Papio anubis clone RP41-441D23, complete sequence
          Length = 156540

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   tctgcgaccccagtcccccc 124
             ||||||||||||||||||||
Sbjct: 41195 tctgcgaccccagtcccccc 41214

>gb|AC022699.11| Mus musculus chromosome 10, clone RP23-107I8, complete sequence
          Length = 225763

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 225   cttgctgctctagagagacc 244
             ||||||||||||||||||||
Sbjct: 88528 cttgctgctctagagagacc 88509

>ref|XM_848576.1| PREDICTED: Canis familiaris similar to mitogen activated protein
            kinase binding protein 1, transcript variant 2
            (LOC484565), mRNA
          Length = 4682

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 327  gaagccatggacctttacaa 346
            ||||||||||||||||||||
Sbjct: 4312 gaagccatggacctttacaa 4331

>ref|XM_541679.2| PREDICTED: Canis familiaris similar to mitogen activated protein
            kinase binding protein 1, transcript variant 1
            (LOC484565), mRNA
          Length = 4649

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 327  gaagccatggacctttacaa 346
            ||||||||||||||||||||
Sbjct: 4279 gaagccatggacctttacaa 4298

>emb|CR847799.17| Zebrafish DNA sequence from clone DKEY-117P4 in linkage group 8, complete
              sequence
          Length = 128900

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 76     tcgcaagcccctttcaaaac 95
              ||||||||||||||||||||
Sbjct: 115721 tcgcaagcccctttcaaaac 115702

>emb|AL391334.16| Human DNA sequence from clone RP11-142F1 on chromosome 10, complete
             sequence
          Length = 97430

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   tcccctgcccttctgactgt 173
             ||||||||||||||||||||
Sbjct: 77652 tcccctgcccttctgactgt 77671

>emb|AL359921.13| Human DNA sequence from clone RP11-385F5 on chromosome 1 Contains a novel
              gene, the LGALS8 gene for lectin, galactoside-binding,
              soluble, 8 (galectin 8), the gene for protein BAP28
              (FLJ10359), a novel gene, the 5' end of the ACTN2 gene for
              actinin, alpha 2 and three CpG islands, complete sequence
          Length = 213757

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 150    ttcttcccctgcccttctga 169
              ||||||||||||||||||||
Sbjct: 116763 ttcttcccctgcccttctga 116744

>emb|AL139044.15| Human DNA sequence from clone RP11-6B20 on chromosome 6 Contains the
            ITPR3 gene for inositol 1,4,5-triphosphate receptor type
            3, a novel gene and the IHPK3 gene for inositol
            hexaphosphate kinase 3, complete sequence
          Length = 134250

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 146  ttgcttcttcccctgccctt 165
            ||||||||||||||||||||
Sbjct: 9083 ttgcttcttcccctgccctt 9102

>emb|BX569798.16| Zebrafish DNA sequence from clone DKEY-26I13 in linkage group 1, complete
              sequence
          Length = 215607

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      tgaacaagacaatcaaggtc 22
              ||||||||||||||||||||
Sbjct: 169256 tgaacaagacaatcaaggtc 169237

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 80      aagcccctttcaaaaccgaa 99
               ||||||||||||||||||||
Sbjct: 2893217 aagcccctttcaaaaccgaa 2893236

>gb|AC102304.6| Mus musculus chromosome 7, clone RP24-403P14, complete sequence
          Length = 153206

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     caagacaatcaaggtcagtt 26
             ||||||||||||||||||||
Sbjct: 61934 caagacaatcaaggtcagtt 61953

>emb|BX323558.7| Zebrafish DNA sequence from clone CH211-214J24 in linkage group 4,
             complete sequence
          Length = 160379

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     tgaacaagacaatcaaggtc 22
             ||||||||||||||||||||
Sbjct: 92781 tgaacaagacaatcaaggtc 92800

>gb|AC171072.2| Rhesus Macaque CHR7 BAC CH250-508E7 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 165491

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    tctgcgaccccagtcccccc 124
              ||||||||||||||||||||
Sbjct: 112443 tctgcgaccccagtcccccc 112462


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,860,508
Number of Sequences: 3902068
Number of extensions: 2860508
Number of successful extensions: 49148
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49040
Number of HSP's gapped (non-prelim): 108
length of query: 408
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 386
effective length of database: 17,147,199,772
effective search space: 6618819111992
effective search space used: 6618819111992
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)