Clone Name	rbaet70c12
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT016269.1| Zea mays clone Contig102 mRNA sequence	293	2e-76
2	gb|AY103919.1| Zea mays PCO099246 mRNA sequence	293	2e-76
3	gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence	285	6e-74
4	gb|BT016705.1| Zea mays clone Contig538 mRNA sequence	274	2e-70
5	ref|XM_475866.1| Oryza sativa (japonica cultivar-group), predic...	260	3e-66
6	dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clon...	260	3e-66
7	dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clon...	260	3e-66
8	dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clon...	260	3e-66
9	ref|NM_192099.1| Oryza sativa (japonica cultivar-group), predic...	236	5e-59
10	dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	5e-59
11	dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	5e-59
12	dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	5e-59
13	dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RW...	236	5e-59
14	dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clon...	228	1e-56
15	gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome...	172	6e-40
16	gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome...	172	6e-40
17	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	172	6e-40
18	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
19	dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
20	dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic D...	153	6e-34
21	emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein bet...	70	7e-09
22	gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like...	70	7e-09
23	emb|BX071356.1|CNS09R80 Single read from an extremity of a full-...	60	6e-06
24	emb|BX071355.1|CNS09R7Z Single read from an extremity of a full-...	60	6e-06
25	emb|BX012321.1|CNS08HO5 Single read from an extremity of a full-...	60	6e-06
26	emb|BX012320.1|CNS08HO4 Single read from an extremity of a full-...	60	6e-06
27	gb|DQ122924.1| Chlamydomonas incerta G protein beta subunit-like...	60	6e-06
28	ref|XM_954977.1| Neurospora crassa OR74A hypothetical protein (N...	58	3e-05
29	ref|XM_325664.1| Neurospora crassa OR74A hypothetical protein (N...	58	3e-05
30	ref|XM_656675.1| Aspergillus nidulans FGSC A4 guanine nucleotide...	58	3e-05
31	ref|XM_753462.1| Ustilago maydis 521 hypothetical protein (UM024...	58	3e-05
32	emb|X81875.1|NCCPC2 N.crassa cpc-2 gene	58	3e-05
33	dbj|AB226203.1| Aspergillus oryzae cDNA, contig sequence: AoEST3062	58	3e-05
34	dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009	58	3e-05
35	gb|AF176775.1|AF176775 Emericella nidulans Gbeta like protein (c...	58	3e-05
36	gb|AF548359.2| Paracoccidioides brasiliensis RACK1-like protein ...	56	1e-04
37	gb|DQ186603.2| Paracoccidioides brasiliensis RACK1-like protein ...	56	1e-04
38	emb|BX019636.1|CNS08NBC Single read from an extremity of a full-...	56	1e-04
39	ref|NM_101670.2| Arabidopsis thaliana ATARCA; nucleotide binding...	54	4e-04
40	gb|AC093195.2| Drosophila melanogaster clone BACR16J09, complete...	54	4e-04
41	gb|AC008328.6| Drosophila melanogaster clone BACR09A04, complete...	54	4e-04
42	gb|AY231739.1| Drosophila yakuba clone yak-em_Rack1 mRNA sequence	54	4e-04
43	emb|BX053466.1|CNS09DF2 Single read from an extremity of a full-...	54	4e-04
44	emb|BX053465.1|CNS09DF1 Single read from an extremity of a full-...	54	4e-04
45	emb|BX053355.1|CNS09DBZ Single read from an extremity of a full-...	54	4e-04
46	emb|BX053354.1|CNS09DBY Single read from an extremity of a full-...	54	4e-04
47	emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-...	54	4e-04
48	emb|BX024636.1|CNS08R68 Single read from an extremity of a full-...	54	4e-04
49	emb|BX072073.1|CNS09RRX Single read from an extremity of a full-...	54	4e-04
50	emb|BX071929.1|CNS09RNX Single read from an extremity of a full-...	54	4e-04
51	emb|BX071928.1|CNS09RNW Single read from an extremity of a full-...	54	4e-04
52	emb|BX071907.1|CNS09RNB Single read from an extremity of a full-...	54	4e-04
53	emb|BX071775.1|CNS09RJN Single read from an extremity of a full-...	54	4e-04
54	emb|BX071774.1|CNS09RJM Single read from an extremity of a full-...	54	4e-04
55	emb|BX071717.1|CNS09RI1 Single read from an extremity of a full-...	54	4e-04
56	emb|BX071716.1|CNS09RI0 Single read from an extremity of a full-...	54	4e-04
57	emb|BX071585.1|CNS09RED Single read from an extremity of a full-...	54	4e-04
58	emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-...	54	4e-04
59	emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-...	54	4e-04
60	emb|BX071037.1|CNS09QZ5 Single read from an extremity of a full-...	54	4e-04
61	emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-...	54	4e-04
62	emb|BX070941.1|CNS09QWH Single read from an extremity of a full-...	54	4e-04
63	emb|BX070940.1|CNS09QWG Single read from an extremity of a full-...	54	4e-04
64	emb|BX070678.1|CNS09QP6 Single read from an extremity of a full-...	54	4e-04
65	emb|BX070378.1|CNS09QGU Single read from an extremity of a full-...	54	4e-04
66	emb|BX070186.1|CNS09QBI Single read from an extremity of a full-...	54	4e-04
67	emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-...	54	4e-04
68	emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-...	54	4e-04
69	emb|BX069810.1|CNS09Q12 Single read from an extremity of a full-...	54	4e-04
70	emb|BX069809.1|CNS09Q11 Single read from an extremity of a full-...	54	4e-04
71	emb|BX069778.1|CNS09Q06 Single read from an extremity of a full-...	54	4e-04
72	emb|BX069777.1|CNS09Q05 Single read from an extremity of a full-...	54	4e-04
73	emb|BX069457.1|CNS09PR9 Single read from an extremity of a full-...	54	4e-04
74	emb|BX069079.1|CNS09PGR Single read from an extremity of a full-...	54	4e-04
75	emb|BX069078.1|CNS09PGQ Single read from an extremity of a full-...	54	4e-04
76	emb|BX068759.1|CNS09P7V Single read from an extremity of a full-...	54	4e-04
77	emb|BX068758.1|CNS09P7U Single read from an extremity of a full-...	54	4e-04
78	emb|BX068670.1|CNS09P5E Single read from an extremity of a full-...	54	4e-04
79	emb|BX068658.1|CNS09P52 Single read from an extremity of a full-...	54	4e-04
80	emb|BX068657.1|CNS09P51 Single read from an extremity of a full-...	54	4e-04
81	emb|BX068642.1|CNS09P4M Single read from an extremity of a full-...	54	4e-04
82	emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-...	54	4e-04
83	emb|BX068364.1|CNS09OWW Single read from an extremity of a full-...	54	4e-04
84	emb|BX068249.1|CNS09OTP Single read from an extremity of a full-...	54	4e-04
85	emb|BX068234.1|CNS09OTA Single read from an extremity of a full-...	54	4e-04
86	emb|BX068233.1|CNS09OT9 Single read from an extremity of a full-...	54	4e-04
87	emb|BX068228.1|CNS09OT4 Single read from an extremity of a full-...	54	4e-04
88	emb|BX068198.1|CNS09OSA Single read from an extremity of a full-...	54	4e-04
89	emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-...	54	4e-04
90	emb|BX068108.1|CNS09OPS Single read from an extremity of a full-...	54	4e-04
91	emb|BX068107.1|CNS09OPR Single read from an extremity of a full-...	54	4e-04
92	emb|BX068050.1|CNS09OO6 Single read from an extremity of a full-...	54	4e-04
93	emb|BX068049.1|CNS09OO5 Single read from an extremity of a full-...	54	4e-04
94	emb|BX068035.1|CNS09ONR Single read from an extremity of a full-...	54	4e-04
95	emb|BX068018.1|CNS09ONA Single read from an extremity of a full-...	54	4e-04
96	emb|BX068017.1|CNS09ON9 Single read from an extremity of a full-...	54	4e-04
97	emb|BX067955.1|CNS09OLJ Single read from an extremity of a full-...	54	4e-04
98	emb|BX067894.1|CNS09OJU Single read from an extremity of a full-...	54	4e-04
99	emb|BX067874.1|CNS09OJA Single read from an extremity of a full-...	54	4e-04
100	emb|BX067850.1|CNS09OIM Single read from an extremity of a full-...	54	4e-04
101	emb|BX067849.1|CNS09OIL Single read from an extremity of a full-...	54	4e-04
102	emb|BX067804.1|CNS09OHC Single read from an extremity of a full-...	54	4e-04
103	emb|BX067803.1|CNS09OHB Single read from an extremity of a full-...	54	4e-04
104	emb|BX067788.1|CNS09OGW Single read from an extremity of a full-...	54	4e-04
105	emb|BX067787.1|CNS09OGV Single read from an extremity of a full-...	54	4e-04
106	emb|BX067705.1|CNS09OEL Single read from an extremity of a full-...	54	4e-04
107	emb|BX067646.1|CNS09OCY Single read from an extremity of a full-...	54	4e-04
108	emb|BX067645.1|CNS09OCX Single read from an extremity of a full-...	54	4e-04
109	emb|BX067635.1|CNS09OCN Single read from an extremity of a full-...	54	4e-04
110	emb|BX067585.1|CNS09OB9 Single read from an extremity of a full-...	54	4e-04
111	emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-...	54	4e-04
112	emb|BX067492.1|CNS09O8O Single read from an extremity of a full-...	54	4e-04
113	emb|BX067491.1|CNS09O8N Single read from an extremity of a full-...	54	4e-04
114	emb|BX066978.1|CNS09NUE Single read from an extremity of a full-...	54	4e-04
115	emb|BX066951.1|CNS09NTN Single read from an extremity of a full-...	54	4e-04
116	emb|BX066950.1|CNS09NTM Single read from an extremity of a full-...	54	4e-04
117	emb|BX066945.1|CNS09NTH Single read from an extremity of a full-...	54	4e-04
118	emb|BX066944.1|CNS09NTG Single read from an extremity of a full-...	54	4e-04
119	emb|BX066941.1|CNS09NTD Single read from an extremity of a full-...	54	4e-04
120	emb|BX066940.1|CNS09NTC Single read from an extremity of a full-...	54	4e-04
121	emb|BX066917.1|CNS09NSP Single read from an extremity of a full-...	54	4e-04
122	emb|BX066916.1|CNS09NSO Single read from an extremity of a full-...	54	4e-04
123	emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-...	54	4e-04
124	emb|BX066716.1|CNS09NN4 Single read from an extremity of a full-...	54	4e-04
125	emb|BX066638.1|CNS09NKY Single read from an extremity of a full-...	54	4e-04
126	emb|BX066637.1|CNS09NKX Single read from an extremity of a full-...	54	4e-04
127	emb|BX066110.1|CNS09N6A Single read from an extremity of a full-...	54	4e-04
128	emb|BX066109.1|CNS09N69 Single read from an extremity of a full-...	54	4e-04
129	emb|BX066047.1|CNS09N4J Single read from an extremity of a full-...	54	4e-04
130	emb|BX066046.1|CNS09N4I Single read from an extremity of a full-...	54	4e-04
131	emb|BX065996.1|CNS09N34 Single read from an extremity of a full-...	54	4e-04
132	emb|BX065949.1|CNS09N1T Single read from an extremity of a full-...	54	4e-04
133	emb|BX065948.1|CNS09N1S Single read from an extremity of a full-...	54	4e-04
134	emb|BX065904.1|CNS09N0K Single read from an extremity of a full-...	54	4e-04
135	emb|BX065815.1|CNS09MY3 Single read from an extremity of a full-...	54	4e-04
136	emb|BX065814.1|CNS09MY2 Single read from an extremity of a full-...	54	4e-04
137	emb|BX065711.1|CNS09MV7 Single read from an extremity of a full-...	54	4e-04
138	emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-...	54	4e-04
139	emb|BX065604.1|CNS09MS8 Single read from an extremity of a full-...	54	4e-04
140	emb|BX065506.1|CNS09MPI Single read from an extremity of a full-...	54	4e-04
141	emb|BX065505.1|CNS09MPH Single read from an extremity of a full-...	54	4e-04
142	emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-...	54	4e-04
143	emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-...	54	4e-04
144	emb|BX065353.1|CNS09ML9 Single read from an extremity of a full-...	54	4e-04
145	emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-...	54	4e-04
146	emb|BX065157.1|CNS09MFT Single read from an extremity of a full-...	54	4e-04
147	emb|BX065023.1|CNS09MC3 Single read from an extremity of a full-...	54	4e-04
148	emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-...	54	4e-04
149	emb|BX064965.1|CNS09MAH Single read from an extremity of a full-...	54	4e-04
150	emb|BX064964.1|CNS09MAG Single read from an extremity of a full-...	54	4e-04
151	emb|BX064854.1|CNS09M7E Single read from an extremity of a full-...	54	4e-04
152	emb|BX064853.1|CNS09M7D Single read from an extremity of a full-...	54	4e-04
153	emb|BX064529.1|CNS09LYD Single read from an extremity of a full-...	54	4e-04
154	emb|BX064405.1|CNS09LUX Single read from an extremity of a full-...	54	4e-04
155	emb|BX064360.1|CNS09LTO Single read from an extremity of a full-...	54	4e-04
156	emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-...	54	4e-04
157	emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-...	54	4e-04
158	emb|BX064233.1|CNS09LQ5 Single read from an extremity of a full-...	54	4e-04
159	emb|BX064232.1|CNS09LQ4 Single read from an extremity of a full-...	54	4e-04
160	emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-...	54	4e-04
161	emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-...	54	4e-04
162	emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-...	54	4e-04
163	emb|BX063936.1|CNS09LHW Single read from an extremity of a full-...	54	4e-04
164	emb|BX063919.1|CNS09LHF Single read from an extremity of a full-...	54	4e-04
165	emb|BX063918.1|CNS09LHE Single read from an extremity of a full-...	54	4e-04
166	emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-...	54	4e-04
167	emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-...	54	4e-04
168	emb|BX063359.1|CNS09L1V Single read from an extremity of a full-...	54	4e-04
169	emb|BX063358.1|CNS09L1U Single read from an extremity of a full-...	54	4e-04
170	emb|BX063357.1|CNS09L1T Single read from an extremity of a full-...	54	4e-04
