Clone Name	rbaet69d09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kin...	244	2e-61
2	ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative...	186	3e-44
3	dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clon...	186	3e-44
4	gb|AY103833.1| Zea mays PCO135636 mRNA sequence	137	3e-29
5	gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno...	121	2e-24
6	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	121	2e-24
7	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	121	2e-24
8	gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphat...	113	4e-22
9	gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I ...	101	2e-18
10	gb|AY104578.1| Zea mays PCO113042 mRNA sequence	101	2e-18
11	ref|XM_478187.1| Oryza sativa (japonica cultivar-group), mRNA	100	6e-18
12	gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside...	100	6e-18
13	dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphat...	100	6e-18
14	dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	6e-18
15	gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence	84	4e-13
16	emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleo...	84	4e-13
17	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	78	2e-11
18	dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic D...	78	2e-11
19	dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic D...	78	2e-11
20	ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ...	76	9e-11
21	ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ...	76	9e-11
22	dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate ...	72	1e-09
23	ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosp...	70	6e-09
24	gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase...	70	6e-09
25	gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA...	66	9e-08
26	ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosph...	62	1e-06
27	emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cos...	62	1e-06
28	emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosm...	62	1e-06
29	gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate ki...	62	1e-06
30	dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate ...	62	1e-06
31	ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21 n...	60	5e-06
32	gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kina...	60	5e-06
33	dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	5e-06
34	gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndp...	58	2e-05
35	ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus simila...	58	2e-05
36	gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, c...	58	2e-05
37	emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segmen...	56	8e-05
38	gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, c...	56	8e-05
39	gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase m...	56	8e-05
40	gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphat...	54	3e-04
41	dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886	54	3e-04
42	dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102	54	3e-04
43	gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate ki...	54	3e-04
44	emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphos...	52	0.001
45	gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase ...	52	0.001
46	gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside ...	52	0.001
47	dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds	52	0.001
48	ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (...	50	0.005
49	dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside...	50	0.005
50	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	48	0.020
51	emb|BX072516.1|CNS09S48 Single read from an extremity of a full-...	48	0.020
52	emb|BX072515.1|CNS09S47 Single read from an extremity of a full-...	48	0.020
53	emb|BX063953.1|CNS09LID Single read from an extremity of a full-...	48	0.020
54	emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-...	48	0.020
55	emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-...	48	0.020
56	emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-...	48	0.020
57	emb|BX048701.1|CNS099QP Single read from an extremity of a full-...	48	0.020
58	emb|BX044675.1|CNS096MV Single read from an extremity of a full-...	48	0.020
59	emb|BX039425.1|CNS092L1 Single read from an extremity of a full-...	48	0.020
60	emb|BX038906.1|CNS0926M Single read from an extremity of a full-...	48	0.020
61	emb|BX038905.1|CNS0926L Single read from an extremity of a full-...	48	0.020
62	emb|BX038259.1|CNS091ON Single read from an extremity of a full-...	48	0.020
63	emb|BX038258.1|CNS091OM Single read from an extremity of a full-...	48	0.020
64	emb|BX038116.1|CNS091KO Single read from an extremity of a full-...	48	0.020
65	emb|BX038115.1|CNS091KN Single read from an extremity of a full-...	48	0.020
66	emb|BX037581.1|CNS0915T Single read from an extremity of a full-...	48	0.020
67	emb|BX037580.1|CNS0915S Single read from an extremity of a full-...	48	0.020
68	emb|BX036658.1|CNS090G6 Single read from an extremity of a full-...	48	0.020
69	emb|BX032742.1|CNS08XFE Single read from an extremity of a full-...	48	0.020
70	emb|BX031659.1|CNS08WLB Single read from an extremity of a full-...	48	0.020
71	emb|BX031658.1|CNS08WLA Single read from an extremity of a full-...	48	0.020
72	emb|BX025663.1|CNS08RYR Single read from an extremity of a full-...	48	0.020
73	emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-...	48	0.020
74	emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-...	48	0.020
