ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet70c03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z49146.1|HVPAL3MR H.vulgare partial PAL mRNA for phenylalani... 852 0.0
2gb|AY973992.1| Bambusa ventricosa putative phenylalanine ammonia... 170 2e-39
3ref|XM_466843.1| Oryza sativa (japonica cultivar-group), mRNA 163 6e-37
4emb|X16099.1|OSPAL Rice gene for phenylalanine ammonia-lyase (EC... 163 6e-37
5dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 163 6e-37
6dbj|AP005000.3| Oryza sativa (japonica cultivar-group) genomic D... 163 6e-37
7dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic D... 163 6e-37
8dbj|AK102817.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
9dbj|AK058306.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
10dbj|AK067923.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
11ref|XM_473192.1| Oryza sativa (japonica cultivar-group), predic... 141 2e-30
12gb|AY224546.1| Oryza sativa (japonica cultivar-group) isolate 24... 141 2e-30
13emb|AL731616.5|OSJN00262 Oryza sativa genomic DNA, chromosome 4,... 141 2e-30
14dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
15dbj|AK100346.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
16emb|AL731629.2|OSJN00274 Oryza sativa genomic DNA, chromosome 4,... 141 2e-30
17gb|AY103647.1| Zea mays PCO142084 mRNA sequence 137 3e-29
18gb|M95077.1|MZEORFR Zea mays putative phenylalanine ammonia lyas... 137 3e-29
19gb|L77912.1|MZEPAL Zea mays phenylalanine ammonia-lyase mRNA, co... 131 2e-27
20gb|AY106831.1| Zea mays PCO142079 mRNA sequence 117 3e-23
21ref|XM_466849.1| Oryza sativa (japonica cultivar-group), mRNA 90 7e-15
22emb|X87946.1|OSDNAZB8 O.sativa ZB8 gene 90 7e-15
23dbj|AK068993.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 7e-15
24ref|XM_473196.1| Oryza sativa (japonica cultivar-group), predic... 82 2e-12
25gb|BT018802.1| Zea mays clone EL01N0529D05.d mRNA sequence 82 2e-12
26dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
27gb|AY005474.1| Triticum aestivum inducible phenylalanine ammonia... 82 2e-12
28dbj|AK067801.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
29gb|AY104679.1| Zea mays PCO142078 mRNA sequence 82 2e-12
30gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 82 2e-12
31emb|AL732380.4|CNS08C93 Oryza sativa chromosome 12, . BAC OSJNBb... 82 2e-12
32gb|AY450643.1| Bambusa oldhamii phenylalanine ammonia-lyase (PAL... 80 7e-12
33ref|XM_475254.1| Oryza sativa (japonica cultivar-group), predic... 74 4e-10
34gb|AC135419.2| Oryza sativa (japonica cultivar-group) chromosome... 74 4e-10
35gb|AC135429.2| Oryza sativa (japonica cultivar-group) chromosome... 74 4e-10
36emb|X99705.1|TAPALGEN1 T.aestivum PAL gene 74 4e-10
37dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
38emb|X99725.1|TAPALGEN2 T.aestivum PAL gene, coding region 72 2e-09
39ref|XM_466846.1| Oryza sativa (japonica cultivar-group), mRNA 64 4e-07
40gb|L11883.1|WHTWALI4A Triticum aestivum phenylalanine ammonia-ly... 60 6e-06
41ref|XM_466845.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.006
42dbj|AK120127.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
43emb|Z15085.1|OSGP28G O.sativa GP28 gene (partial) 50 0.006
44emb|X99483.1|HVPAL6 H.vulgare mRNA for phenylalanine ammonia-lya... 50 0.006
45dbj|AK065208.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
46dbj|AK061959.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
47gb|AC129351.6| Homo sapiens 12 BAC RP11-466G11 (Roswell Park Can... 46 0.098
48gb|AC129675.6| Homo sapiens 12 BAC RP11-310A24 (Roswell Park Can... 46 0.098
49emb|Z49145.1|HVPAL2MR H.vulgare partial PAL mRNA for phenylalani... 46 0.098
50gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5... 42 1.5
51ref|XR_005088.1| PREDICTED: Mus musculus hypothetical protein LO... 42 1.5
52ref|XR_004983.1| PREDICTED: Mus musculus similar to preferential... 42 1.5
53ref|XM_112266.6| PREDICTED: Mus musculus similar to preferential... 42 1.5
54ref|XM_205435.6| PREDICTED: Mus musculus similar to preferential... 42 1.5
55ref|XM_539018.2| PREDICTED: Canis familiaris similar to inhibito... 42 1.5
56gb|AC098888.4| Mus musculus BAC clone RP23-122N8 from 8, complet... 42 1.5
57gb|AC129623.4| Homo sapiens 12 BAC CTD-2107C6 (Cal Tech Human BA... 42 1.5
58emb|BX005100.9| Mouse DNA sequence from clone RP23-76P22 on chro... 42 1.5
59gb|AC074237.4| Homo sapiens chromosome 18, clone RP11-333K18, co... 42 1.5
60gb|AY036011.1| Manihot esculenta phenylalanine ammonia-lyase 1 (... 42 1.5
61dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
62dbj|AP006235.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
63dbj|AP005876.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
64gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, c... 42 1.5
65gb|AY098511.1| Ananas comosus phenylalanine ammonia-lyase mRNA, ... 42 1.5
66emb|AL626771.9| Mouse DNA sequence from clone RP23-281O10 on chr... 42 1.5
67emb|AL713865.10| Mouse DNA sequence from clone RP23-451D4 on chr... 42 1.5
68gb|AC168206.7| Mus musculus chromosome 1, clone RP23-17B20, comp... 40 6.0
69gb|AC099582.7| Mus musculus chromosome 1, clone RP23-188D7, comp... 40 6.0
70gb|AC145477.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
71gb|AC115035.5| Mus musculus chromosome 3, clone RP24-273F11, com... 40 6.0
72gb|BC070761.1| Xenopus laevis hypothetical protein MGC83782, mRN... 40 6.0
73gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
74gb|AC162790.2| Mus musculus chromosome 3, clone RP24-397C18, com... 40 6.0
75gb|AC073258.9| Homo sapiens BAC clone RP11-221B19 from 7, comple... 40 6.0
76gb|AC129198.3| Mus musculus BAC clone RP24-183I4 from chromosome... 40 6.0
77gb|AC099413.3| Mus musculus BAC clone RP23-2O10 from 4, complete... 40 6.0
78gb|AC114916.5| Mus musculus BAC clone RP23-68E10 from 15, comple... 40 6.0
79gb|AC099342.5| Homo sapiens BAC clone RP11-323F6 from 7, complet... 40 6.0
80gb|AC005083.1| Homo sapiens BAC clone CTA-281G5 from 7, complete... 40 6.0
81emb|AL596223.3| Human DNA sequence from clone RP11-227H15 on chr... 40 6.0
82emb|AL356096.11| Human DNA sequence from clone RP11-366K1 on chr... 40 6.0
83emb|AL031906.1|HS90O12 Human DNA sequence from clone RP1-90O12 o... 40 6.0
84emb|CR450810.5| Zebrafish DNA sequence from clone CH211-156N19 i... 40 6.0
85emb|X79047.1|EC12TCGWT Echovirus type 12, prototype Travis wild ... 40 6.0
86emb|X61581.1|DDPROFLI D.discoideum mRNA for profilin I 40 6.0
87emb|AL034557.8|PFMAL4P1 Plasmodium falciparum MAL4P1 40 6.0
88emb|BX530064.8| Zebrafish DNA sequence from clone CH211-232M19 i... 40 6.0
89emb|BX005068.13| Zebrafish DNA sequence from clone DKEY-40H17 in... 40 6.0
90gb|AC027489.8| Homo sapiens chromosome , clone RP11-453M23, comp... 40 6.0
91emb|BX005425.12| Zebrafish DNA sequence from clone DKEY-7O6 in l... 40 6.0
92gb|AC048352.18| Homo sapiens 12 BAC RP11-871F6 (Roswell Park Can... 40 6.0
93gb|AC079596.11| Homo sapiens 12 BAC RP11-632N20 (Roswell Park Ca... 40 6.0
94gb|AC093122.12| Homo sapiens 12 BAC RP11-317E2 (Roswell Park Can... 40 6.0
95gb|AC106727.5| Homo sapiens 3q BAC RP11-534K3 (Roswell Park Canc... 40 6.0
96dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 40 6.0
97gb|AC023538.7| Homo sapiens chromosome 8, clone RP11-510I21, com... 40 6.0
98gb|AC022039.7| Homo sapiens chromosome 8, clone RP11-3G21, compl... 40 6.0
99gb|AC091108.5| Homo sapiens chromosome 18, clone RP11-765H19, co... 40 6.0
100gb|AC026398.5| Homo sapiens chromosome 5 clone CTB-127M13, compl... 40 6.0
101gb|BC097918.1| Xenopus laevis cDNA clone IMAGE:6868144, partial cds 40 6.0
102emb|BX470254.7| Zebrafish DNA sequence from clone CH211-256M1 in... 40 6.0
103gb|AC008220.5|AC008220 Drosophila melanogaster, chromosome 3R, r... 40 6.0
104gb|AC007975.7|AC007975 Drosophila melanogaster, chromosome 3R, r... 40 6.0
105gb|AE014844.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 6.0
106emb|BX255877.14| Zebrafish DNA sequence from clone CH211-254C9, ... 40 6.0
107emb|BX571894.9| Mouse DNA sequence from clone RP23-203N8 on chro... 40 6.0
108gb|AC006034.2|AC006034 Homo sapiens BAC clone RP11-144M13 from 7... 40 6.0
109emb|BX539323.11| Zebrafish DNA sequence from clone DKEY-58P11 in... 40 6.0
110gb|AE003776.2| Drosophila melanogaster chromosome 3R, section 11... 40 6.0
111emb|AL121767.6|CNS01DSC Human chromosome 14 DNA sequence BAC C-2... 40 6.0
112emb|CR846103.8| Zebrafish DNA sequence from clone DKEY-28K9 in l... 40 6.0
113emb|AL772421.5|CNS08C9Z Oryza sativa chromosome 12, . BAC OJ1007... 40 6.0
114emb|AL732360.12| Mouse DNA sequence from clone RP23-405B14 on ch... 40 6.0
115emb|CR854921.10| Zebrafish DNA sequence from clone DKEY-287M23 i... 40 6.0
116emb|AL929017.9| Zebrafish DNA sequence from clone DKEY-4C15 in l... 40 6.0
117dbj|AP006535.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 6.0
118gb|AC154809.2| Mus musculus BAC clone RP24-528G7 from chromosome... 40 6.0
119emb|AL772320.12| Mouse DNA sequence from clone RP23-346F2 on chr... 40 6.0