171	emb|BX063356.1|CNS09L1S Single read from an extremity of a full-...	54	4e-04
172	emb|BX063204.1|CNS09KXK Single read from an extremity of a full-...	54	4e-04
173	emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-...	54	4e-04
174	emb|BX063052.1|CNS09KTC Single read from an extremity of a full-...	54	4e-04
175	emb|BX063051.1|CNS09KTB Single read from an extremity of a full-...	54	4e-04
176	emb|BX063016.1|CNS09KSC Single read from an extremity of a full-...	54	4e-04
177	emb|BX063014.1|CNS09KSA Single read from an extremity of a full-...	54	4e-04
178	emb|BX062938.1|CNS09KQ6 Single read from an extremity of a full-...	54	4e-04
179	emb|BX062802.1|CNS09KME Single read from an extremity of a full-...	54	4e-04
180	emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-...	54	4e-04
181	emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-...	54	4e-04
182	emb|BX062775.1|CNS09KLN Single read from an extremity of a full-...	54	4e-04
183	emb|BX062774.1|CNS09KLM Single read from an extremity of a full-...	54	4e-04
184	emb|BX062707.1|CNS09KJR Single read from an extremity of a full-...	54	4e-04
185	emb|BX062706.1|CNS09KJQ Single read from an extremity of a full-...	54	4e-04
186	emb|BX062617.1|CNS09KH9 Single read from an extremity of a full-...	54	4e-04
187	emb|BX062616.1|CNS09KH8 Single read from an extremity of a full-...	54	4e-04
188	emb|BX062615.1|CNS09KH7 Single read from an extremity of a full-...	54	4e-04
189	emb|BX062614.1|CNS09KH6 Single read from an extremity of a full-...	54	4e-04
190	emb|BX062265.1|CNS09K7H Single read from an extremity of a full-...	54	4e-04
191	emb|BX062264.1|CNS09K7G Single read from an extremity of a full-...	54	4e-04
192	emb|BX062196.1|CNS09K5K Single read from an extremity of a full-...	54	4e-04
193	emb|BX062195.1|CNS09K5J Single read from an extremity of a full-...	54	4e-04
194	emb|BX062152.1|CNS09K4C Single read from an extremity of a full-...	54	4e-04
195	emb|BX062151.1|CNS09K4B Single read from an extremity of a full-...	54	4e-04
196	emb|BX062132.1|CNS09K3S Single read from an extremity of a full-...	54	4e-04
197	emb|BX062131.1|CNS09K3R Single read from an extremity of a full-...	54	4e-04
198	emb|BX062052.1|CNS09K1K Single read from an extremity of a full-...	54	4e-04
199	emb|BX061984.1|CNS09JZO Single read from an extremity of a full-...	54	4e-04
200	emb|BX061983.1|CNS09JZN Single read from an extremity of a full-...	54	4e-04
201	emb|BX061962.1|CNS09JZ2 Single read from an extremity of a full-...	54	4e-04
202	emb|BX061961.1|CNS09JZ1 Single read from an extremity of a full-...	54	4e-04
203	emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-...	54	4e-04
204	emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-...	54	4e-04
205	emb|BX061867.1|CNS09JWF Single read from an extremity of a full-...	54	4e-04
206	emb|BX061866.1|CNS09JWE Single read from an extremity of a full-...	54	4e-04
207	emb|BX061808.1|CNS09JUS Single read from an extremity of a full-...	54	4e-04
208	emb|BX061807.1|CNS09JUR Single read from an extremity of a full-...	54	4e-04
209	emb|BX061804.1|CNS09JUO Single read from an extremity of a full-...	54	4e-04
210	emb|BX061803.1|CNS09JUN Single read from an extremity of a full-...	54	4e-04
211	emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-...	54	4e-04
212	emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-...	54	4e-04
213	emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-...	54	4e-04
214	emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-...	54	4e-04
215	emb|BX061589.1|CNS09JOP Single read from an extremity of a full-...	54	4e-04
216	emb|BX061588.1|CNS09JOO Single read from an extremity of a full-...	54	4e-04
217	emb|BX061562.1|CNS09JNY Single read from an extremity of a full-...	54	4e-04
218	emb|BX061561.1|CNS09JNX Single read from an extremity of a full-...	54	4e-04
219	emb|BX061522.1|CNS09JMU Single read from an extremity of a full-...	54	4e-04
220	emb|BX061521.1|CNS09JMT Single read from an extremity of a full-...	54	4e-04
221	emb|BX061174.1|CNS09JD6 Single read from an extremity of a full-...	54	4e-04
222	emb|BX061173.1|CNS09JD5 Single read from an extremity of a full-...	54	4e-04
223	emb|BX060748.1|CNS09J1C Single read from an extremity of a full-...	54	4e-04
224	emb|BX060747.1|CNS09J1B Single read from an extremity of a full-...	54	4e-04
225	emb|BX060414.1|CNS09IS2 Single read from an extremity of a full-...	54	4e-04
226	emb|BX060410.1|CNS09IRY Single read from an extremity of a full-...	54	4e-04
227	emb|BX060409.1|CNS09IRX Single read from an extremity of a full-...	54	4e-04
228	emb|BX060393.1|CNS09IRH Single read from an extremity of a full-...	54	4e-04
229	emb|BX060392.1|CNS09IRG Single read from an extremity of a full-...	54	4e-04
230	emb|BX060282.1|CNS09IOE Single read from an extremity of a full-...	54	4e-04
231	emb|BX060281.1|CNS09IOD Single read from an extremity of a full-...	54	4e-04
232	emb|BX060076.1|CNS09IIO Single read from an extremity of a full-...	54	4e-04
233	emb|BX060049.1|CNS09IHX Single read from an extremity of a full-...	54	4e-04
234	emb|BX060048.1|CNS09IHW Single read from an extremity of a full-...	54	4e-04
235	emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-...	54	4e-04
236	emb|BX059637.1|CNS09I6H Single read from an extremity of a full-...	54	4e-04
237	emb|BX059608.1|CNS09I5O Single read from an extremity of a full-...	54	4e-04
238	emb|BX059419.1|CNS09I0F Single read from an extremity of a full-...	54	4e-04
239	emb|BX059418.1|CNS09I0E Single read from an extremity of a full-...	54	4e-04
240	emb|BX059402.1|CNS09HZY Single read from an extremity of a full-...	54	4e-04
241	emb|BX059401.1|CNS09HZX Single read from an extremity of a full-...	54	4e-04
242	emb|BX059380.1|CNS09HZC Single read from an extremity of a full-...	54	4e-04
243	emb|BX059379.1|CNS09HZB Single read from an extremity of a full-...	54	4e-04
244	emb|BX059205.1|CNS09HUH Single read from an extremity of a full-...	54	4e-04
245	emb|BX059204.1|CNS09HUG Single read from an extremity of a full-...	54	4e-04
246	emb|BX059163.1|CNS09HTB Single read from an extremity of a full-...	54	4e-04
247	emb|BX059162.1|CNS09HTA Single read from an extremity of a full-...	54	4e-04
248	emb|BX059100.1|CNS09HRK Single read from an extremity of a full-...	54	4e-04
249	emb|BX059099.1|CNS09HRJ Single read from an extremity of a full-...	54	4e-04
250	emb|BX059084.1|CNS09HR4 Single read from an extremity of a full-...	54	4e-04
251	emb|BX059083.1|CNS09HR3 Single read from an extremity of a full-...	54	4e-04
252	emb|BX058995.1|CNS09HON Single read from an extremity of a full-...	54	4e-04
253	emb|BX058994.1|CNS09HOM Single read from an extremity of a full-...	54	4e-04
254	emb|BX058960.1|CNS09HNO Single read from an extremity of a full-...	54	4e-04
255	emb|BX058959.1|CNS09HNN Single read from an extremity of a full-...	54	4e-04
256	emb|BX058601.1|CNS09HDP Single read from an extremity of a full-...	54	4e-04
257	emb|BX058573.1|CNS09HCX Single read from an extremity of a full-...	54	4e-04
258	emb|BX058506.1|CNS09HB2 Single read from an extremity of a full-...	54	4e-04
259	emb|BX058489.1|CNS09HAL Single read from an extremity of a full-...	54	4e-04
260	emb|BX058488.1|CNS09HAK Single read from an extremity of a full-...	54	4e-04
261	emb|BX058259.1|CNS09H47 Single read from an extremity of a full-...	54	4e-04
262	emb|BX058247.1|CNS09H3V Single read from an extremity of a full-...	54	4e-04
263	emb|BX058246.1|CNS09H3U Single read from an extremity of a full-...	54	4e-04
264	emb|BX058245.1|CNS09H3T Single read from an extremity of a full-...	54	4e-04
265	emb|BX058224.1|CNS09H38 Single read from an extremity of a full-...	54	4e-04
266	emb|BX058185.1|CNS09H25 Single read from an extremity of a full-...	54	4e-04
267	emb|BX058171.1|CNS09H1R Single read from an extremity of a full-...	54	4e-04
268	emb|BX058170.1|CNS09H1Q Single read from an extremity of a full-...	54	4e-04
269	emb|BX058051.1|CNS09GYF Single read from an extremity of a full-...	54	4e-04
270	emb|BX058021.1|CNS09GXL Single read from an extremity of a full-...	54	4e-04
271	emb|BX058020.1|CNS09GXK Single read from an extremity of a full-...	54	4e-04
272	emb|BX056697.1|CNS09FWT Single read from an extremity of a full-...	54	4e-04
273	emb|BX057882.1|CNS09GTQ Single read from an extremity of a full-...	54	4e-04
274	emb|BX057881.1|CNS09GTP Single read from an extremity of a full-...	54	4e-04
275	emb|BX057715.1|CNS09GP3 Single read from an extremity of a full-...	54	4e-04
276	emb|BX057645.1|CNS09GN5 Single read from an extremity of a full-...	54	4e-04
277	emb|BX057618.1|CNS09GME Single read from an extremity of a full-...	54	4e-04
278	emb|BX057555.1|CNS09GKN Single read from an extremity of a full-...	54	4e-04
279	emb|BX057419.1|CNS09GGV Single read from an extremity of a full-...	54	4e-04
280	emb|BX057418.1|CNS09GGU Single read from an extremity of a full-...	54	4e-04
281	emb|BX057394.1|CNS09GG6 Single read from an extremity of a full-...	54	4e-04
282	emb|BX057189.1|CNS09GAH Single read from an extremity of a full-...	54	4e-04
283	emb|BX057124.1|CNS09G8O Single read from an extremity of a full-...	54	4e-04
284	emb|BX055889.1|CNS09FAD Single read from an extremity of a full-...	54	4e-04
285	emb|BX055888.1|CNS09FAC Single read from an extremity of a full-...	54	4e-04
286	emb|BX056278.1|CNS09FL6 Single read from an extremity of a full-...	54	4e-04
287	emb|BX056277.1|CNS09FL5 Single read from an extremity of a full-...	54	4e-04
288	emb|BX056060.1|CNS09FF4 Single read from an extremity of a full-...	54	4e-04
289	emb|BX056010.1|CNS09FDQ Single read from an extremity of a full-...	54	4e-04
290	emb|BX055974.1|CNS09FCQ Single read from an extremity of a full-...	54	4e-04
291	emb|BX055414.1|CNS09EX6 Single read from an extremity of a full-...	54	4e-04
292	emb|BX055345.1|CNS09EV9 Single read from an extremity of a full-...	54	4e-04
293	emb|BX055344.1|CNS09EV8 Single read from an extremity of a full-...	54	4e-04
294	emb|BX055279.1|CNS09ETF Single read from an extremity of a full-...	54	4e-04
295	emb|BX053270.1|CNS09D9M Single read from an extremity of a full-...	54	4e-04
296	emb|BX053269.1|CNS09D9L Single read from an extremity of a full-...	54	4e-04
297	emb|BX053130.1|CNS09D5Q Single read from an extremity of a full-...	54	4e-04
298	emb|BX055048.1|CNS09EN0 Single read from an extremity of a full-...	54	4e-04
299	emb|BX055047.1|CNS09EMZ Single read from an extremity of a full-...	54	4e-04
300	emb|BX054966.1|CNS09EKQ Single read from an extremity of a full-...	54	4e-04
301	emb|BX054945.1|CNS09EK5 Single read from an extremity of a full-...	54	4e-04
302	emb|BX054931.1|CNS09EJR Single read from an extremity of a full-...	54	4e-04
303	emb|BX054767.1|CNS09EF7 Single read from an extremity of a full-...	54	4e-04
304	emb|BX054766.1|CNS09EF6 Single read from an extremity of a full-...	54	4e-04
305	emb|BX054765.1|CNS09EF5 Single read from an extremity of a full-...	54	4e-04
306	emb|BX053033.1|CNS09D31 Single read from an extremity of a full-...	54	4e-04
307	emb|BX053032.1|CNS09D30 Single read from an extremity of a full-...	54	4e-04
308	emb|BX053000.1|CNS09D24 Single read from an extremity of a full-...	54	4e-04
309	emb|BX052999.1|CNS09D23 Single read from an extremity of a full-...	54	4e-04
310	emb|BX052963.1|CNS09D13 Single read from an extremity of a full-...	54	4e-04
311	emb|BX052919.1|CNS09CZV Single read from an extremity of a full-...	54	4e-04
312	emb|BX054709.1|CNS09EDL Single read from an extremity of a full-...	54	4e-04
313	emb|BX054708.1|CNS09EDK Single read from an extremity of a full-...	54	4e-04
314	emb|BX054600.1|CNS09EAK Single read from an extremity of a full-...	54	4e-04
315	emb|BX054576.1|CNS09E9W Single read from an extremity of a full-...	54	4e-04
316	emb|BX054529.1|CNS09E8L Single read from an extremity of a full-...	54	4e-04
317	emb|BX054528.1|CNS09E8K Single read from an extremity of a full-...	54	4e-04
318	emb|BX054523.1|CNS09E8F Single read from an extremity of a full-...	54	4e-04
319	emb|BX054522.1|CNS09E8E Single read from an extremity of a full-...	54	4e-04
320	emb|BX054497.1|CNS09E7P Single read from an extremity of a full-...	54	4e-04
321	emb|BX054389.1|CNS09E4P Single read from an extremity of a full-...	54	4e-04
322	emb|BX054388.1|CNS09E4O Single read from an extremity of a full-...	54	4e-04
323	emb|BX054299.1|CNS09E27 Single read from an extremity of a full-...	54	4e-04
324	emb|BX053999.1|CNS09DTV Single read from an extremity of a full-...	54	4e-04
325	emb|BX053716.1|CNS09DM0 Single read from an extremity of a full-...	54	4e-04
326	emb|BX053571.1|CNS09DHZ Single read from an extremity of a full-...	54	4e-04
327	emb|BX053570.1|CNS09DHY Single read from an extremity of a full-...	54	4e-04
328	emb|BX053534.1|CNS09DGY Single read from an extremity of a full-...	54	4e-04
329	emb|BX052899.1|CNS09CZB Single read from an extremity of a full-...	54	4e-04
330	emb|BX052898.1|CNS09CZA Single read from an extremity of a full-...	54	4e-04
331	emb|BX052832.1|CNS09CXG Single read from an extremity of a full-...	54	4e-04
332	emb|BX052831.1|CNS09CXF Single read from an extremity of a full-...	54	4e-04
333	emb|BX052827.1|CNS09CXB Single read from an extremity of a full-...	54	4e-04
334	emb|BX052600.1|CNS09CR0 Single read from an extremity of a full-...	54	4e-04
335	emb|BX052461.1|CNS09CN5 Single read from an extremity of a full-...	54	4e-04
336	emb|BX052449.1|CNS09CMT Single read from an extremity of a full-...	54	4e-04
