| Clone Name | rbaet70d12 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Y14201.1|HVY14201 Hordeum vulgare mRNA for hypothetical protein, clone pBH6-12 Length = 829 Score = 87.7 bits (44), Expect = 2e-15 Identities = 44/44 (100%) Strand = Plus / Minus Query: 1 gctcaaccttgcgaacgttgatttattccattccaggcagtaca 44 |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 828 gctcaaccttgcgaacgttgatttattccattccaggcagtaca 785
>gb|U32431.1|TAU32431 Triticum aestivum mRNA, clone WCI-5, complete cds Length = 862 Score = 54.0 bits (27), Expect = 2e-05 Identities = 30/31 (96%) Strand = Plus / Minus Query: 14 aacgttgatttattccattccaggcagtaca 44 |||| |||||||||||||||||||||||||| Sbjct: 831 aacgctgatttattccattccaggcagtaca 801
>emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chromosome 11 Contains the 3' end of the Slfn3 gene for schlafen 3, a novel gene, two schlafen (Slfn) pseudogenes, the Pex12 gene for peroxisomal biogenesis factor 12 and the Ap2b1 gene for adaptor-related protein complex 2 beta 1 subunit, complete sequence Length = 204523 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 21 atttattccattccaggca 39 ||||||||||||||||||| Sbjct: 117562 atttattccattccaggca 117580
>gb|AC124036.5| Mus Musculus Strain C57BL6/J chromosome 11 BAC Clone RP24-100D7, Complete Sequence, complete sequence Length = 228907 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 21 atttattccattccaggca 39 ||||||||||||||||||| Sbjct: 34786 atttattccattccaggca 34768
>gb|M57692.1|TTPULSA Thermoanaerobacterium thermosulfurigenes pullulanase (amyB) maltose-binding protein (amyE), membrane proteins for maltose transport (amyD and amyC), and alpha-cyclodextrin glycosyltransferase (amyA) genes, complete cds Length = 12854 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 gttgatttattccattcca 35 ||||||||||||||||||| Sbjct: 8966 gttgatttattccattcca 8948
>emb|AL713883.1|CNS07YP0 Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6) clone 179H3 of library Caltech CITB-BAC from chromosome 11 of Mus musculus (mouse) Length = 168835 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 21 atttattccattccaggca 39 ||||||||||||||||||| Sbjct: 92398 atttattccattccaggca 92380
>gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, complete sequence Length = 168364 Score = 36.2 bits (18), Expect = 5.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 23 ttattccattccaggcagtaca 44 ||||||| |||||||||||||| Sbjct: 33222 ttattcccttccaggcagtaca 33243
>gb|AC140212.2| Mus musculus BAC clone RP23-267G14 from chromosome 15, complete sequence Length = 177379 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ttgatttattccattcca 35 |||||||||||||||||| Sbjct: 114871 ttgatttattccattcca 114888
>emb|AL356490.14| Human DNA sequence from clone RP11-333B6 on chromosome 9, complete sequence Length = 46676 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 21 atttattccattccaggc 38 |||||||||||||||||| Sbjct: 28678 atttattccattccaggc 28695
>emb|AL137078.20| Human DNA sequence from clone RP1-66N13 on chromosome 20 Contains a novel gene (LOC284749) and two novel genes, complete sequence Length = 80725 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 19 tgatttattccattccag 36 |||||||||||||||||| Sbjct: 34589 tgatttattccattccag 34606
>emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chromosome 1 Contains the 5' end of a novel gene, a novel gene, a macrophage stimulating 1 (hepatocyte growth factor-like)(MST1) pseudogene and three CpG islands, complete sequence Length = 146141 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ttgatttattccattcca 35 |||||||||||||||||| Sbjct: 94553 ttgatttattccattcca 94536
>emb|AL928666.7| Mouse DNA sequence from clone RP23-216G14 on chromosome 11, complete sequence Length = 91110 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 22 tttattccattccaggca 39 |||||||||||||||||| Sbjct: 21514 tttattccattccaggca 21497
>gb|AC109441.3| Homo sapiens chromosome 5 clone CTC-269P20, complete sequence Length = 89908 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 17 gttgatttattccattcc 34 |||||||||||||||||| Sbjct: 70904 gttgatttattccattcc 70887
>gb|AC084364.20| Homo sapiens 12q BAC RP11-626I20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 104791 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 25 attccattccaggcagta 42 |||||||||||||||||| Sbjct: 28584 attccattccaggcagta 28567
>gb|AC008473.6| Homo sapiens chromosome 5 clone CTC-375J15, complete sequence Length = 98360 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 gttgatttattccattcc 34 |||||||||||||||||| Sbjct: 25846 gttgatttattccattcc 25863
>emb|AJ234823.1|HVU234823 Hordeum vulgare genomic DNA fragment; clone MWG2181.rev Length = 440 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 22 tttattccattccaggca 39 |||||||||||||||||| Sbjct: 287 tttattccattccaggca 304
>emb|AL157689.3|CNS01RG1 Human chromosome 14 DNA sequence BAC R-1075M22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 216457 Score = 36.2 bits (18), Expect = 5.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 22 tttattccattccaggcagtac 43 ||||||||||| |||||||||| Sbjct: 100615 tttattccatttcaggcagtac 100636
>gb|AC005772.1|AC005772 Homo sapiens chromosome 17, clone hRPK.924_A_14, complete sequence Length = 175339 Score = 36.2 bits (18), Expect = 5.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 11 gcgaacgttgatttattccatt 32 ||||| |||||||||||||||| Sbjct: 111156 gcgaatgttgatttattccatt 111177
>dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete genome Length = 452528 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 22 tttattccattccaggca 39 |||||||||||||||||| Sbjct: 253783 tttattccattccaggca 253766 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 395,188 Number of Sequences: 3902068 Number of extensions: 395188 Number of successful extensions: 82020 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 81990 Number of HSP's gapped (non-prelim): 30 length of query: 44 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 24 effective length of database: 17,155,003,908 effective search space: 411720093792 effective search space used: 411720093792 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)