>emb|Z49146.1|HVPAL3MR H.vulgare partial PAL mRNA for phenylalanine ammonia-lyase (1831 bp)
          Length = 1831

 Score =  852 bits (430), Expect = 0.0
 Identities = 433/434 (99%)
 Strand = Plus / Minus

                                                                        
Query: 15   tagtatgtatatatattgtattatagtaaaagcaaaacattttgcaaagacagtaataca 74
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1814 tagtatgtatatatattgtattatagtaaaagcaaaacattttgcaaagacagtaataca 1755

                                                                        
Query: 75   agcaaaaaagaagccgcgtagtattagcataattcaccccaaaatacaacgacaatatct 134
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1754 agcaaaaaagaagccacgtagtattagcataattcaccccaaaatacaacgacaatatct 1695

                                                                        
Query: 135  gtaggtaaagctgcgggtccgccatggctgagcagctacacaattaacaacacacgtcga 194
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1694 gtaggtaaagctgcgggtccgccatggctgagcagctacacaattaacaacacacgtcga 1635

                                                                        
Query: 195  tcaacaccaacgcacgaacaagtaaaggcaaaagcgacaggaactgaagtaagaacatgc 254
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1634 tcaacaccaacgcacgaacaagtaaaggcaaaagcgacaggaactgaagtaagaacatgc 1575

                                                                        
Query: 255  acgaacggattaagcgtcttatttttggatgtactttggaagcctcctcctctcctccac 314
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1574 acgaacggattaagcgtcttatttttggatgtactttggaagcctcctcctctcctccac 1515

                                                                        
Query: 315  ggtggcacggacgatccttcagacgttgatgggcaggggctcgccgttccactccttgag 374
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1514 ggtggcacggacgatccttcagacgttgatgggcaggggctcgccgttccactccttgag 1455

                                                                        
Query: 375  gcactcgagcatggggtcgatgagcttgttctggctgatgccgaggaagaccttggtgca 434
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1454 gcactcgagcatggggtcgatgagcttgttctggctgatgccgaggaagaccttggtgca 1395

                          
Query: 435  ttcctcgccggggg 448
            ||||||||||||||
Sbjct: 1394 ttcctcgccggggg 1381



to top

>gb|AY973992.1| Bambusa ventricosa putative phenylalanine ammonia-lyase mRNA,
            complete cds
          Length = 2353

 Score =  170 bits (86), Expect = 2e-39
 Identities = 104/110 (94%)
 Strand = Plus / Minus