337	emb|BX052448.1|CNS09CMS Single read from an extremity of a full-...	54	4e-04
338	emb|BX052291.1|CNS09CIF Single read from an extremity of a full-...	54	4e-04
339	emb|BX052243.1|CNS09CH3 Single read from an extremity of a full-...	54	4e-04
340	emb|BX052242.1|CNS09CH2 Single read from an extremity of a full-...	54	4e-04
341	emb|BX051997.1|CNS09CA9 Single read from an extremity of a full-...	54	4e-04
342	emb|BX051743.1|CNS09C37 Single read from an extremity of a full-...	54	4e-04
343	emb|BX051668.1|CNS09C14 Single read from an extremity of a full-...	54	4e-04
344	emb|BX051623.1|CNS09BZV Single read from an extremity of a full-...	54	4e-04
345	emb|BX050241.1|CNS09AXH Single read from an extremity of a full-...	54	4e-04
346	emb|BX050240.1|CNS09AXG Single read from an extremity of a full-...	54	4e-04
347	emb|BX050169.1|CNS09AVH Single read from an extremity of a full-...	54	4e-04
348	emb|BX050139.1|CNS09AUN Single read from an extremity of a full-...	54	4e-04
349	emb|BX050138.1|CNS09AUM Single read from an extremity of a full-...	54	4e-04
350	emb|BX051263.1|CNS09BPV Single read from an extremity of a full-...	54	4e-04
351	emb|BX051262.1|CNS09BPU Single read from an extremity of a full-...	54	4e-04
352	emb|BX050756.1|CNS09BBS Single read from an extremity of a full-...	54	4e-04
353	emb|BX050728.1|CNS09BB0 Single read from an extremity of a full-...	54	4e-04
354	emb|BX050727.1|CNS09BAZ Single read from an extremity of a full-...	54	4e-04
355	emb|BX050369.1|CNS09B11 Single read from an extremity of a full-...	54	4e-04
356	emb|BX050368.1|CNS09B10 Single read from an extremity of a full-...	54	4e-04
357	emb|BX050014.1|CNS09AR6 Single read from an extremity of a full-...	54	4e-04
358	emb|BX049964.1|CNS09APS Single read from an extremity of a full-...	54	4e-04
359	emb|BX049954.1|CNS09API Single read from an extremity of a full-...	54	4e-04
360	emb|BX049953.1|CNS09APH Single read from an extremity of a full-...	54	4e-04
361	emb|BX049828.1|CNS09AM0 Single read from an extremity of a full-...	54	4e-04
362	emb|BX049827.1|CNS09ALZ Single read from an extremity of a full-...	54	4e-04
363	emb|BX049768.1|CNS09AKC Single read from an extremity of a full-...	54	4e-04
364	emb|BX049747.1|CNS09AJR Single read from an extremity of a full-...	54	4e-04
365	emb|BX049746.1|CNS09AJQ Single read from an extremity of a full-...	54	4e-04
366	emb|BX030975.1|CNS08W2B Single read from an extremity of a full-...	54	4e-04
367	emb|BX030974.1|CNS08W2A Single read from an extremity of a full-...	54	4e-04
368	emb|BX030868.1|CNS08VZC Single read from an extremity of a full-...	54	4e-04
369	emb|BX049406.1|CNS09AAA Single read from an extremity of a full-...	54	4e-04
370	emb|BX049245.1|CNS09A5T Single read from an extremity of a full-...	54	4e-04
371	emb|BX049143.1|CNS09A2Z Single read from an extremity of a full-...	54	4e-04
372	emb|BX049053.1|CNS09A0H Single read from an extremity of a full-...	54	4e-04
373	emb|BX049052.1|CNS09A0G Single read from an extremity of a full-...	54	4e-04
374	emb|BX049001.1|CNS099Z1 Single read from an extremity of a full-...	54	4e-04
375	emb|BX048986.1|CNS099YM Single read from an extremity of a full-...	54	4e-04
376	emb|BX048977.1|CNS099YD Single read from an extremity of a full-...	54	4e-04
377	emb|BX048867.1|CNS099VB Single read from an extremity of a full-...	54	4e-04
378	emb|BX048863.1|CNS099V7 Single read from an extremity of a full-...	54	4e-04
379	emb|BX048862.1|CNS099V6 Single read from an extremity of a full-...	54	4e-04
380	emb|BX048717.1|CNS099R5 Single read from an extremity of a full-...	54	4e-04
381	emb|BX048681.1|CNS099Q5 Single read from an extremity of a full-...	54	4e-04
382	emb|BX048630.1|CNS099OQ Single read from an extremity of a full-...	54	4e-04
383	emb|BX048629.1|CNS099OP Single read from an extremity of a full-...	54	4e-04
384	emb|BX048624.1|CNS099OK Single read from an extremity of a full-...	54	4e-04
385	emb|BX048623.1|CNS099OJ Single read from an extremity of a full-...	54	4e-04
386	emb|BX048591.1|CNS099NN Single read from an extremity of a full-...	54	4e-04
387	emb|BX048554.1|CNS099MM Single read from an extremity of a full-...	54	4e-04
388	emb|BX046394.1|CNS097YM Single read from an extremity of a full-...	54	4e-04
389	emb|BX046393.1|CNS097YL Single read from an extremity of a full-...	54	4e-04
390	emb|BX048277.1|CNS099EX Single read from an extremity of a full-...	54	4e-04
391	emb|BX048069.1|CNS09995 Single read from an extremity of a full-...	54	4e-04
392	emb|BX048011.1|CNS0997J Single read from an extremity of a full-...	54	4e-04
393	emb|BX048010.1|CNS0997I Single read from an extremity of a full-...	54	4e-04
394	emb|BX047783.1|CNS09917 Single read from an extremity of a full-...	54	4e-04
395	emb|BX047724.1|CNS098ZK Single read from an extremity of a full-...	54	4e-04
396	emb|BX047723.1|CNS098ZJ Single read from an extremity of a full-...	54	4e-04
397	emb|BX047681.1|CNS098YD Single read from an extremity of a full-...	54	4e-04
398	emb|BX047543.1|CNS098UJ Single read from an extremity of a full-...	54	4e-04
399	emb|BX047542.1|CNS098UI Single read from an extremity of a full-...	54	4e-04
400	emb|BX047415.1|CNS098QZ Single read from an extremity of a full-...	54	4e-04
401	emb|BX047414.1|CNS098QY Single read from an extremity of a full-...	54	4e-04
402	emb|BX047380.1|CNS098Q0 Single read from an extremity of a full-...	54	4e-04
403	emb|BX047379.1|CNS098PZ Single read from an extremity of a full-...	54	4e-04
404	emb|BX047341.1|CNS098OX Single read from an extremity of a full-...	54	4e-04
405	emb|BX046994.1|CNS098FA Single read from an extremity of a full-...	54	4e-04
406	emb|BX046993.1|CNS098F9 Single read from an extremity of a full-...	54	4e-04
407	emb|BX046983.1|CNS098EZ Single read from an extremity of a full-...	54	4e-04
408	emb|BX046982.1|CNS098EY Single read from an extremity of a full-...	54	4e-04
409	emb|BX046960.1|CNS098EC Single read from an extremity of a full-...	54	4e-04
410	emb|BX046948.1|CNS098E0 Single read from an extremity of a full-...	54	4e-04
411	emb|BX046919.1|CNS098D7 Single read from an extremity of a full-...	54	4e-04
412	emb|BX046818.1|CNS098AE Single read from an extremity of a full-...	54	4e-04
413	emb|BX046778.1|CNS0989A Single read from an extremity of a full-...	54	4e-04
414	emb|BX046633.1|CNS09859 Single read from an extremity of a full-...	54	4e-04
415	emb|BX046341.1|CNS097X5 Single read from an extremity of a full-...	54	4e-04
416	emb|BX046137.1|CNS097RH Single read from an extremity of a full-...	54	4e-04
417	emb|BX046044.1|CNS097OW Single read from an extremity of a full-...	54	4e-04
418	emb|BX046043.1|CNS097OV Single read from an extremity of a full-...	54	4e-04
419	emb|BX046040.1|CNS097OS Single read from an extremity of a full-...	54	4e-04
420	emb|BX046039.1|CNS097OR Single read from an extremity of a full-...	54	4e-04
421	emb|BX046003.1|CNS097NR Single read from an extremity of a full-...	54	4e-04
422	emb|BX045660.1|CNS097E8 Single read from an extremity of a full-...	54	4e-04
423	emb|BX045659.1|CNS097E7 Single read from an extremity of a full-...	54	4e-04
424	emb|BX045120.1|CNS096Z8 Single read from an extremity of a full-...	54	4e-04
425	emb|BX045038.1|CNS096WY Single read from an extremity of a full-...	54	4e-04
426	emb|BX045037.1|CNS096WX Single read from an extremity of a full-...	54	4e-04
427	emb|BX044960.1|CNS096US Single read from an extremity of a full-...	54	4e-04
428	emb|BX044959.1|CNS096UR Single read from an extremity of a full-...	54	4e-04
429	emb|BX045186.1|CNS09712 Single read from an extremity of a full-...	54	4e-04
430	emb|BX044698.1|CNS096NI Single read from an extremity of a full-...	54	4e-04
431	emb|BX044697.1|CNS096NH Single read from an extremity of a full-...	54	4e-04
432	emb|BX044664.1|CNS096MK Single read from an extremity of a full-...	54	4e-04
433	emb|BX044558.1|CNS096JM Single read from an extremity of a full-...	54	4e-04
434	emb|BX044511.1|CNS096IB Single read from an extremity of a full-...	54	4e-04
435	emb|BX044478.1|CNS096HE Single read from an extremity of a full-...	54	4e-04
436	emb|BX044334.1|CNS096DE Single read from an extremity of a full-...	54	4e-04
437	emb|BX043878.1|CNS0960Q Single read from an extremity of a full-...	54	4e-04
438	emb|BX043766.1|CNS095XM Single read from an extremity of a full-...	54	4e-04
439	emb|BX043765.1|CNS095XL Single read from an extremity of a full-...	54	4e-04
440	emb|BX043710.1|CNS095W2 Single read from an extremity of a full-...	54	4e-04
441	emb|BX043491.1|CNS095PZ Single read from an extremity of a full-...	54	4e-04
442	emb|BX043490.1|CNS095PY Single read from an extremity of a full-...	54	4e-04
443	emb|BX043444.1|CNS095OO Single read from an extremity of a full-...	54	4e-04
444	emb|BX043443.1|CNS095ON Single read from an extremity of a full-...	54	4e-04
445	emb|BX043381.1|CNS095MX Single read from an extremity of a full-...	54	4e-04
446	emb|BX043353.1|CNS095M5 Single read from an extremity of a full-...	54	4e-04
447	emb|BX043326.1|CNS095LE Single read from an extremity of a full-...	54	4e-04
448	emb|BX043325.1|CNS095LD Single read from an extremity of a full-...	54	4e-04
449	emb|BX043709.1|CNS095W1 Single read from an extremity of a full-...	54	4e-04
450	emb|BX043663.1|CNS095UR Single read from an extremity of a full-...	54	4e-04
451	emb|BX043646.1|CNS095UA Single read from an extremity of a full-...	54	4e-04
452	emb|BX043645.1|CNS095U9 Single read from an extremity of a full-...	54	4e-04
453	emb|BX043549.1|CNS095RL Single read from an extremity of a full-...	54	4e-04
454	emb|BX043548.1|CNS095RK Single read from an extremity of a full-...	54	4e-04
455	emb|BX043224.1|CNS095IK Single read from an extremity of a full-...	54	4e-04
456	emb|BX043223.1|CNS095IJ Single read from an extremity of a full-...	54	4e-04
457	emb|BX043198.1|CNS095HU Single read from an extremity of a full-...	54	4e-04
458	emb|BX043155.1|CNS095GN Single read from an extremity of a full-...	54	4e-04
459	emb|BX043154.1|CNS095GM Single read from an extremity of a full-...	54	4e-04
460	emb|BX043130.1|CNS095FY Single read from an extremity of a full-...	54	4e-04
461	emb|BX043129.1|CNS095FX Single read from an extremity of a full-...	54	4e-04
462	emb|BX042859.1|CNS0958F Single read from an extremity of a full-...	54	4e-04
463	emb|BX042858.1|CNS0958E Single read from an extremity of a full-...	54	4e-04
464	emb|BX042789.1|CNS0956H Single read from an extremity of a full-...	54	4e-04
465	emb|BX042584.1|CNS0950S Single read from an extremity of a full-...	54	4e-04
466	emb|BX042419.1|CNS094W7 Single read from an extremity of a full-...	54	4e-04
467	emb|BX042365.1|CNS094UP Single read from an extremity of a full-...	54	4e-04
468	emb|BX042364.1|CNS094UO Single read from an extremity of a full-...	54	4e-04
469	emb|BX042334.1|CNS094TU Single read from an extremity of a full-...	54	4e-04
470	emb|BX042320.1|CNS094TG Single read from an extremity of a full-...	54	4e-04
471	emb|BX042319.1|CNS094TF Single read from an extremity of a full-...	54	4e-04
472	emb|BX042214.1|CNS094QI Single read from an extremity of a full-...	54	4e-04
473	emb|BX042168.1|CNS094P8 Single read from an extremity of a full-...	54	4e-04
474	emb|BX042156.1|CNS094OW Single read from an extremity of a full-...	54	4e-04
475	emb|BX042155.1|CNS094OV Single read from an extremity of a full-...	54	4e-04
476	emb|BX042102.1|CNS094NE Single read from an extremity of a full-...	54	4e-04
477	emb|BX042101.1|CNS094ND Single read from an extremity of a full-...	54	4e-04
478	emb|BX042051.1|CNS094LZ Single read from an extremity of a full-...	54	4e-04
479	emb|BX042050.1|CNS094LY Single read from an extremity of a full-...	54	4e-04
480	emb|BX041945.1|CNS094J1 Single read from an extremity of a full-...	54	4e-04
481	emb|BX041489.1|CNS0946D Single read from an extremity of a full-...	54	4e-04
482	emb|BX041488.1|CNS0946C Single read from an extremity of a full-...	54	4e-04
483	emb|BX041443.1|CNS09453 Single read from an extremity of a full-...	54	4e-04
484	emb|BX041442.1|CNS09452 Single read from an extremity of a full-...	54	4e-04
485	emb|BX041386.1|CNS0943I Single read from an extremity of a full-...	54	4e-04
486	emb|BX041385.1|CNS0943H Single read from an extremity of a full-...	54	4e-04
487	emb|BX041306.1|CNS0941A Single read from an extremity of a full-...	54	4e-04
488	emb|BX041305.1|CNS09419 Single read from an extremity of a full-...	54	4e-04
489	emb|BX041209.1|CNS093YL Single read from an extremity of a full-...	54	4e-04
490	emb|BX041149.1|CNS093WX Single read from an extremity of a full-...	54	4e-04
491	emb|BX041148.1|CNS093WW Single read from an extremity of a full-...	54	4e-04
492	emb|BX041077.1|CNS093UX Single read from an extremity of a full-...	54	4e-04
493	emb|BX041076.1|CNS093UW Single read from an extremity of a full-...	54	4e-04
494	emb|BX040933.1|CNS093QX Single read from an extremity of a full-...	54	4e-04
495	emb|BX040789.1|CNS093MX Single read from an extremity of a full-...	54	4e-04
496	emb|BX040788.1|CNS093MW Single read from an extremity of a full-...	54	4e-04
497	emb|BX040686.1|CNS093K2 Single read from an extremity of a full-...	54	4e-04
498	emb|BX040685.1|CNS093K1 Single read from an extremity of a full-...	54	4e-04
499	emb|BX040671.1|CNS093JN Single read from an extremity of a full-...	54	4e-04
500	emb|BX040670.1|CNS093JM Single read from an extremity of a full-...	54	4e-04

