ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet70d12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Y14201.1|HVY14201 Hordeum vulgare mRNA for hypothetical prot... 88 2e-15
2gb|U32431.1|TAU32431 Triticum aestivum mRNA, clone WCI-5, comple... 54 2e-05
3emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chr... 38 1.3
4gb|AC124036.5| Mus Musculus Strain C57BL6/J chromosome 11 BAC Cl... 38 1.3
5gb|M57692.1|TTPULSA Thermoanaerobacterium thermosulfurigenes pul... 38 1.3
6emb|AL713883.1|CNS07YP0 Mus musculus chromosome 11 region in the... 38 1.3
7gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, co... 36 5.3
8gb|AC140212.2| Mus musculus BAC clone RP23-267G14 from chromosom... 36 5.3
9emb|AL356490.14| Human DNA sequence from clone RP11-333B6 on chr... 36 5.3
10emb|AL137078.20| Human DNA sequence from clone RP1-66N13 on chro... 36 5.3
11emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chr... 36 5.3
12emb|AL928666.7| Mouse DNA sequence from clone RP23-216G14 on chr... 36 5.3
13gb|AC109441.3| Homo sapiens chromosome 5 clone CTC-269P20, compl... 36 5.3
14gb|AC084364.20| Homo sapiens 12q BAC RP11-626I20 (Roswell Park C... 36 5.3
15gb|AC008473.6| Homo sapiens chromosome 5 clone CTC-375J15, compl... 36 5.3
16emb|AJ234823.1|HVU234823 Hordeum vulgare genomic DNA fragment; c... 36 5.3
17emb|AL157689.3|CNS01RG1 Human chromosome 14 DNA sequence BAC R-1... 36 5.3
18gb|AC005772.1|AC005772 Homo sapiens chromosome 17, clone hRPK.92... 36 5.3
19dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete ge... 36 5.3

>emb|Y14201.1|HVY14201 Hordeum vulgare mRNA for hypothetical protein, clone pBH6-12
          Length = 829

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 44/44 (100%)
 Strand = Plus / Minus

                                                       
Query: 1   gctcaaccttgcgaacgttgatttattccattccaggcagtaca 44
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 828 gctcaaccttgcgaacgttgatttattccattccaggcagtaca 785



to top

>gb|U32431.1|TAU32431 Triticum aestivum mRNA, clone WCI-5, complete cds
          Length = 862

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 14  aacgttgatttattccattccaggcagtaca 44
           |||| ||||||||||||||||||||||||||
Sbjct: 831 aacgctgatttattccattccaggcagtaca 801



to top

>emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chromosome 11 Contains the
              3' end of the Slfn3 gene for schlafen 3, a novel gene, two
              schlafen (Slfn) pseudogenes, the Pex12 gene for peroxisomal
              biogenesis factor 12 and the Ap2b1 gene for adaptor-related
              protein complex 2 beta 1 subunit, complete sequence
          Length = 204523

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     atttattccattccaggca 39
              |||||||||||||||||||
Sbjct: 117562 atttattccattccaggca 117580



to top

>gb|AC124036.5| Mus Musculus Strain C57BL6/J chromosome 11 BAC Clone RP24-100D7,
             Complete Sequence, complete sequence
          Length = 228907

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    atttattccattccaggca 39
             |||||||||||||||||||
Sbjct: 34786 atttattccattccaggca 34768



to top

>gb|M57692.1|TTPULSA Thermoanaerobacterium thermosulfurigenes pullulanase (amyB)
            maltose-binding protein (amyE), membrane proteins for
            maltose transport (amyD and amyC), and alpha-cyclodextrin
            glycosyltransferase (amyA) genes, complete cds
          Length = 12854

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 17   gttgatttattccattcca 35
            |||||||||||||||||||
Sbjct: 8966 gttgatttattccattcca 8948



to top

>emb|AL713883.1|CNS07YP0 Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 179H3 of library Caltech CITB-BAC from chromosome 11
             of Mus musculus (mouse)
          Length = 168835