                                                                        
Query: 339  gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2104 gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 2045

                                                              
Query: 399  cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            ||||  |||||||||||||| ||| |||||| |||| |||||||||||||
Sbjct: 2044 cttgccctggctgatgccgatgaacaccttgttgcactcctcgccggggg 1995



to top

>ref|XM_466843.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2502

 Score =  163 bits (82), Expect = 6e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                        
Query: 339  gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
            ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2189 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 2130

                                                              
Query: 399  cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            ||||  |||||||||||||||||| |||||| |||| |||||||||||||
Sbjct: 2129 cttgccctggctgatgccgaggaacaccttgttgcactcctcgccggggg 2080



to top

>emb|X16099.1|OSPAL Rice gene for phenylalanine ammonia-lyase (EC 4.3.1.5)
          Length = 4412

 Score =  163 bits (82), Expect = 6e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                        
Query: 339  gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
            ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 4066 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 4007

                                                              
Query: 399  cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            ||||  |||||||||||||||||| |||||| |||| |||||||||||||
Sbjct: 4006 cttgccctggctgatgccgaggaacaccttgttgcactcctcgccggggg 3957



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  163 bits (82), Expect = 6e-37
 Identities = 103/110 (93%)
 Strand = Plus / Plus

                                                                            
Query: 339      gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
                ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 24992256 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 24992315

                                                                  
Query: 399      cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
                ||||  |||||||||||||||||| |||||| |||| |||||||||||||
Sbjct: 24992316 cttgccctggctgatgccgaggaacaccttgttgcactcctcgccggggg 24992365



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 54/57 (94%)
 Strand = Plus / Plus

                                                                         
Query: 346      ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
                ||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 25025228 ggcaggggctcgccgttccactccttgaggcactcgagcaacgggtcgatgtgcttg 25025284



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 342      gatgggcaggggctcgccgttccactccttgaggcactcgagca 385
                ||||||||||||| ||||||||||||||||||| ||||| ||||
Sbjct: 25011629 gatgggcaggggcgcgccgttccactccttgagacactcaagca 25011672



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                         
Query: 346      ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
                ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 25004085 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 25004141



to top

>dbj|AP005000.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0042D01
          Length = 148305

 Score =  163 bits (82), Expect = 6e-37
 Identities = 103/110 (93%)
 Strand = Plus / Plus

                                                                        
Query: 339  gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
            ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 5244 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 5303

                                                              
Query: 399  cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            ||||  |||||||||||||||||| |||||| |||| |||||||||||||
Sbjct: 5304 cttgccctggctgatgccgaggaacaccttgttgcactcctcgccggggg 5353



 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 54/57 (94%)
 Strand = Plus / Plus

                                                                      
Query: 346   ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
             ||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 38216 ggcaggggctcgccgttccactccttgaggcactcgagcaacgggtcgatgtgcttg 38272



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 342   gatgggcaggggctcgccgttccactccttgaggcactcgagca 385
             ||||||||||||| ||||||||||||||||||| ||||| ||||
Sbjct: 24617 gatgggcaggggcgcgccgttccactccttgagacactcaagca 24660



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 346   ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
             ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 17073 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 17129



to top

>dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:B1215B07
          Length = 165957

 Score =  163 bits (82), Expect = 6e-37
 Identities = 103/110 (93%)
 Strand = Plus / Plus

                                                                          
Query: 339    gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
              ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 153539 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 153598

                                                                
Query: 399    cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
              ||||  |||||||||||||||||| |||||| |||| |||||||||||||
Sbjct: 153599 cttgccctggctgatgccgaggaacaccttgttgcactcctcgccggggg 153648



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                       
Query: 346    ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
              ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 165368 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 165424



to top

>dbj|AK102817.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108N04, full
            insert sequence
          Length = 2504

 Score =  163 bits (82), Expect = 6e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                        
Query: 339  gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
            ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2191 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 2132

                                                              
Query: 399  cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            ||||  |||||||||||||||||| |||||| |||| |||||||||||||
Sbjct: 2131 cttgccctggctgatgccgaggaacaccttgttgcactcctcgccggggg 2082



to top

>dbj|AK058306.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H03, full
           insert sequence
          Length = 1298

 Score =  163 bits (82), Expect = 6e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                       
Query: 339 gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
           ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 983 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 924

                                                             
Query: 399 cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
           ||||  |||||||||||||||||| |||||| |||| |||||||||||||
Sbjct: 923 cttgccctggctgatgccgaggaacaccttgttgcactcctcgccggggg 874



to top

>dbj|AK067923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013126B03, full
            insert sequence
          Length = 1531

 Score =  155 bits (78), Expect = 1e-34
 Identities = 102/110 (92%)
 Strand = Plus / Minus

                                                                        
Query: 339  gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
            ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 1218 gttgatgggaaggggctcgccgttccactccttgaggcagtcgagcatggggtcgatgag 1159

                                                              
Query: 399  cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            ||||  |||||||||||||||||| |||||| |||| ||| |||||||||
Sbjct: 1158 cttgccctggctgatgccgaggaacaccttgttgcactccccgccggggg 1109



to top

>ref|XM_473192.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2124

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Minus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 2118 gatgggcaggggctcgccgttccactccttgaggcactcgagcatcgggtcgatgagctt 2059

                                                           
Query: 402  gttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            |  || ||||||| | ||||| |||||| |||| |||||||||||||
Sbjct: 2058 gcgctcgctgatggccaggaacaccttgttgcactcctcgccggggg 2012



to top

>gb|AY224546.1| Oryza sativa (japonica cultivar-group) isolate 24080 phenylalanine
            ammonia-lyase mRNA, complete cds
          Length = 2016

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Minus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 2010 gatgggcaggggctcgccgttccactccttgaggcactcgagcatcgggtcgatgagctt 1951

                                                           
Query: 402  gttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            |  || ||||||| | ||||| |||||| |||| |||||||||||||
Sbjct: 1950 gcgctcgctgatggccaggaacaccttgttgcactcctcgccggggg 1904



to top

>emb|AL731616.5|OSJN00262 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073E02,
             complete sequence
          Length = 139080

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Plus

                                                                         
Query: 342   gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
             ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 98032 gatgggcaggggctcgccgttccactccttgaggcactcgagcatcgggtcgatgagctt 98091

                                                            
Query: 402   gttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
             |  || ||||||| | ||||| |||||| |||| |||||||||||||
Sbjct: 98092 gcgctcgctgatggccaggaacaccttgttgcactcctcgccggggg 98138



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                          
Query: 342    gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
              ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 118218 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 118277

               
Query: 402    g 402
              |
Sbjct: 118278 g 118278



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Plus

                                                                            
Query: 342      gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 25880622 gatgggcaggggctcgccgttccactccttgaggcactcgagcatcgggtcgatgagctt 25880681