---

>gb|BT016269.1| Zea mays clone Contig102 mRNA sequence
          Length = 1254

 Score =  293 bits (148), Expect = 2e-76
 Identities = 214/236 (90%)
 Strand = Plus / Minus

                                                                        
Query: 201  agaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagc 260
            ||||||||||||  ||||||||||| || ||||||||||||||||| || ||||||||||
Sbjct: 1039 agaccctgatagacccatcggtgtagccagtgtagagggtgcttccatcggcgctccagc 980

                                                                        
Query: 261  tcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggcttaaggtcct 320
            ||||||||||||||||||| |||||||||||||||| |||||  |||||||| |||||||
Sbjct: 979  tcaagcttgtgcagtacaggatctggttcttggagatctggatgtcaggcttgaggtcct 920

                                                                        
Query: 321  gcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgcagcgcaga 380
            ||||||| ||||| ||||| |||||||||||||| | ||| ||||  |||||||||||||
Sbjct: 919  gcacgacgtgcttcgactcaaggtcccagatcttaacagagtcctgggtcgcagcgcaga 860

                                                                    
Query: 381  gccagtagcggttgggcgagaagcagagcgagtggatgatggagccggcttccagc 436
            |||||||||||||||||||||||||||| ||||||||||||||||| || ||||||
Sbjct: 859  gccagtagcggttgggcgagaagcagagggagtggatgatggagcccgcatccagc 804

---

>gb|AY103919.1| Zea mays PCO099246 mRNA sequence
          Length = 1461

 Score =  293 bits (148), Expect = 2e-76
 Identities = 214/236 (90%)
 Strand = Plus / Minus

                                                                        
Query: 201  agaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagc 260
            ||||||||||||  ||||||||||| || ||||||||||||||||| || ||||||||||
Sbjct: 1196 agaccctgatagacccatcggtgtagccagtgtagagggtgcttccatcggcgctccagc 1137

                                                                        
Query: 261  tcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggcttaaggtcct 320
            ||||||||||||||||||| |||||||||||||||| |||||  |||||||| |||||||
Sbjct: 1136 tcaagcttgtgcagtacaggatctggttcttggagatctggatgtcaggcttgaggtcct 1077

                                                                        
Query: 321  gcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgcagcgcaga 380
            ||||||| ||||| ||||| |||||||||||||| | ||| ||||  |||||||||||||
Sbjct: 1076 gcacgacgtgcttcgactcaaggtcccagatcttaacagagtcctgggtcgcagcgcaga 1017

                                                                    
Query: 381  gccagtagcggttgggcgagaagcagagcgagtggatgatggagccggcttccagc 436
            |||||||||||||||||||||||||||| ||||||||||||||||| || ||||||
Sbjct: 1016 gccagtagcggttgggcgagaagcagagggagtggatgatggagcccgcatccagc 961

---

>gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence
          Length = 1281

 Score =  285 bits (144), Expect = 6e-74
 Identities = 213/236 (90%)
 Strand = Plus / Minus

                                                                        
Query: 201  agaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagc 260
            ||||||||||||  ||||||||||| || |||||||||| |||||| || ||||||||||
Sbjct: 1048 agaccctgatagacccatcggtgtagccagtgtagagggggcttccatcggcgctccagc 989

                                                                        
Query: 261  tcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggcttaaggtcct 320
            ||||||||||||||||||| |||||||||||||||| |||||  |||||||| |||||||
Sbjct: 988  tcaagcttgtgcagtacaggatctggttcttggagatctggatgtcaggcttgaggtcct 929

                                                                        
Query: 321  gcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgcagcgcaga 380
            ||||||| ||||| ||||| |||||||||||||| | ||| ||||  |||||||||||||
Sbjct: 928  gcacgacgtgcttcgactcaaggtcccagatcttaacagagtcctgggtcgcagcgcaga 869

                                                                    
Query: 381  gccagtagcggttgggcgagaagcagagcgagtggatgatggagccggcttccagc 436
            |||||||||||||||||||||||||||| ||||||||||||||||| || ||||||
Sbjct: 868  gccagtagcggttgggcgagaagcagagggagtggatgatggagcccgcatccagc 813