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    atttattccattccaggca 39
             |||||||||||||||||||
Sbjct: 92398 atttattccattccaggca 92380



to top

>gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, complete sequence
          Length = 168364

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 23    ttattccattccaggcagtaca 44
             ||||||| ||||||||||||||
Sbjct: 33222 ttattcccttccaggcagtaca 33243



to top

>gb|AC140212.2| Mus musculus BAC clone RP23-267G14 from chromosome 15, complete sequence
          Length = 177379

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 18     ttgatttattccattcca 35
              ||||||||||||||||||
Sbjct: 114871 ttgatttattccattcca 114888



to top

>emb|AL356490.14| Human DNA sequence from clone RP11-333B6 on chromosome 9, complete
             sequence
          Length = 46676

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 21    atttattccattccaggc 38
             ||||||||||||||||||
Sbjct: 28678 atttattccattccaggc 28695



to top

>emb|AL137078.20| Human DNA sequence from clone RP1-66N13 on chromosome 20 Contains a
             novel gene (LOC284749) and two novel genes, complete
             sequence
          Length = 80725

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 19    tgatttattccattccag 36
             ||||||||||||||||||
Sbjct: 34589 tgatttattccattccag 34606



to top

>emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chromosome 1 Contains the
             5' end of a novel gene, a novel gene, a macrophage
             stimulating 1 (hepatocyte growth factor-like)(MST1)
             pseudogene and three CpG islands, complete sequence
          Length = 146141

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 18    ttgatttattccattcca 35
             ||||||||||||||||||
Sbjct: 94553 ttgatttattccattcca 94536



to top

>emb|AL928666.7| Mouse DNA sequence from clone RP23-216G14 on chromosome 11, complete
             sequence
          Length = 91110

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    tttattccattccaggca 39
             ||||||||||||||||||
Sbjct: 21514 tttattccattccaggca 21497



to top

>gb|AC109441.3| Homo sapiens chromosome 5 clone CTC-269P20, complete sequence
          Length = 89908

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    gttgatttattccattcc 34
             ||||||||||||||||||
Sbjct: 70904 gttgatttattccattcc 70887



to top

>gb|AC084364.20| Homo sapiens 12q BAC RP11-626I20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 104791

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 25    attccattccaggcagta 42
             ||||||||||||||||||
Sbjct: 28584 attccattccaggcagta 28567



to top

>gb|AC008473.6| Homo sapiens chromosome 5 clone CTC-375J15, complete sequence
          Length = 98360

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 17    gttgatttattccattcc 34
             ||||||||||||||||||
Sbjct: 25846 gttgatttattccattcc 25863



to top

>emb|AJ234823.1|HVU234823 Hordeum vulgare genomic DNA fragment; clone MWG2181.rev
          Length = 440

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 22  tttattccattccaggca 39
           ||||||||||||||||||
Sbjct: 287 tttattccattccaggca 304



to top

>emb|AL157689.3|CNS01RG1 Human chromosome 14 DNA sequence BAC R-1075M22 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 216457

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 22     tttattccattccaggcagtac 43
              ||||||||||| ||||||||||
Sbjct: 100615 tttattccatttcaggcagtac 100636



to top

>gb|AC005772.1|AC005772 Homo sapiens chromosome 17, clone hRPK.924_A_14, complete sequence
          Length = 175339

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 11     gcgaacgttgatttattccatt 32
              ||||| ||||||||||||||||
Sbjct: 111156 gcgaatgttgatttattccatt 111177



to top

>dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete genome
          Length = 452528

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     tttattccattccaggca 39
              ||||||||||||||||||
Sbjct: 253783 tttattccattccaggca 253766


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 395,188
Number of Sequences: 3902068
Number of extensions: 395188
Number of successful extensions: 82020
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81990
Number of HSP's gapped (non-prelim): 30
length of query: 44
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 24
effective length of database: 17,155,003,908
effective search space: 411720093792
effective search space used: 411720093792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top