                                                               
Query: 402      gttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
                |  || ||||||| | ||||| |||||| |||| |||||||||||||
Sbjct: 25880682 gcgctcgctgatggccaggaacaccttgttgcactcctcgccggggg 25880728



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                            
Query: 342      gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
                ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 25900808 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 25900867

                 
Query: 402      g 402
                |
Sbjct: 25900868 g 25900868



to top

>dbj|AK100346.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023082J11, full
            insert sequence
          Length = 2510

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Minus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 2210 gatgggcaggggctcgccgttccactccttgaggcactcgagcatcgggtcgatgagctt 2151

                                                           
Query: 402  gttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            |  || ||||||| | ||||| |||||| |||| |||||||||||||
Sbjct: 2150 gcgctcgctgatggccaggaacaccttgttgcactcctcgccggggg 2104



to top

>emb|AL731629.2|OSJN00274 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0061C13,
            complete sequence
          Length = 139226

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Plus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 6884 gatgggcaggggctcgccgttccactccttgaggcactcgagcatcgggtcgatgagctt 6943

                                                           
Query: 402  gttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            |  || ||||||| | ||||| |||||| |||| |||||||||||||
Sbjct: 6944 gcgctcgctgatggccaggaacaccttgttgcactcctcgccggggg 6990



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                         
Query: 342   gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
             ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 27070 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 27129

              
Query: 402   g 402
             |
Sbjct: 27130 g 27130



to top

>gb|AY103647.1| Zea mays PCO142084 mRNA sequence
          Length = 2598

 Score =  137 bits (69), Expect = 3e-29
 Identities = 102/113 (90%)
 Strand = Plus / Minus

                                                                        
Query: 336  gacgttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgat 395
            ||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||| | 
Sbjct: 2215 gacgttgatgggcagcggcttgccgtcccactccttgaggcactcgagcatggggtccac 2156

                                                                 
Query: 396  gagcttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            |||||||  |||||||||||||| ||| |||||| |||| |||||||||||||
Sbjct: 2155 gagcttgccctggctgatgccgacgaacaccttgttgcactcctcgccggggg 2103



to top

>gb|M95077.1|MZEORFR Zea mays putative phenylalanine ammonia lyase mRNA, partial cds
          Length = 190

 Score =  137 bits (69), Expect = 3e-29
 Identities = 102/113 (90%)
 Strand = Plus / Minus

                                                                       
Query: 336 gacgttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgat 395
           ||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||| | 
Sbjct: 181 gacgttgatgggcagcggcttgccgtcccactccttgaggcactcgagcatggggtccac 122

                                                                
Query: 396 gagcttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
           |||||||  |||||||||||||| ||| |||||| |||| |||||||||||||
Sbjct: 121 gagcttgccctggctgatgccgacgaacaccttgttgcactcctcgccggggg 69



to top

>gb|L77912.1|MZEPAL Zea mays phenylalanine ammonia-lyase mRNA, complete cds
          Length = 2488

 Score =  131 bits (66), Expect = 2e-27
 Identities = 99/110 (90%)
 Strand = Plus / Minus

                                                                        
Query: 339  gttgatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgag 398
            |||||||||||| |||| ||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 2216 gttgatgggcagcggcttgccgtcccactccttgaggcactcgagcatggggtccacgag 2157

                                                              
Query: 399  cttgttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            ||||  |||||||||||||| ||| |||||| |||| |||||||||||||
Sbjct: 2156 cttgccctggctgatgccgacgaacaccttgttgcactcctcgccggggg 2107



to top

>gb|AY106831.1| Zea mays PCO142079 mRNA sequence
          Length = 2299

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            |||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||
Sbjct: 1968 gatgggcaggggcttgccgtcccactccttgaggcagtcgagcatggggtcgatgagctt 1909

                                                           
Query: 402  gttctggctgatgccgaggaagaccttggtgcattcctcgccggggg 448
            |  || ||||| | | ||||| |||||| |||| |||||||||||||
Sbjct: 1908 gccctcgctgagggccaggaacaccttgttgcactcctcgccggggg 1862



to top

>ref|XM_466849.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2407

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 54/57 (94%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 2167 ggcaggggctcgccgttccactccttgaggcactcgagcaacgggtcgatgtgcttg 2111



to top

>emb|X87946.1|OSDNAZB8 O.sativa ZB8 gene
          Length = 4660

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 54/57 (94%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 4566 ggcaggggctcgccgttccactccttgaggcactcgagcaacgggtcgatgtgcttg 4510



to top

>dbj|AK068993.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001A06, full
            insert sequence
          Length = 2406

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 54/57 (94%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 2166 ggcaggggctcgccgttccactccttgaggcactcgagcaacgggtcgatgtgcttg 2110



to top

>ref|XM_473196.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2145

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 2139 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 2080

             
Query: 402  g 402
            |
Sbjct: 2079 g 2079



to top

>gb|BT018802.1| Zea mays clone EL01N0529D05.d mRNA sequence
          Length = 1451

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||||||| ||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 1116 ggcaggggcgcgccgttccactccttgaggcactcgagcagcgggtcgatgtgcttg 1060



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                            
Query: 342      gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
                ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 16320140 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 16320199

                 
Query: 402      g 402
                |
Sbjct: 16320200 g 16320200



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 103      ataattcaccccaaaatacaacga 126
                ||||||||||||||| ||||||||
Sbjct: 10527685 ataattcaccccaaattacaacga 10527708



to top

>gb|AY005474.1| Triticum aestivum inducible phenylalanine ammonia-lyase mRNA, partial
            cds
          Length = 1933

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||||||||||||||||||||||||||||||||| ||||  ||||||||| |||||
Sbjct: 1625 ggcaggggctcgccgttccactccttgaggcactccagcagcgggtcgatgtgcttg 1569



to top

>dbj|AK067801.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118I15, full
            insert sequence
          Length = 2551

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 2264 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 2205

             
Query: 402  g 402
            |
Sbjct: 2204 g 2204



to top

>gb|AY104679.1| Zea mays PCO142078 mRNA sequence
          Length = 1864

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||||||| ||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 1562 ggcaggggcgcgccgttccactccttgaggcactcgagcagcgggtcgatgtgcttg 1506



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                            
Query: 342      gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
                ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 16273373 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 16273432

                 
Query: 402      g 402
                |
Sbjct: 16273433 g 16273433



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 103      ataattcaccccaaaatacaacga 126
                ||||||||||||||| ||||||||
Sbjct: 10527567 ataattcaccccaaattacaacga 10527590



to top

>emb|AL732380.4|CNS08C93 Oryza sativa chromosome 12, . BAC OSJNBb0119N22 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 79613