---

>gb|BT016705.1| Zea mays clone Contig538 mRNA sequence
          Length = 1265

 Score =  274 bits (138), Expect = 2e-70
 Identities = 201/222 (90%)
 Strand = Plus / Minus

                                                                        
Query: 215  ccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctcaagcttgtgcag 274
            ||||||||||| || ||||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 1025 ccatcggtgtagccagtgtagagggtgcttccgtccgcactccagctcaagcttgtacag 966

                                                                        
Query: 275  tacagcatctggttcttggagacctggacttcaggcttaaggtcctgcacgacatgcttg 334
            ||||| ||||||||||||||||||||||  || ||||| ||||||||||| || ||||| 
Sbjct: 965  tacaggatctggttcttggagacctggatgtcgggcttgaggtcctgcacaacgtgcttc 906

                                                                        
Query: 335  gactccaggtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttg 394
            ||||| |||||||||||||||| ||| ||||  |||||||||||||||||||||||||||
Sbjct: 905  gactcgaggtcccagatcttgacagagtcctgcgtcgcagcgcagagccagtagcggttg 846

                                                      
Query: 395  ggcgagaagcagagcgagtggatgatggagccggcttccagc 436
            || ||||||||||| ||||||||||||||||| || ||||||
Sbjct: 845  ggtgagaagcagagagagtggatgatggagcccgcgtccagc 804

---

>ref|XM_475866.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1011

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 203 accctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctc 262
           ||||||||||||||||| ||||| || | | |||||||||| || || ||||||||||||
Sbjct: 974 accctgatagttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctc 915

                                                                       
Query: 263 aagcttgtgcagtacagcatctggttcttggagacctggacttcaggcttaaggtcctgc 322
           || ||||||||||||||||||||| ||||| || |||||||||| ||||| |||||||||
Sbjct: 914 aaacttgtgcagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgc 855

                                                                       
Query: 323 acgacatgcttggactccaggtcccagatcttgatagactcctctgtcgcagcgcagagc 382
           | |||  |||||||||| ||||||||||||||||  || ||||||||||| |||||||||
Sbjct: 854 atgacgagcttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagc 795

                                                          
Query: 383 cagtagcggttgggcgagaagcagagcgagtggatgatggagccggc 429
           |||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 794 cagtagcggttgggcgagaagcagagggagtggatgatggcgccggc 748

---

>dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034P13, full
            insert sequence
          Length = 1385

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 203  accctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctc 262
            ||||||||||||||||| ||||| || | | |||||||||| || || ||||||||||||
Sbjct: 1049 accctgatagttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctc 990

                                                                        
Query: 263  aagcttgtgcagtacagcatctggttcttggagacctggacttcaggcttaaggtcctgc 322
            || ||||||||||||||||||||| ||||| || |||||||||| ||||| |||||||||
Sbjct: 989  aaacttgtgcagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgc 930

                                                                        
Query: 323  acgacatgcttggactccaggtcccagatcttgatagactcctctgtcgcagcgcagagc 382
            | |||  |||||||||| ||||||||||||||||  || ||||||||||| |||||||||
Sbjct: 929  atgacgagcttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagc 870

                                                           
Query: 383  cagtagcggttgggcgagaagcagagcgagtggatgatggagccggc 429
            |||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 869  cagtagcggttgggcgagaagcagagggagtggatgatggcgccggc 823

---

>dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002L07, full
            insert sequence
          Length = 1227

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 203  accctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctc 262
            ||||||||||||||||| ||||| || | | |||||||||| || || ||||||||||||
Sbjct: 1042 accctgatagttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctc 983

                                                                        
Query: 263  aagcttgtgcagtacagcatctggttcttggagacctggacttcaggcttaaggtcctgc 322
            || ||||||||||||||||||||| ||||| || |||||||||| ||||| |||||||||
Sbjct: 982  aaacttgtgcagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgc 923

                                                                        
Query: 323  acgacatgcttggactccaggtcccagatcttgatagactcctctgtcgcagcgcagagc 382
            | |||  |||||||||| ||||||||||||||||  || ||||||||||| |||||||||
Sbjct: 922  atgacgagcttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagc 863

                                                           
Query: 383  cagtagcggttgggcgagaagcagagcgagtggatgatggagccggc 429
            |||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 862  cagtagcggttgggcgagaagcagagggagtggatgatggcgccggc 816

---

>dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-D07, full
            insert sequence
          Length = 1412

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 203  accctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctc 262
            ||||||||||||||||| ||||| || | | |||||||||| || || ||||||||||||
Sbjct: 1051 accctgatagttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctc 992

                                                                        
Query: 263  aagcttgtgcagtacagcatctggttcttggagacctggacttcaggcttaaggtcctgc 322
            || ||||||||||||||||||||| ||||| || |||||||||| ||||| |||||||||
Sbjct: 991  aaacttgtgcagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgc 932

                                                                        
Query: 323  acgacatgcttggactccaggtcccagatcttgatagactcctctgtcgcagcgcagagc 382
            | |||  |||||||||| ||||||||||||||||  || ||||||||||| |||||||||
Sbjct: 931  atgacgagcttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagc 872

                                                           
Query: 383  cagtagcggttgggcgagaagcagagcgagtggatgatggagccggc 429
            |||||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 871  cagtagcggttgggcgagaagcagagggagtggatgatggcgccggc 825

---

>ref|NM_192099.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1005

 Score =  236 bits (119), Expect = 5e-59
 Identities = 203/231 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
           ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 981 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 922

                                                                       
Query: 253 gctccagctcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggctt 312
           ||||||| |||||||||||||||| ||||||||||||||||||||  |||  || |||||
Sbjct: 921 gctccagttcaagcttgtgcagtagagcatctggttcttggagacagggatctcgggctt 862

                                                                       
Query: 313 aaggtcctgcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgc 372
           |||||||||||| |  ||||| ||||| || ||||||||||||||||| ||||  |||||
Sbjct: 861 aaggtcctgcacaatgtgctttgactcaagatcccagatcttgatagagtcctgggtcgc 802

                                                              
Query: 373 agcgcagagccagtagcggttgggcgagaagcagagcgagtggatgatgga 423
            ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 801 cgcgcagagccagtagcggttgggcgagaagcagagcgagtgaatgatgga 751

---

>dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037K24, full
            insert sequence
          Length = 1358

 Score =  236 bits (119), Expect = 5e-59
 Identities = 203/231 (87%)
 Strand = Plus / Minus

                                                                        
Query: 193  gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
            ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 1079 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 1020

                                                                        
Query: 253  gctccagctcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggctt 312
            ||||||| |||||||||||||||| ||||||||||||||||||||  |||  || |||||
Sbjct: 1019 gctccagttcaagcttgtgcagtagagcatctggttcttggagacagggatctcgggctt 960

                                                                        
Query: 313  aaggtcctgcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgc 372
            |||||||||||| |  ||||| ||||| || ||||||||||||||||| ||||  |||||
Sbjct: 959  aaggtcctgcacaatgtgctttgactcaagatcccagatcttgatagagtcctgggtcgc 900

                                                               
Query: 373  agcgcagagccagtagcggttgggcgagaagcagagcgagtggatgatgga 423
             ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 899  cgcgcagagccagtagcggttgggcgagaagcagagcgagtgaatgatgga 849

---

>dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001N15, full
            insert sequence
          Length = 1256

 Score =  236 bits (119), Expect = 5e-59
 Identities = 203/231 (87%)
 Strand = Plus / Minus

                                                                        
Query: 193  gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
            ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 1050 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 991

                                                                        
Query: 253  gctccagctcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggctt 312
            ||||||| |||||||||||||||| ||||||||||||||||||||  |||  || |||||
Sbjct: 990  gctccagttcaagcttgtgcagtagagcatctggttcttggagacagggatctcgggctt 931

                                                                        
Query: 313  aaggtcctgcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgc 372
            |||||||||||| |  ||||| ||||| || ||||||||||||||||| ||||  |||||
Sbjct: 930  aaggtcctgcacaatgtgctttgactcaagatcccagatcttgatagagtcctgggtcgc 871

                                                               
Query: 373  agcgcagagccagtagcggttgggcgagaagcagagcgagtggatgatgga 423
             ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 870  cgcgcagagccagtagcggttgggcgagaagcagagcgagtgaatgatgga 820

---

>dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-011-A02, full
            insert sequence
          Length = 1351

 Score =  236 bits (119), Expect = 5e-59
 Identities = 203/231 (87%)
 Strand = Plus / Minus

                                                                        
Query: 193  gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
            ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 1073 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 1014

                                                                        
Query: 253  gctccagctcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggctt 312
            ||||||| |||||||||||||||| ||||||||||||||||||||  |||  || |||||
Sbjct: 1013 gctccagttcaagcttgtgcagtagagcatctggttcttggagacagggatctcgggctt 954

                                                                        
Query: 313  aaggtcctgcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgc 372
            |||||||||||| |  ||||| ||||| || ||||||||||||||||| ||||  |||||
Sbjct: 953  aaggtcctgcacaatgtgctttgactcaagatcccagatcttgatagagtcctgggtcgc 894

                                                               
Query: 373  agcgcagagccagtagcggttgggcgagaagcagagcgagtggatgatgga 423
             ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 893  cgcgcagagccagtagcggttgggcgagaagcagagcgagtgaatgatgga 843

---

>dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RWD mRNA for q group of
            receptor for activated C-kinase, complete cds
          Length = 1285

 Score =  236 bits (119), Expect = 5e-59
 Identities = 203/231 (87%)
 Strand = Plus / Minus

                                                                        
Query: 193  gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
            ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 1007 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 948

                                                                        
Query: 253  gctccagctcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggctt 312
            ||||||| |||||||||||||||| ||||||||||||||||||||  |||  || |||||
Sbjct: 947  gctccagttcaagcttgtgcagtagagcatctggttcttggagacagggatctcgggctt 888

                                                                        
Query: 313  aaggtcctgcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgc 372
            |||||||||||| |  ||||| ||||| || ||||||||||||||||| ||||  |||||
Sbjct: 887  aaggtcctgcacaatgtgctttgactcaagatcccagatcttgatagagtcctgggtcgc 828

                                                               
Query: 373  agcgcagagccagtagcggttgggcgagaagcagagcgagtggatgatgga 423
             ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 827  cgcgcagagccagtagcggttgggcgagaagcagagcgagtgaatgatgga 777

---

>dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001E12, full
            insert sequence
          Length = 1326

 Score =  228 bits (115), Expect = 1e-56
 Identities = 202/231 (87%)
 Strand = Plus / Minus

                                                                        
Query: 193  gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
            ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 1067 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 1008

                                                                        
Query: 253  gctccagctcaagcttgtgcagtacagcatctggttcttggagacctggacttcaggctt 312
            ||||||| |||||||||||||||| ||||||||||||||||||||  |||  || |||||
Sbjct: 1007 gctccagttcaagcttgtgcagtagagcatctggttcttggagacagggatctcgggctt 948

                                                                        
Query: 313  aaggtcctgcacgacatgcttggactccaggtcccagatcttgatagactcctctgtcgc 372
            |||||||||||| |  ||||| ||||| ||  |||||||||||||||| ||||  |||||
Sbjct: 947  aaggtcctgcacaatgtgctttgactcaagaccccagatcttgatagagtcctgggtcgc 888

                                                               
Query: 373  agcgcagagccagtagcggttgggcgagaagcagagcgagtggatgatgga 423
             ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 887  cgcgcagagccagtagcggttgggcgagaagcagagcgagtgaatgatgga 837

---

>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0079H23,
              complete sequence
          Length = 191765

 Score =  172 bits (87), Expect = 6e-40
 Identities = 132/147 (89%)
 Strand = Plus / Plus

                                                                          
Query: 283    ctggttcttggagacctggacttcaggcttaaggtcctgcacgacatgcttggactccag 342
              |||| ||||| || |||||||||| ||||| |||||||||| |||  |||||||||| ||
Sbjct: 115538 ctggctcttgaaggcctggacttctggcttgaggtcctgcatgacgagcttggactcgag 115597

                                                                          
Query: 343    gtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttgggcgagaa 402
              ||||||||||||||  || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 115598 gtcccagatcttgacggagtcctctgtcgcggcgcagagccagtagcggttgggcgagaa 115657