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                         
Query: 342   gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
             ||||||||| ||||||||||||||||||||||||||||||||||  | ||||||| ||||
Sbjct: 67191 gatgggcagaggctcgccgttccactccttgaggcactcgagcagtgcgtcgatgtgctt 67250

              
Query: 402   g 402
             |
Sbjct: 67251 g 67251



to top

>gb|AY450643.1| Bambusa oldhamii phenylalanine ammonia-lyase (PAL1) mRNA, complete
            cds
          Length = 2139

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagctt 401
            ||||||||| ||||||||||||||||||||||||||||| ||||  ||||| ||| ||||
Sbjct: 2133 gatgggcagtggctcgccgttccactccttgaggcactcaagcagcgggtcaatgtgctt 2074

                                
Query: 402  gttctggctgatgccgagga 421
            |  |||| ||||| ||||||
Sbjct: 2073 gccctggttgatggcgagga 2054



to top

>ref|XM_475254.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2151

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||| ||| ||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 2141 ggcagtggcgcgccgttccactccttgaggcactcgagcagcgggtcgatgtgcttg 2085



to top

>gb|AC135419.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0044P19,
              complete sequence
          Length = 176917

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                       
Query: 346    ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
              ||||| ||| ||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 122631 ggcagtggcgcgccgttccactccttgaggcactcgagcagcgggtcgatgtgcttg 122687



to top

>gb|AC135429.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0636F09,
             complete sequence
          Length = 177374

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                      
Query: 346   ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
             ||||| ||| ||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 65212 ggcagtggcgcgccgttccactccttgaggcactcgagcagcgggtcgatgtgcttg 65268



to top

>emb|X99705.1|TAPALGEN1 T.aestivum PAL gene
          Length = 3444

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||||||||||||||||||||||||||||||||| ||||  | ||||||| |||||
Sbjct: 3097 ggcaggggctcgccgttccactccttgaggcactccagcagcgcgtcgatgtgcttg 3041



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                         
Query: 346      ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
                ||||| ||| ||||||||||||||||||||||||||||||  ||||||||| |||||
Sbjct: 20809407 ggcagtggcgcgccgttccactccttgaggcactcgagcagcgggtcgatgtgcttg 20809463



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 115     aaaatacaacgacaatatct 134
               ||||||||||||||||||||
Sbjct: 7843191 aaaatacaacgacaatatct 7843172



to top

>emb|X99725.1|TAPALGEN2 T.aestivum PAL gene, coding region
          Length = 1419

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                    
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagca 385
            ||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1011 ggcaggggctcgccgttccactccttgaggcactcaagca 972



to top

>ref|XM_466846.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2142

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 342  gatgggcaggggctcgccgttccactccttgaggcactcgagca 385
            ||||||||||||| ||||||||||||||||||| ||||| ||||
Sbjct: 2136 gatgggcaggggcgcgccgttccactccttgagacactcaagca 2093



to top

>gb|L11883.1|WHTWALI4A Triticum aestivum phenylalanine ammonia-lyase (wali4) mRNA, 3' end,
           partial cds
          Length = 634

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 349 aggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
           |||||||||||||||||||||||||| ||||| ||||  | ||||||| |||||
Sbjct: 376 aggggctcgccgttccactccttgagacactccagcagcgcgtcgatgtgcttg 323



to top

>ref|XM_466845.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2369

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 2296 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 2240



to top

>dbj|AK120127.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013026F02, full
            insert sequence
          Length = 2594

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 2296 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 2240



to top

>emb|Z15085.1|OSGP28G O.sativa GP28 gene (partial)
          Length = 4843

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 4725 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 4669



to top

>emb|X99483.1|HVPAL6 H.vulgare mRNA for phenylalanine ammonia-lyase, pal6
          Length = 1251

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||| |||||||| ||||||||||||||||| || ||||  | ||||||| |||||
Sbjct: 1046 ggcagaggctcgccattccactccttgaggcattccagcagcgcgtcgatgtgcttg 990



to top

>dbj|AK065208.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F15, full
            insert sequence
          Length = 1835

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 1537 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 1481



to top

>dbj|AK061959.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-G01, full
            insert sequence
          Length = 1589

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 346  ggcaggggctcgccgttccactccttgaggcactcgagcatggggtcgatgagcttg 402
            ||||| ||| |||| ||||| ||||||||||| |||||||  ||||||||| |||||
Sbjct: 1253 ggcagtggcgcgccattccattccttgaggcattcgagcagcgggtcgatgtgcttg 1197



to top

>gb|AC129351.6| Homo sapiens 12 BAC RP11-466G11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 161618

 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 13     tgtagtatgtatatatattgtattata 39
              |||| ||||||||||||||||||||||
Sbjct: 127843 tgtattatgtatatatattgtattata 127817



to top

>gb|AC129675.6| Homo sapiens 12 BAC RP11-310A24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 112495

 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 13    tgtagtatgtatatatattgtattata 39
             |||| ||||||||||||||||||||||
Sbjct: 78795 tgtattatgtatatatattgtattata 78769



to top

>emb|Z49145.1|HVPAL2MR H.vulgare partial PAL mRNA for phenylalanine ammonia-lyase (1670 bp)
          Length = 1670

 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 346  ggcaggggctcgccgttccactccttgaggcactc 380
            ||||||||||| || ||||||||||| ||||||||
Sbjct: 1420 ggcaggggctcaccattccactccttcaggcactc 1386



to top

>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the complete
             sequence
          Length = 249995

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    atgtatatatattgtattata 39
             |||||||||||||||||||||
Sbjct: 60529 atgtatatatattgtattata 60549



to top

>ref|XR_005088.1| PREDICTED: Mus musculus hypothetical protein LOC677558 (LOC677558),
           mRNA
          Length = 1008

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 275 atttttggatgtactttggaa 295
           |||||||||||||||||||||
Sbjct: 951 atttttggatgtactttggaa 971



to top

>ref|XR_004983.1| PREDICTED: Mus musculus similar to preferentially expressed antigen
            in melanoma like 5 (LOC676880), mRNA
          Length = 1639

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 275  atttttggatgtactttggaa 295
            |||||||||||||||||||||
Sbjct: 1582 atttttggatgtactttggaa 1602



to top

>ref|XM_112266.6| PREDICTED: Mus musculus similar to preferentially expressed antigen
            in melanoma like 5 (LOC195555), mRNA
          Length = 1636

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 275  atttttggatgtactttggaa 295
            |||||||||||||||||||||
Sbjct: 1579 atttttggatgtactttggaa 1599



to top

>ref|XM_205435.6| PREDICTED: Mus musculus similar to preferentially expressed antigen
            in melanoma like 5 (LOC279185), mRNA
          Length = 1636

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 275  atttttggatgtactttggaa 295
            |||||||||||||||||||||
Sbjct: 1579 atttttggatgtactttggaa 1599



to top

>ref|XM_539018.2| PREDICTED: Canis familiaris similar to inhibitor of Brutons tyrosine
            kinase (LOC481897), mRNA
          Length = 4215

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 74   aagcaaaaaagaagccgcgta 94
            |||||||||||||||||||||
Sbjct: 3098 aagcaaaaaagaagccgcgta 3118



to top

>gb|AC098888.4| Mus musculus BAC clone RP23-122N8 from 8, complete sequence
          Length = 229247

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 11     aatgtagtatgtatatatattgtattata 39
              ||||||||||||||||||  |||||||||
Sbjct: 175295 aatgtagtatgtatatattatgtattata 175267



to top

>gb|AC129623.4| Homo sapiens 12 BAC CTD-2107C6 (Cal Tech Human BAC Library D) complete
             sequence
          Length = 133581

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 97    attagcataattcaccccaaaatac 121
             ||||||||| |||||||||||||||
Sbjct: 78789 attagcatatttcaccccaaaatac 78765



to top

>emb|BX005100.9| Mouse DNA sequence from clone RP23-76P22 on chromosome 11 Contains part
              of the gene for a novel protein (C230094A16Rik), the gene
              for a novel protein (4931440F15Rik) similar to Mus musculus
              feminization 1 homolog a (C. elegans) (Fem1a), a ribosomal
              protein L23 (Rpl23) pseudogene, a preferentially expressed
              antigen in melanoma like 5 (Pramel5) pseudogene and a CpG
              island, complete sequence
          Length = 193116

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 275    atttttggatgtactttggaa 295
              |||||||||||||||||||||
Sbjct: 174370 atttttggatgtactttggaa 174390



to top

>gb|AC074237.4| Homo sapiens chromosome 18, clone RP11-333K18, complete sequence
          Length = 181390

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 97    attagcataattcaccccaaaatac 121
             ||||||||| |||||||||||||||
Sbjct: 53072 attagcatatttcaccccaaaatac 53048



to top

>gb|AY036011.1| Manihot esculenta phenylalanine ammonia-lyase 1 (PAL1) mRNA, complete
            cds
          Length = 2253

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 361  ttccactccttgaggcactcgagcatggg 389
            ||||||||||||||||| || ||||||||
Sbjct: 2185 ttccactccttgaggcattcaagcatggg 2157



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 292     ggaagcctcctcctctcctcc 312
               |||||||||||||||||||||
Sbjct: 7993897 ggaagcctcctcctctcctcc 7993917



to top

>dbj|AP006235.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBa0017N10
          Length = 168535

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 292    ggaagcctcctcctctcctcc 312
              |||||||||||||||||||||
Sbjct: 106540 ggaagcctcctcctctcctcc 106560



to top

>dbj|AP005876.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
            clone:OSJNBa0092O08
          Length = 145596

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 292  ggaagcctcctcctctcctcc 312
            |||||||||||||||||||||
Sbjct: 9002 ggaagcctcctcctctcctcc 9022



to top

>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence
          Length = 201535

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 287   actttggaagcctcctcctct 307
             |||||||||||||||||||||
Sbjct: 44602 actttggaagcctcctcctct 44582



to top

>gb|AY098511.1| Ananas comosus phenylalanine ammonia-lyase mRNA, partial cds
          Length = 1110

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 361 ttccactccttgaggcactcgagcatggg 389
           ||||||||||| | |||||||||||||||
Sbjct: 864 ttccactccttcaagcactcgagcatggg 836



to top

>emb|AL626771.9| Mouse DNA sequence from clone RP23-281O10 on chromosome 4, complete
             sequence
          Length = 185594

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 275   atttttggatgtactttggaa 295
             |||||||||||||||||||||
Sbjct: 42223 atttttggatgtactttggaa 42243



to top

>emb|AL713865.10| Mouse DNA sequence from clone RP23-451D4 on chromosome 4, complete
              sequence
          Length = 172962

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 275    atttttggatgtactttggaa 295
              |||||||||||||||||||||
Sbjct: 147699 atttttggatgtactttggaa 147719



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 275   atttttggatgtactttggaa 295
             |||||||||||||||||||||
Sbjct: 36754 atttttggatgtactttggaa 36774



to top

>gb|AC168206.7| Mus musculus chromosome 1, clone RP23-17B20, complete sequence
          Length = 245358

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     attatagtaaaagcaaaaca 53
              ||||||||||||||||||||
Sbjct: 234097 attatagtaaaagcaaaaca 234116



to top

>gb|AC099582.7| Mus musculus chromosome 1, clone RP23-188D7, complete sequence
          Length = 192016

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    attatagtaaaagcaaaaca 53
             ||||||||||||||||||||
Sbjct: 44899 attatagtaaaagcaaaaca 44880



to top

>gb|AC145477.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1402B06,
              complete sequence
          Length = 134001

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 115    aaaatacaacgacaatatct 134
              ||||||||||||||||||||
Sbjct: 120777 aaaatacaacgacaatatct 120758



to top

>gb|AC115035.5| Mus musculus chromosome 3, clone RP24-273F11, complete sequence
          Length = 131719

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    atgtagtatgtatatatatt 31
             ||||||||||||||||||||
Sbjct: 50147 atgtagtatgtatatatatt 50166



to top

>gb|BC070761.1| Xenopus laevis hypothetical protein MGC83782, mRNA (cDNA clone
            MGC:83782 IMAGE:6641157), complete cds
          Length = 4636

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 41   taaaagcaaaacattttgcaaaga 64
            ||||||| ||||||||||||||||
Sbjct: 4081 taaaagctaaacattttgcaaaga 4104



to top

>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0042F15, complete sequence
          Length = 162959

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   aaaatacaacgacaatatct 134
             ||||||||||||||||||||
Sbjct: 27966 aaaatacaacgacaatatct 27947



to top

>gb|AC162790.2| Mus musculus chromosome 3, clone RP24-397C18, complete sequence
          Length = 169244

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    atgtagtatgtatatatatt 31
             ||||||||||||||||||||
Sbjct: 54454 atgtagtatgtatatatatt 54435



to top

>gb|AC073258.9| Homo sapiens BAC clone RP11-221B19 from 7, complete sequence
          Length = 156127

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 37     atagtaaaagcaaaacattt 56
              ||||||||||||||||||||
Sbjct: 143720 atagtaaaagcaaaacattt 143701



to top

>gb|AC129198.3| Mus musculus BAC clone RP24-183I4 from chromosome 15, complete sequence
          Length = 165791