                                         
Query: 403    gcagagcgagtggatgatggagccggc 429
              |||||| ||||||||||||| ||||||
Sbjct: 115658 gcagagggagtggatgatggcgccggc 115684



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 73/82 (89%)
 Strand = Plus / Plus

                                                                          
Query: 203    accctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctc 262
              ||||||||||||||||| ||||| || | | |||||||||| || || ||||||||||||
Sbjct: 114367 accctgatagttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctc 114426

                                    
Query: 263    aagcttgtgcagtacagcatct 284
              || |||||||||||||||||||
Sbjct: 114427 aaacttgtgcagtacagcatct 114448

---

>gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0560C03,
              complete sequence
          Length = 177861

 Score =  172 bits (87), Expect = 6e-40
 Identities = 132/147 (89%)
 Strand = Plus / Plus

                                                                          
Query: 283    ctggttcttggagacctggacttcaggcttaaggtcctgcacgacatgcttggactccag 342
              |||| ||||| || |||||||||| ||||| |||||||||| |||  |||||||||| ||
Sbjct: 171966 ctggctcttgaaggcctggacttctggcttgaggtcctgcatgacgagcttggactcgag 172025

                                                                          
Query: 343    gtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttgggcgagaa 402
              ||||||||||||||  || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 172026 gtcccagatcttgacggagtcctctgtcgcggcgcagagccagtagcggttgggcgagaa 172085

                                         
Query: 403    gcagagcgagtggatgatggagccggc 429
              |||||| ||||||||||||| ||||||
Sbjct: 172086 gcagagggagtggatgatggcgccggc 172112



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 73/82 (89%)
 Strand = Plus / Plus

                                                                          
Query: 203    accctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctc 262
              ||||||||||||||||| ||||| || | | |||||||||| || || ||||||||||||
Sbjct: 170795 accctgatagttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctc 170854

                                    
Query: 263    aagcttgtgcagtacagcatct 284
              || |||||||||||||||||||
Sbjct: 170855 aaacttgtgcagtacagcatct 170876

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  172 bits (87), Expect = 6e-40
 Identities = 132/147 (89%)
 Strand = Plus / Plus

                                                                            
Query: 283      ctggttcttggagacctggacttcaggcttaaggtcctgcacgacatgcttggactccag 342
                |||| ||||| || |||||||||| ||||| |||||||||| |||  |||||||||| ||
Sbjct: 27240570 ctggctcttgaaggcctggacttctggcttgaggtcctgcatgacgagcttggactcgag 27240629

                                                                            
Query: 343      gtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttgggcgagaa 402
                ||||||||||||||  || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 27240630 gtcccagatcttgacggagtcctctgtcgcggcgcagagccagtagcggttgggcgagaa 27240689

                                           
Query: 403      gcagagcgagtggatgatggagccggc 429
                |||||| ||||||||||||| ||||||
Sbjct: 27240690 gcagagggagtggatgatggcgccggc 27240716



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 73/82 (89%)
 Strand = Plus / Plus

                                                                            
Query: 203      accctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctc 262
                ||||||||||||||||| ||||| || | | |||||||||| || || ||||||||||||
Sbjct: 27239399 accctgatagttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctc 27239458

                                      
Query: 263      aagcttgtgcagtacagcatct 284
                || |||||||||||||||||||
Sbjct: 27239459 aaacttgtgcagtacagcatct 27239480

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  153 bits (77), Expect = 6e-34
 Identities = 125/141 (88%)
 Strand = Plus / Minus

                                                                            
Query: 283      ctggttcttggagacctggacttcaggcttaaggtcctgcacgacatgcttggactccag 342
                |||||||||||||||  |||  || ||||||||||||||||| |  ||||| ||||| ||
Sbjct: 28325045 ctggttcttggagacagggatctcgggcttaaggtcctgcacaatgtgctttgactcaag 28324986

                                                                            
Query: 343      gtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttgggcgagaa 402
                 ||||||||||||||||| ||||  ||||| |||||||||||||||||||||||||||||
Sbjct: 28324985 atcccagatcttgatagagtcctgggtcgccgcgcagagccagtagcggttgggcgagaa 28324926

                                     
Query: 403      gcagagcgagtggatgatgga 423
                |||||||||||| ||||||||
Sbjct: 28324925 gcagagcgagtgaatgatgga 28324905



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                            
Query: 193      gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
                ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 28326297 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 28326238

                                                 
Query: 253      gctccagctcaagcttgtgcagtacagcatctg 285
                ||||||| |||||||||||||||| ||||||||
Sbjct: 28326237 gctccagttcaagcttgtgcagtagagcatctg 28326205

---

>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0478H03
          Length = 167560

 Score =  153 bits (77), Expect = 6e-34
 Identities = 125/141 (88%)
 Strand = Plus / Minus

                                                                          
Query: 283    ctggttcttggagacctggacttcaggcttaaggtcctgcacgacatgcttggactccag 342
              |||||||||||||||  |||  || ||||||||||||||||| |  ||||| ||||| ||
Sbjct: 159552 ctggttcttggagacagggatctcgggcttaaggtcctgcacaatgtgctttgactcaag 159493

                                                                          
Query: 343    gtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttgggcgagaa 402
               ||||||||||||||||| ||||  ||||| |||||||||||||||||||||||||||||
Sbjct: 159492 atcccagatcttgatagagtcctgggtcgccgcgcagagccagtagcggttgggcgagaa 159433

                                   
Query: 403    gcagagcgagtggatgatgga 423
              |||||||||||| ||||||||
Sbjct: 159432 gcagagcgagtgaatgatgga 159412



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                          
Query: 193    gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
              ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 160804 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 160745

                                               
Query: 253    gctccagctcaagcttgtgcagtacagcatctg 285
              ||||||| |||||||||||||||| ||||||||
Sbjct: 160744 gctccagttcaagcttgtgcagtagagcatctg 160712

---

>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0519D04
          Length = 193068

 Score =  153 bits (77), Expect = 6e-34
 Identities = 125/141 (88%)
 Strand = Plus / Minus

                                                                         
Query: 283   ctggttcttggagacctggacttcaggcttaaggtcctgcacgacatgcttggactccag 342
             |||||||||||||||  |||  || ||||||||||||||||| |  ||||| ||||| ||
Sbjct: 40145 ctggttcttggagacagggatctcgggcttaaggtcctgcacaatgtgctttgactcaag 40086

                                                                         
Query: 343   gtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttgggcgagaa 402
              ||||||||||||||||| ||||  ||||| |||||||||||||||||||||||||||||
Sbjct: 40085 atcccagatcttgatagagtcctgggtcgccgcgcagagccagtagcggttgggcgagaa 40026

                                  
Query: 403   gcagagcgagtggatgatgga 423
             |||||||||||| ||||||||
Sbjct: 40025 gcagagcgagtgaatgatgga 40005



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                         
Query: 193   gatcttgaagaccctgatagttccatcggtgtacccggtgtagagggtgcttccgtccgc 252
             ||||||| ||| |||||| |||||||| ||||| || |  |||||||||||||| || ||
Sbjct: 41397 gatcttgtagatcctgatggttccatctgtgtaaccagcatagagggtgcttccatctgc 41338

                                              
Query: 253   gctccagctcaagcttgtgcagtacagcatctg 285
             ||||||| |||||||||||||||| ||||||||
Sbjct: 41337 gctccagttcaagcttgtgcagtagagcatctg 41305

---

>emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein beta subunit-like
            polypeptide
          Length = 2314

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                        
Query: 337  ctccaggtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttggg 396
            ||||||||||||||||||||| ||   ||  || || ||||| |||||||||||||||||
Sbjct: 1643 ctccaggtcccagatcttgatggaggactgggtggcggcgcacagccagtagcggttggg 1584

                                   
Query: 397  cgagaagcagagcgagtggatga 419
            ||||||||| ||  |||||||||
Sbjct: 1583 cgagaagcacaggcagtggatga 1561

---

>gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like polypeptide
           (cblP) mRNA, partial cds
          Length = 843

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 337 ctccaggtcccagatcttgatagactcctctgtcgcagcgcagagccagtagcggttggg 396
           ||||||||||||||||||||| ||   ||  || || ||||| |||||||||||||||||
Sbjct: 801 ctccaggtcccagatcttgatggaggactgggtggcggcgcacagccagtagcggttggg 742

                                  
Query: 397 cgagaagcagagcgagtggatga 419
           ||||||||| ||  |||||||||
Sbjct: 741 cgagaagcacaggcagtggatga 719

---

>emb|BX071356.1|CNS09R80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 423

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 375 cgcagagccagtagcggttgggcgagaagcagagcgagtggatgat 420
           |||| |||||||||||||||||||||||||| |||| || ||||||
Sbjct: 299 cgcacagccagtagcggttgggcgagaagcacagcgcgttgatgat 344

---

>emb|BX071355.1|CNS09R7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 cgcagagccagtagcggttgggcgagaagcagagcgagtggatgat 420
           |||| |||||||||||||||||||||||||| |||| || ||||||
Sbjct: 836 cgcacagccagtagcggttgggcgagaagcacagcgcgttgatgat 791

---

>emb|BX012321.1|CNS08HO5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 623

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 375 cgcagagccagtagcggttgggcgagaagcagagcgagtggatgat 420
           |||| |||||||||||||||||||||||||| |||| || ||||||
Sbjct: 159 cgcacagccagtagcggttgggcgagaagcacagcgcgttgatgat 204

---

>emb|BX012320.1|CNS08HO4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 375 cgcagagccagtagcggttgggcgagaagcagagcgagtggatgat 420
           |||| |||||||||||||||||||||||||| |||| || ||||||
Sbjct: 740 cgcacagccagtagcggttgggcgagaagcacagcgcgttgatgat 695

---

>gb|DQ122924.1| Chlamydomonas incerta G protein beta subunit-like polypeptide (cblP)
            gene, partial cds
          Length = 1471

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 374  gcgcagagccagtagcggttgggcgagaagcagagcgagtggatga 419
            ||||| |||||||||||||||||||||||||| ||  |||||||||
Sbjct: 1452 gcgcacagccagtagcggttgggcgagaagcacaggcagtggatga 1407

---

>ref|XM_954977.1| Neurospora crassa OR74A hypothetical protein (NCU05810.1) partial
           mRNA
          Length = 951

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 gcagcgcagagccagtagcggttgggcgagaag 403
           |||||||||||||||||||||||||| ||||||
Sbjct: 752 gcagcgcagagccagtagcggttgggggagaag 720

---

>ref|XM_325664.1| Neurospora crassa OR74A hypothetical protein (NCU05810.1) partial
           mRNA
          Length = 951

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 gcagcgcagagccagtagcggttgggcgagaag 403
           |||||||||||||||||||||||||| ||||||
Sbjct: 752 gcagcgcagagccagtagcggttgggggagaag 720

---

>ref|XM_656675.1| Aspergillus nidulans FGSC A4 guanine nucleotide-binding protein
           subunit beta-like protein (Cross-pathway control
           WD-repeat protein cpc-2) (AN4163.2), mRNA
          Length = 951

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 gcagcgcagagccagtagcggttgggcgagaag 403
           |||||||||||||||||||||||||| ||||||
Sbjct: 752 gcagcgcagagccagtagcggttgggggagaag 720

---

>ref|XM_753462.1| Ustilago maydis 521 hypothetical protein (UM02408.1) partial mRNA
          Length = 1281

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 gcagcgcagagccagtagcggttgggcgagaag 403
           ||||||||||||||||| |||||||||||||||
Sbjct: 848 gcagcgcagagccagtaacggttgggcgagaag 816

---

>emb|X81875.1|NCCPC2 N.crassa cpc-2 gene
          Length = 4269

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 371  gcagcgcagagccagtagcggttgggcgagaag 403
            |||||||||||||||||||||||||| ||||||
Sbjct: 3070 gcagcgcagagccagtagcggttgggggagaag 3038

---

>dbj|AB226203.1| Aspergillus oryzae cDNA, contig sequence: AoEST3062
          Length = 1325

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 371 gcagcgcagagccagtagcggttgggcgagaag 403
           |||||||||||||||||||||||||| ||||||
Sbjct: 845 gcagcgcagagccagtagcggttgggggagaag 813

---

>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009
          Length = 1913118

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                               
Query: 371    gcagcgcagagccagtagcggttgggcgagaag 403
              |||||||||||||||||||||||||| ||||||
Sbjct: 703843 gcagcgcagagccagtagcggttgggggagaag 703811