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 12    atgtagtatgtatatatattgtat 35
             ||||| ||||||||||||||||||
Sbjct: 26254 atgtattatgtatatatattgtat 26231



to top

>gb|AC099413.3| Mus musculus BAC clone RP23-2O10 from 4, complete sequence
          Length = 208798

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     agtatgtatatatattgtat 35
              ||||||||||||||||||||
Sbjct: 183148 agtatgtatatatattgtat 183129



to top

>gb|AC114916.5| Mus musculus BAC clone RP23-68E10 from 15, complete sequence
          Length = 207411

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 12   atgtagtatgtatatatattgtat 35
            ||||| ||||||||||||||||||
Sbjct: 4176 atgtattatgtatatatattgtat 4199



to top

>gb|AC099342.5| Homo sapiens BAC clone RP11-323F6 from 7, complete sequence
          Length = 29752

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 104  taattcaccccaaaatacaa 123
            ||||||||||||||||||||
Sbjct: 1408 taattcaccccaaaatacaa 1427



to top

>gb|AC005083.1| Homo sapiens BAC clone CTA-281G5 from 7, complete sequence
          Length = 146285

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 104 taattcaccccaaaatacaa 123
           ||||||||||||||||||||
Sbjct: 593 taattcaccccaaaatacaa 574



to top

>emb|AL596223.3| Human DNA sequence from clone RP11-227H15 on chromosome 10 Contains 3'
              end of the VPS26 gene for vacuolar protein sorting 26
              (yeast) (HB58, Hbeta58, FLJ12930), the SUPV3L1 gene for
              suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3), the
              gene for a novel hexokinase domain containing protein
              (FLJ37767), the 5' end of the HK1 gene for hexokinase 1
              (HKI, HXK1), two novel genes, a ribosomal protein S15a
              (RPS15A) pseudogene and two CpG islands, complete sequence
          Length = 180548

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    cataattcaccccaaaatac 121
              ||||||||||||||||||||
Sbjct: 144030 cataattcaccccaaaatac 144011



to top

>emb|AL356096.11| Human DNA sequence from clone RP11-366K1 on chromosome 13 Contains a
             novel gene and a CpG island, complete sequence
          Length = 190101

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    tatattgtattatagtaaaa 45
             ||||||||||||||||||||
Sbjct: 81640 tatattgtattatagtaaaa 81659



to top

>emb|AL031906.1|HS90O12 Human DNA sequence from clone RP1-90O12 on chromosome 6p24.1-25.1,
             complete sequence
          Length = 99035

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 12    atgtagtatgtatatatattgtat 35
             |||||||||||||||||| |||||
Sbjct: 56050 atgtagtatgtatatataatgtat 56073



to top

>emb|CR450810.5| Zebrafish DNA sequence from clone CH211-156N19 in linkage group 3,
             complete sequence
          Length = 45749

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    gtatgtatatatattgtatt 36
             ||||||||||||||||||||
Sbjct: 11447 gtatgtatatatattgtatt 11428



to top

>emb|X79047.1|EC12TCGWT Echovirus type 12, prototype Travis wild type genome
          Length = 7501

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 46   gcaaaacattttgcaaagac 65
            ||||||||||||||||||||
Sbjct: 1402 gcaaaacattttgcaaagac 1421



to top

>emb|X61581.1|DDPROFLI D.discoideum mRNA for profilin I
          Length = 521

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 17 gtatgtatatatattgtatt 36
          ||||||||||||||||||||
Sbjct: 23 gtatgtatatatattgtatt 4



to top

>emb|AL034557.8|PFMAL4P1 Plasmodium falciparum MAL4P1
          Length = 347582

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 22     tatatatattgtattatagtaaaagcaa 49
              |||||||| | |||||||||||||||||
Sbjct: 127464 tatatataatatattatagtaaaagcaa 127491



to top

>emb|BX530064.8| Zebrafish DNA sequence from clone CH211-232M19 in linkage group 16,
              complete sequence
          Length = 153572

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     atatattgtattatagtaaa 44
              ||||||||||||||||||||
Sbjct: 135971 atatattgtattatagtaaa 135990



to top

>emb|BX005068.13| Zebrafish DNA sequence from clone DKEY-40H17 in linkage group 1, complete
              sequence
          Length = 215007

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 104    taattcaccccaaaatacaa 123
              ||||||||||||||||||||
Sbjct: 183379 taattcaccccaaaatacaa 183360



to top

>gb|AC027489.8| Homo sapiens chromosome , clone RP11-453M23, complete sequence
          Length = 189706

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 60    aaagacagtaatacaagcaaaaaa 83
             ||||||||||| ||||||||||||
Sbjct: 95313 aaagacagtaaaacaagcaaaaaa 95290



to top

>emb|BX005425.12| Zebrafish DNA sequence from clone DKEY-7O6 in linkage group 8, complete
              sequence
          Length = 252440

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 265    taagcgtcttatttttggat 284
              ||||||||||||||||||||
Sbjct: 198253 taagcgtcttatttttggat 198234



to top

>gb|AC048352.18| Homo sapiens 12 BAC RP11-871F6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 216792

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 93     tagtattagcataattcacc 112
              ||||||||||||||||||||
Sbjct: 141811 tagtattagcataattcacc 141830



to top

>gb|AC079596.11| Homo sapiens 12 BAC RP11-632N20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 103998

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     agtatgtatatatattgtat 35
              ||||||||||||||||||||
Sbjct: 102486 agtatgtatatatattgtat 102467



to top

>gb|AC093122.12| Homo sapiens 12 BAC RP11-317E2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 108125

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     agtatgtatatatattgtat 35
              ||||||||||||||||||||
Sbjct: 107633 agtatgtatatatattgtat 107652



to top

>gb|AC106727.5| Homo sapiens 3q BAC RP11-534K3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 153692

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    tgtatatatattgtattata 39
             ||||||||||||||||||||
Sbjct: 89298 tgtatatatattgtattata 89317



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 411     gatgccgaggaagaccttgg 430
               ||||||||||||||||||||
Sbjct: 1290667 gatgccgaggaagaccttgg 1290648



to top

>gb|AC023538.7| Homo sapiens chromosome 8, clone RP11-510I21, complete sequence
          Length = 189543

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    tgtatatatattgtattata 39
             ||||||||||||||||||||
Sbjct: 64400 tgtatatatattgtattata 64381



to top

>gb|AC022039.7| Homo sapiens chromosome 8, clone RP11-3G21, complete sequence
          Length = 176815