---

>gb|AF176775.1|AF176775 Emericella nidulans Gbeta like protein (cpcB) gene, complete cds
          Length = 4505

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 371  gcagcgcagagccagtagcggttgggcgagaag 403
            |||||||||||||||||||||||||| ||||||
Sbjct: 2788 gcagcgcagagccagtagcggttgggggagaag 2756

---

>gb|AF548359.2| Paracoccidioides brasiliensis RACK1-like protein mRNA, complete cds
          Length = 1409

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 371 gcagcgcagagccagtagcggttgggcgagaa 402
           |||||||||||||||||||||||||| |||||
Sbjct: 856 gcagcgcagagccagtagcggttgggggagaa 825

---

>gb|DQ186603.2| Paracoccidioides brasiliensis RACK1-like protein gene, complete cds
          Length = 1804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 371  gcagcgcagagccagtagcggttgggcgagaa 402
            |||||||||||||||||||||||||| |||||
Sbjct: 1271 gcagcgcagagccagtagcggttgggggagaa 1240

---

>emb|BX019636.1|CNS08NBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 374 gcgcagagccagtagcggttgggcgagaagca 405
           ||||| ||||||||||||||||||||||||||
Sbjct: 855 gcgcacagccagtagcggttgggcgagaagca 824

---

>ref|NM_101670.2| Arabidopsis thaliana ATARCA; nucleotide binding AT1G18080 (ATARCA)
            mRNA, complete cds
          Length = 1358

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                        
Query: 214  tccatcggtgtacccggtgtagagggtgcttccgtccgcgctccagctcaagcttgtgca 273
            |||||||||||| ||  || ||||||||||||| || ||||||||| | | |||||||||
Sbjct: 1075 tccatcggtgtaaccactgaagagggtgcttccatcagcgctccagttaaggcttgtgca 1016

               
Query: 274  gta 276
            |||
Sbjct: 1015 gta 1013

---

>gb|AC093195.2| Drosophila melanogaster clone BACR16J09, complete sequence
          Length = 178863

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                             
Query: 375    cgcagagccagtagcggttgggcgagaagca 405
              |||| ||||||||||||||||||||||||||
Sbjct: 175384 cgcacagccagtagcggttgggcgagaagca 175414

---

>gb|AC008328.6| Drosophila melanogaster clone BACR09A04, complete sequence
          Length = 166722

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                             
Query: 375    cgcagagccagtagcggttgggcgagaagca 405
              |||| ||||||||||||||||||||||||||
Sbjct: 133631 cgcacagccagtagcggttgggcgagaagca 133661

---

>gb|AY231739.1| Drosophila yakuba clone yak-em_Rack1 mRNA sequence
          Length = 507

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 304 cgcacagccagtagcggttgggcgagaagca 274

---

>emb|BX053466.1|CNS09DF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 318 cgcacagccagtagcggttgggcgagaagca 348

---

>emb|BX053465.1|CNS09DF1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 855 cgcacagccagtagcggttgggcgagaagca 825

---

>emb|BX053355.1|CNS09DBZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 304 cgcacagccagtagcggttgggcgagaagca 334

---

>emb|BX053354.1|CNS09DBY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 843 cgcacagccagtagcggttgggcgagaagca 813

---

>emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX024636.1|CNS08R68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 830 cgcacagccagtagcggttgggcgagaagca 800

---

>emb|BX072073.1|CNS09RRX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 453

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 307 cgcacagccagtagcggttgggcgagaagca 337

---

>emb|BX071929.1|CNS09RNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 301 cgcacagccagtagcggttgggcgagaagca 331

---

>emb|BX071928.1|CNS09RNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1065

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 841 cgcacagccagtagcggttgggcgagaagca 811

---

>emb|BX071907.1|CNS09RNB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 293 cgcacagccagtagcggttgggcgagaagca 323

---

>emb|BX071775.1|CNS09RJN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 299 cgcacagccagtagcggttgggcgagaagca 329

---

>emb|BX071774.1|CNS09RJM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 851 cgcacagccagtagcggttgggcgagaagca 821

---

>emb|BX071717.1|CNS09RI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 304 cgcacagccagtagcggttgggcgagaagca 334

---

>emb|BX071716.1|CNS09RI0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX071585.1|CNS09RED Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 308 cgcacagccagtagcggttgggcgagaagca 338

---

>emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 287 cgcacagccagtagcggttgggcgagaagca 317

---

>emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 840 cgcacagccagtagcggttgggcgagaagca 810

---

>emb|BX071037.1|CNS09QZ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 839 cgcacagccagtagcggttgggcgagaagca 809

---

>emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 303 cgcacagccagtagcggttgggcgagaagca 333

---

>emb|BX070941.1|CNS09QWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326

---

>emb|BX070940.1|CNS09QWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 838 cgcacagccagtagcggttgggcgagaagca 808

---

>emb|BX070678.1|CNS09QP6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 285 cgcacagccagtagcggttgggcgagaagca 315

---

>emb|BX070378.1|CNS09QGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 839 cgcacagccagtagcggttgggcgagaagca 809

---

>emb|BX070186.1|CNS09QBI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 385

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 158 cgcacagccagtagcggttgggcgagaagca 188

---

>emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 290 cgcacagccagtagcggttgggcgagaagca 320

---

>emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 839 cgcacagccagtagcggttgggcgagaagca 809

---

>emb|BX069810.1|CNS09Q12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 286 cgcacagccagtagcggttgggcgagaagca 316

---

>emb|BX069809.1|CNS09Q11 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 834 cgcacagccagtagcggttgggcgagaagca 804

---

>emb|BX069778.1|CNS09Q06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 328

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 158 cgcacagccagtagcggttgggcgagaagca 188

---

>emb|BX069777.1|CNS09Q05 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 849 cgcacagccagtagcggttgggcgagaagca 819

---

>emb|BX069457.1|CNS09PR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 860 cgcacagccagtagcggttgggcgagaagca 830

---

>emb|BX069079.1|CNS09PGR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 575

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 301 cgcacagccagtagcggttgggcgagaagca 331

---

>emb|BX069078.1|CNS09PGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 874 cgcacagccagtagcggttgggcgagaagca 844

---

>emb|BX068759.1|CNS09P7V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 318 cgcacagccagtagcggttgggcgagaagca 348

---

>emb|BX068758.1|CNS09P7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 856 cgcacagccagtagcggttgggcgagaagca 826

---

>emb|BX068670.1|CNS09P5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 867

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 837 cgcacagccagtagcggttgggcgagaagca 807

---

>emb|BX068658.1|CNS09P52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 312 cgcacagccagtagcggttgggcgagaagca 342

---

>emb|BX068657.1|CNS09P51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 852 cgcacagccagtagcggttgggcgagaagca 822

---

>emb|BX068642.1|CNS09P4M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 298 cgcacagccagtagcggttgggcgagaagca 328

---

>emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 851 cgcacagccagtagcggttgggcgagaagca 821

---

>emb|BX068364.1|CNS09OWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 263 cgcacagccagtagcggttgggcgagaagca 293

---

>emb|BX068249.1|CNS09OTP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 235 cgcacagccagtagcggttgggcgagaagca 265

---

>emb|BX068234.1|CNS09OTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 323 cgcacagccagtagcggttgggcgagaagca 353

---

>emb|BX068233.1|CNS09OT9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 852 cgcacagccagtagcggttgggcgagaagca 822

---

>emb|BX068228.1|CNS09OT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 293 cgcacagccagtagcggttgggcgagaagca 323

---

>emb|BX068198.1|CNS09OSA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 274 cgcacagccagtagcggttgggcgagaagca 304

---

>emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 843 cgcacagccagtagcggttgggcgagaagca 813

---

>emb|BX068108.1|CNS09OPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326

---

>emb|BX068107.1|CNS09OPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX068050.1|CNS09OO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 310 cgcacagccagtagcggttgggcgagaagca 340

---

>emb|BX068049.1|CNS09OO5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 853 cgcacagccagtagcggttgggcgagaagca 823

---

>emb|BX068035.1|CNS09ONR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 760 cgcacagccagtagcggttgggcgagaagca 730

---

>emb|BX068018.1|CNS09ONA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 300 cgcacagccagtagcggttgggcgagaagca 330

---

>emb|BX068017.1|CNS09ON9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 852 cgcacagccagtagcggttgggcgagaagca 822

---

>emb|BX067955.1|CNS09OLJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 317

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 236 cgcacagccagtagcggttgggcgagaagca 266

---

>emb|BX067894.1|CNS09OJU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 282 cgcacagccagtagcggttgggcgagaagca 312

---

>emb|BX067874.1|CNS09OJA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 739 cgcacagccagtagcggttgggcgagaagca 709

---

>emb|BX067850.1|CNS09OIM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 292 cgcacagccagtagcggttgggcgagaagca 322

---

>emb|BX067849.1|CNS09OIL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 841 cgcacagccagtagcggttgggcgagaagca 811

---

>emb|BX067804.1|CNS09OHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 293 cgcacagccagtagcggttgggcgagaagca 323

---

>emb|BX067803.1|CNS09OHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 847 cgcacagccagtagcggttgggcgagaagca 817

---

>emb|BX067788.1|CNS09OGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 230

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 158 cgcacagccagtagcggttgggcgagaagca 188

---

>emb|BX067787.1|CNS09OGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 839 cgcacagccagtagcggttgggcgagaagca 809

---

>emb|BX067705.1|CNS09OEL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX067646.1|CNS09OCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326

---

>emb|BX067645.1|CNS09OCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 838 cgcacagccagtagcggttgggcgagaagca 808

---

>emb|BX067635.1|CNS09OCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 841 cgcacagccagtagcggttgggcgagaagca 811

---

>emb|BX067585.1|CNS09OB9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 464

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 297 cgcacagccagtagcggttgggcgagaagca 327

---

>emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 904 cgcacagccagtagcggttgggcgagaagca 874

---

>emb|BX067492.1|CNS09O8O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 301 cgcacagccagtagcggttgggcgagaagca 331

---

>emb|BX067491.1|CNS09O8N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 836 cgcacagccagtagcggttgggcgagaagca 806

---

>emb|BX066978.1|CNS09NUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 807 cgcacagccagtagcggttgggcgagaagca 777

---

>emb|BX066951.1|CNS09NTN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 318 cgcacagccagtagcggttgggcgagaagca 348

---

>emb|BX066950.1|CNS09NTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 866 cgcacagccagtagcggttgggcgagaagca 836

---

>emb|BX066945.1|CNS09NTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 425

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 302 cgcacagccagtagcggttgggcgagaagca 332

---

>emb|BX066944.1|CNS09NTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX066941.1|CNS09NTD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 306 cgcacagccagtagcggttgggcgagaagca 336

---

>emb|BX066940.1|CNS09NTC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 551 cgcacagccagtagcggttgggcgagaagca 521

---

>emb|BX066917.1|CNS09NSP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 312 cgcacagccagtagcggttgggcgagaagca 342

---

>emb|BX066916.1|CNS09NSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 844 cgcacagccagtagcggttgggcgagaagca 814

---

>emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 852 cgcacagccagtagcggttgggcgagaagca 822

---

>emb|BX066716.1|CNS09NN4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 240

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 158 cgcacagccagtagcggttgggcgagaagca 188

---

>emb|BX066638.1|CNS09NKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 314 cgcacagccagtagcggttgggcgagaagca 344

---

>emb|BX066637.1|CNS09NKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1056

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 851 cgcacagccagtagcggttgggcgagaagca 821

---

>emb|BX066110.1|CNS09N6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 298 cgcacagccagtagcggttgggcgagaagca 328

---

>emb|BX066109.1|CNS09N69 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 835 cgcacagccagtagcggttgggcgagaagca 805

---

>emb|BX066047.1|CNS09N4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 341

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 158 cgcacagccagtagcggttgggcgagaagca 188

---

>emb|BX066046.1|CNS09N4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 833 cgcacagccagtagcggttgggcgagaagca 803

---

>emb|BX065996.1|CNS09N34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 553 cgcacagccagtagcggttgggcgagaagca 523

---

>emb|BX065949.1|CNS09N1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 295 cgcacagccagtagcggttgggcgagaagca 325

---

>emb|BX065948.1|CNS09N1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 904 cgcacagccagtagcggttgggcgagaagca 874

---

>emb|BX065904.1|CNS09N0K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 314 cgcacagccagtagcggttgggcgagaagca 344

---

>emb|BX065815.1|CNS09MY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 305 cgcacagccagtagcggttgggcgagaagca 335

---

>emb|BX065814.1|CNS09MY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX065711.1|CNS09MV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 633