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    tgtatatatattgtattata 39
             ||||||||||||||||||||
Sbjct: 18333 tgtatatatattgtattata 18352



to top

>gb|AC091108.5| Homo sapiens chromosome 18, clone RP11-765H19, complete sequence
          Length = 164790

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 60     aaagacagtaatacaagcaaaaaa 83
              ||||||||||| ||||||||||||
Sbjct: 156481 aaagacagtaaaacaagcaaaaaa 156504



to top

>gb|AC026398.5| Homo sapiens chromosome 5 clone CTB-127M13, complete sequence
          Length = 88783

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    tatgtatatatattgtatta 37
             ||||||||||||||||||||
Sbjct: 17497 tatgtatatatattgtatta 17478



to top

>gb|BC097918.1| Xenopus laevis cDNA clone IMAGE:6868144, partial cds
          Length = 2407

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 41   taaaagcaaaacattttgcaaaga 64
            ||||||| ||||||||||||||||
Sbjct: 1852 taaaagctaaacattttgcaaaga 1875



to top

>emb|BX470254.7| Zebrafish DNA sequence from clone CH211-256M1 in linkage group 3,
             complete sequence
          Length = 146746

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    gtatgtatatatattgtatt 36
             ||||||||||||||||||||
Sbjct: 21726 gtatgtatatatattgtatt 21745



to top

>gb|AC008220.5|AC008220 Drosophila melanogaster, chromosome 3R, region 100B-100C, BAC clone
             BACR11C03, complete sequence
          Length = 186549

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 19    atgtatatatattgtattatagta 42
             |||||||||||||||| |||||||
Sbjct: 50076 atgtatatatattgtagtatagta 50053



to top

>gb|AC007975.7|AC007975 Drosophila melanogaster, chromosome 3R, region 100A-100B, BAC clone
              BACR06P08, complete sequence
          Length = 180630

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 19     atgtatatatattgtattatagta 42
              |||||||||||||||| |||||||
Sbjct: 172123 atgtatatatattgtagtatagta 172100



to top

>gb|AE014844.1| Plasmodium falciparum 3D7 chromosome 12, section 1 of 9 of the complete
              sequence
          Length = 251551

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 16     agtatgtatatatattgtattata 39
              |||||||||||||||| |||||||
Sbjct: 108821 agtatgtatatatattatattata 108844



to top

>emb|BX255877.14| Zebrafish DNA sequence from clone CH211-254C9, complete sequence
          Length = 152976

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 39     agtaaaagcaaaacattttgcaaa 62
              ||||||||||||||||||| ||||
Sbjct: 104068 agtaaaagcaaaacattttacaaa 104091



to top

>emb|BX571894.9| Mouse DNA sequence from clone RP23-203N8 on chromosome 2, complete
             sequence
          Length = 101718

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    tgtatatatattgtattata 39
             ||||||||||||||||||||
Sbjct: 13434 tgtatatatattgtattata 13453



to top

>gb|AC006034.2|AC006034 Homo sapiens BAC clone RP11-144M13 from 7p11.2-p21, complete sequence
          Length = 56479

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   taattcaccccaaaatacaa 123
             ||||||||||||||||||||
Sbjct: 26527 taattcaccccaaaatacaa 26508



to top

>emb|BX539323.11| Zebrafish DNA sequence from clone DKEY-58P11 in linkage group 19,
             complete sequence
          Length = 87362

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    tgtatatatattgtattata 39
             ||||||||||||||||||||
Sbjct: 48345 tgtatatatattgtattata 48326



to top

>gb|AE003776.2| Drosophila melanogaster chromosome 3R, section 114 of 118 of the complete
              sequence
          Length = 225764

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 19     atgtatatatattgtattatagta 42
              |||||||||||||||| |||||||
Sbjct: 166749 atgtatatatattgtagtatagta 166726



to top

>emb|AL121767.6|CNS01DSC Human chromosome 14 DNA sequence BAC C-2593I21 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 208309

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    agtaatacaagcaaaaaaga 85
             ||||||||||||||||||||
Sbjct: 57927 agtaatacaagcaaaaaaga 57946



to top

>emb|CR846103.8| Zebrafish DNA sequence from clone DKEY-28K9 in linkage group 3,
             complete sequence
          Length = 54792

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    gtatgtatatatattgtatt 36
             ||||||||||||||||||||
Sbjct: 33067 gtatgtatatatattgtatt 33048



to top

>emb|AL772421.5|CNS08C9Z Oryza sativa chromosome 12, . BAC OJ1007_A12 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 130672

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 103   ataattcaccccaaaatacaacga 126
             ||||||||||||||| ||||||||
Sbjct: 53491 ataattcaccccaaattacaacga 53514



to top

>emb|AL732360.12| Mouse DNA sequence from clone RP23-405B14 on chromosome X, complete
              sequence
          Length = 197398

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     atgtagtatgtatatatatt 31
              ||||||||||||||||||||
Sbjct: 124715 atgtagtatgtatatatatt 124734



to top

>emb|CR854921.10| Zebrafish DNA sequence from clone DKEY-287M23 in linkage group 3,
            complete sequence
          Length = 19549

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   gtatgtatatatattgtatt 36
            ||||||||||||||||||||
Sbjct: 8103 gtatgtatatatattgtatt 8122



to top

>emb|AL929017.9| Zebrafish DNA sequence from clone DKEY-4C15 in linkage group 20, complete
              sequence
          Length = 208922

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     gaatgtagtatgtatatata 29
              ||||||||||||||||||||
Sbjct: 103585 gaatgtagtatgtatatata 103604



to top

>dbj|AP006535.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT02D13, TM0546,
             complete sequence
          Length = 107979

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 56    ttgcaaagacagtaatacaagcaa 79
             |||||||| |||||||||||||||
Sbjct: 77962 ttgcaaagccagtaatacaagcaa 77985



to top

>gb|AC154809.2| Mus musculus BAC clone RP24-528G7 from chromosome 16, complete sequence
          Length = 191524

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    tatatattgtattatagtaa 43
             ||||||||||||||||||||
Sbjct: 83535 tatatattgtattatagtaa 83516



to top

>emb|AL772320.12| Mouse DNA sequence from clone RP23-346F2 on chromosome 4, complete
              sequence
          Length = 211321

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     agtatgtatatatattgtat 35
              ||||||||||||||||||||
Sbjct: 106200 agtatgtatatatattgtat 106219


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,923,406
Number of Sequences: 3902068
Number of extensions: 4923406
Number of successful extensions: 148041
Number of sequences better than 10.0: 120
Number of HSP's better than 10.0 without gapping: 124
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 147156
Number of HSP's gapped (non-prelim): 885
length of query: 448
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 426
effective length of database: 17,147,199,772
effective search space: 7304707102872
effective search space used: 7304707102872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top