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 289 cgcacagccagtagcggttgggcgagaagca 319

---

>emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 838 cgcacagccagtagcggttgggcgagaagca 808

---

>emb|BX065604.1|CNS09MS8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 835 cgcacagccagtagcggttgggcgagaagca 805

---

>emb|BX065506.1|CNS09MPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 309 cgcacagccagtagcggttgggcgagaagca 339

---

>emb|BX065505.1|CNS09MPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 841 cgcacagccagtagcggttgggcgagaagca 811

---

>emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 295 cgcacagccagtagcggttgggcgagaagca 325

---

>emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 842 cgcacagccagtagcggttgggcgagaagca 812

---

>emb|BX065353.1|CNS09ML9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326

---

>emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 842 cgcacagccagtagcggttgggcgagaagca 812

---

>emb|BX065157.1|CNS09MFT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 548 cgcacagccagtagcggttgggcgagaagca 518

---

>emb|BX065023.1|CNS09MC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 325

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 260 cgcacagccagtagcggttgggcgagaagca 290

---

>emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 809 cgcacagccagtagcggttgggcgagaagca 779

---

>emb|BX064965.1|CNS09MAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 283 cgcacagccagtagcggttgggcgagaagca 313

---

>emb|BX064964.1|CNS09MAG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 813 cgcacagccagtagcggttgggcgagaagca 783

---

>emb|BX064854.1|CNS09M7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 201 cgcacagccagtagcggttgggcgagaagca 231

---

>emb|BX064853.1|CNS09M7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 744 cgcacagccagtagcggttgggcgagaagca 714

---

>emb|BX064529.1|CNS09LYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 287 cgcacagccagtagcggttgggcgagaagca 317

---

>emb|BX064405.1|CNS09LUX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 321 cgcacagccagtagcggttgggcgagaagca 351

---

>emb|BX064360.1|CNS09LTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 858 cgcacagccagtagcggttgggcgagaagca 828

---

>emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 299 cgcacagccagtagcggttgggcgagaagca 329

---

>emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 833 cgcacagccagtagcggttgggcgagaagca 803

---

>emb|BX064233.1|CNS09LQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 301 cgcacagccagtagcggttgggcgagaagca 331

---

>emb|BX064232.1|CNS09LQ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 848 cgcacagccagtagcggttgggcgagaagca 818

---

>emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 840 cgcacagccagtagcggttgggcgagaagca 810

---

>emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 282 cgcacagccagtagcggttgggcgagaagca 312

---

>emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 833 cgcacagccagtagcggttgggcgagaagca 803

---

>emb|BX063936.1|CNS09LHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 839 cgcacagccagtagcggttgggcgagaagca 809

---

>emb|BX063919.1|CNS09LHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 324 cgcacagccagtagcggttgggcgagaagca 354

---

>emb|BX063918.1|CNS09LHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 858 cgcacagccagtagcggttgggcgagaagca 828

---

>emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 301 cgcacagccagtagcggttgggcgagaagca 331

---

>emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 851 cgcacagccagtagcggttgggcgagaagca 821

---

>emb|BX063359.1|CNS09L1V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 285 cgcacagccagtagcggttgggcgagaagca 315

---

>emb|BX063358.1|CNS09L1U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 815 cgcacagccagtagcggttgggcgagaagca 785

---

>emb|BX063357.1|CNS09L1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 274 cgcacagccagtagcggttgggcgagaagca 304

---

>emb|BX063356.1|CNS09L1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 819 cgcacagccagtagcggttgggcgagaagca 789

---

>emb|BX063204.1|CNS09KXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 302 cgcacagccagtagcggttgggcgagaagca 332

---

>emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX063052.1|CNS09KTC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326

---

>emb|BX063051.1|CNS09KTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 774 cgcacagccagtagcggttgggcgagaagca 744

---

>emb|BX063016.1|CNS09KSC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 316 cgcacagccagtagcggttgggcgagaagca 346

---

>emb|BX063014.1|CNS09KSA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 316 cgcacagccagtagcggttgggcgagaagca 346

---

>emb|BX062938.1|CNS09KQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 517

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 288 cgcacagccagtagcggttgggcgagaagca 318

---

>emb|BX062802.1|CNS09KME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 612

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 310 cgcacagccagtagcggttgggcgagaagca 340

---

>emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 289 cgcacagccagtagcggttgggcgagaagca 319

---

>emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 830 cgcacagccagtagcggttgggcgagaagca 800

---

>emb|BX062775.1|CNS09KLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 291 cgcacagccagtagcggttgggcgagaagca 321

---

>emb|BX062774.1|CNS09KLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 840 cgcacagccagtagcggttgggcgagaagca 810

---

>emb|BX062707.1|CNS09KJR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 293 cgcacagccagtagcggttgggcgagaagca 323

---

>emb|BX062706.1|CNS09KJQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 741 cgcacagccagtagcggttgggcgagaagca 711

---

>emb|BX062617.1|CNS09KH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 294 cgcacagccagtagcggttgggcgagaagca 324

---

>emb|BX062616.1|CNS09KH8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 831 cgcacagccagtagcggttgggcgagaagca 801

---

>emb|BX062615.1|CNS09KH7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 298 cgcacagccagtagcggttgggcgagaagca 328

---

>emb|BX062614.1|CNS09KH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1062

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 830 cgcacagccagtagcggttgggcgagaagca 800

---

>emb|BX062265.1|CNS09K7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 291 cgcacagccagtagcggttgggcgagaagca 321

---

>emb|BX062264.1|CNS09K7G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 801 cgcacagccagtagcggttgggcgagaagca 771

---

>emb|BX062196.1|CNS09K5K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 289 cgcacagccagtagcggttgggcgagaagca 319

---

>emb|BX062195.1|CNS09K5J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1076

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 837 cgcacagccagtagcggttgggcgagaagca 807

---

>emb|BX062152.1|CNS09K4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1028

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326

---

>emb|BX062151.1|CNS09K4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1094

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 835 cgcacagccagtagcggttgggcgagaagca 805

---

>emb|BX062132.1|CNS09K3S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 300 cgcacagccagtagcggttgggcgagaagca 330

---

>emb|BX062131.1|CNS09K3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1080

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 835 cgcacagccagtagcggttgggcgagaagca 805

---

>emb|BX062052.1|CNS09K1K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 418

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 287 cgcacagccagtagcggttgggcgagaagca 317

---

>emb|BX061984.1|CNS09JZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 305 cgcacagccagtagcggttgggcgagaagca 335

---

>emb|BX061983.1|CNS09JZN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 841 cgcacagccagtagcggttgggcgagaagca 811

---

>emb|BX061962.1|CNS09JZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 304 cgcacagccagtagcggttgggcgagaagca 334

---

>emb|BX061961.1|CNS09JZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 831 cgcacagccagtagcggttgggcgagaagca 801

---

>emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 288 cgcacagccagtagcggttgggcgagaagca 318

---

>emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 834 cgcacagccagtagcggttgggcgagaagca 804

---

>emb|BX061867.1|CNS09JWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 297 cgcacagccagtagcggttgggcgagaagca 327

---

>emb|BX061866.1|CNS09JWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 834 cgcacagccagtagcggttgggcgagaagca 804

---

>emb|BX061808.1|CNS09JUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 283 cgcacagccagtagcggttgggcgagaagca 313

---

>emb|BX061807.1|CNS09JUR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 832 cgcacagccagtagcggttgggcgagaagca 802

---

>emb|BX061804.1|CNS09JUO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 286 cgcacagccagtagcggttgggcgagaagca 316

---

>emb|BX061803.1|CNS09JUN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 841 cgcacagccagtagcggttgggcgagaagca 811

---

>emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 290 cgcacagccagtagcggttgggcgagaagca 320

---

>emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 832 cgcacagccagtagcggttgggcgagaagca 802

---

>emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326

---

>emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 861 cgcacagccagtagcggttgggcgagaagca 831

---

>emb|BX061589.1|CNS09JOP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 298 cgcacagccagtagcggttgggcgagaagca 328

---

>emb|BX061588.1|CNS09JOO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 837 cgcacagccagtagcggttgggcgagaagca 807

---

>emb|BX061562.1|CNS09JNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 301 cgcacagccagtagcggttgggcgagaagca 331

---

>emb|BX061561.1|CNS09JNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 845 cgcacagccagtagcggttgggcgagaagca 815

---

>emb|BX061522.1|CNS09JMU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 304 cgcacagccagtagcggttgggcgagaagca 334

---

>emb|BX061521.1|CNS09JMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 830 cgcacagccagtagcggttgggcgagaagca 800

---

>emb|BX061174.1|CNS09JD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 261 cgcacagccagtagcggttgggcgagaagca 291

---

>emb|BX061173.1|CNS09JD5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 731 cgcacagccagtagcggttgggcgagaagca 701

---

>emb|BX060748.1|CNS09J1C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 277 cgcacagccagtagcggttgggcgagaagca 307

---

>emb|BX060747.1|CNS09J1B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 818 cgcacagccagtagcggttgggcgagaagca 788

---

>emb|BX060414.1|CNS09IS2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 291 cgcacagccagtagcggttgggcgagaagca 321

---

>emb|BX060410.1|CNS09IRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 306 cgcacagccagtagcggttgggcgagaagca 336

---

>emb|BX060409.1|CNS09IRX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1056

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 852 cgcacagccagtagcggttgggcgagaagca 822

---

>emb|BX060393.1|CNS09IRH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 288 cgcacagccagtagcggttgggcgagaagca 318

---

>emb|BX060392.1|CNS09IRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 829 cgcacagccagtagcggttgggcgagaagca 799

---

>emb|BX060282.1|CNS09IOE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 298 cgcacagccagtagcggttgggcgagaagca 328

---

>emb|BX060281.1|CNS09IOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 810 cgcacagccagtagcggttgggcgagaagca 780

---

>emb|BX060076.1|CNS09IIO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 757 cgcacagccagtagcggttgggcgagaagca 727

---

>emb|BX060049.1|CNS09IHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 291 cgcacagccagtagcggttgggcgagaagca 321

---

>emb|BX060048.1|CNS09IHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 832 cgcacagccagtagcggttgggcgagaagca 802

---

>emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 815 cgcacagccagtagcggttgggcgagaagca 785

---

>emb|BX059637.1|CNS09I6H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 833 cgcacagccagtagcggttgggcgagaagca 803

---

>emb|BX059608.1|CNS09I5O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 517 cgcacagccagtagcggttgggcgagaagca 487

---

>emb|BX059419.1|CNS09I0F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 294 cgcacagccagtagcggttgggcgagaagca 324

---

>emb|BX059418.1|CNS09I0E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 846 cgcacagccagtagcggttgggcgagaagca 816

---

>emb|BX059402.1|CNS09HZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 304 cgcacagccagtagcggttgggcgagaagca 334

---

>emb|BX059401.1|CNS09HZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 888 cgcacagccagtagcggttgggcgagaagca 858

---

>emb|BX059380.1|CNS09HZC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 308 cgcacagccagtagcggttgggcgagaagca 338

---

>emb|BX059379.1|CNS09HZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 842 cgcacagccagtagcggttgggcgagaagca 812

---

>emb|BX059205.1|CNS09HUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 285 cgcacagccagtagcggttgggcgagaagca 315

---

>emb|BX059204.1|CNS09HUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 838 cgcacagccagtagcggttgggcgagaagca 808

---

>emb|BX059163.1|CNS09HTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 289 cgcacagccagtagcggttgggcgagaagca 319

---

>emb|BX059162.1|CNS09HTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 836 cgcacagccagtagcggttgggcgagaagca 806

---

>emb|BX059100.1|CNS09HRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 300 cgcacagccagtagcggttgggcgagaagca 330

---

>emb|BX059099.1|CNS09HRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 848 cgcacagccagtagcggttgggcgagaagca 818

---

>emb|BX059084.1|CNS09HR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 375 cgcagagccagtagcggttgggcgagaagca 405
           |||| ||||||||||||||||||||||||||
Sbjct: 296 cgcacagccagtagcggttgggcgagaagca 326


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,176,211
Number of Sequences: 3902068
Number of extensions: 3176211
Number of successful extensions: 56552
Number of sequences better than 10.0: 1363
Number of HSP's better than 10.0 without gapping: 1360
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 54002
Number of HSP's gapped (non-prelim): 2552
length of query: 443
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 421
effective length of database: 17,147,199,772
effective search space: 7218971104012
effective search space used: 7218971104012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---