75	emb|BX024508.1|CNS08R2O Single read from an extremity of a full-...	48	0.020
76	emb|BX024507.1|CNS08R2N Single read from an extremity of a full-...	48	0.020
77	emb|BX023654.1|CNS08QEY Single read from an extremity of a full-...	48	0.020
78	emb|BX022916.1|CNS08PUG Single read from an extremity of a full-...	48	0.020
79	emb|BX022915.1|CNS08PUF Single read from an extremity of a full-...	48	0.020
80	emb|BX021481.1|CNS08OQL Single read from an extremity of a full-...	48	0.020
81	emb|BX021480.1|CNS08OQK Single read from an extremity of a full-...	48	0.020
82	emb|BX021303.1|CNS08OLN Single read from an extremity of a full-...	48	0.020
83	emb|BX021302.1|CNS08OLM Single read from an extremity of a full-...	48	0.020
84	emb|BX021192.1|CNS08OIK Single read from an extremity of a full-...	48	0.020
85	emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-...	48	0.020
86	emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-...	48	0.020
87	emb|BX018153.1|CNS08M65 Single read from an extremity of a full-...	48	0.020
88	emb|BX018054.1|CNS08M3E Single read from an extremity of a full-...	48	0.020
89	emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-...	48	0.020
90	emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-...	48	0.020
91	emb|BX017207.1|CNS08LFV Single read from an extremity of a full-...	48	0.020
92	emb|BX017206.1|CNS08LFU Single read from an extremity of a full-...	48	0.020
93	emb|BX016645.1|CNS08L09 Single read from an extremity of a full-...	48	0.020
94	emb|BX014282.1|CNS08J6M Single read from an extremity of a full-...	48	0.020
95	emb|BX013424.1|CNS08IIS Single read from an extremity of a full-...	48	0.020
96	emb|BX009576.1|CNS08FJW Single read from an extremity of a full-...	48	0.020
97	emb|BX009575.1|CNS08FJV Single read from an extremity of a full-...	48	0.020
98	emb|BX009569.1|CNS08FJP Single read from an extremity of a full-...	48	0.020
99	emb|BX009487.1|CNS08FHF Single read from an extremity of a full-...	48	0.020
100	emb|BX007945.1|CNS08EAL Single read from an extremity of a full-...	48	0.020
101	emb|BX007944.1|CNS08EAK Single read from an extremity of a full-...	48	0.020
102	emb|BX006734.1|CNS08DCY Single read from an extremity of a full-...	48	0.020
103	emb|BX006733.1|CNS08DCX Single read from an extremity of a full-...	48	0.020
104	emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-...	48	0.020
105	ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253 ...	48	0.020
106	ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical ...	46	0.080
107	emb|BX025692.1|CNS08RZK Single read from an extremity of a full-...	46	0.080
108	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	46	0.080
109	dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside dipho...	46	0.080
110	gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase m...	46	0.080
111	dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside d...	46	0.080
112	emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome	46	0.080
113	gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphos...	46	0.080
114	dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds	46	0.080
115	ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucle...	44	0.32
116	gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.32
117	gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expr...	44	0.32
118	gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.32
119	gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.32
120	gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.32
121	gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expr...	44	0.32
122	ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein ex...	44	0.32
123	ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM027...	44	0.32
124	ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphospha...	44	0.32
125	ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.32
126	ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.32
127	emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate ki...	44	0.32
128	emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, ...	44	0.32
129	emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, B...	44	0.32
130	emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblas...	44	0.32
131	emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal bra...	44	0.32
132	dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE20223...	44	0.32
133	emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblas...	44	0.32
134	emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblas...	44	0.32
135	emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal bra...	44	0.32
136	gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, comple...	44	0.32
137	gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.32
138	dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diph...	44	0.32
139	dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.32
140	emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Co...	44	0.32
141	emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Co...	44	0.32
142	gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replicati...	44	0.32
143	gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002....	44	0.32
144	gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001....	44	0.32
145	gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000....	44	0.32
146	gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999....	44	0.32
147	gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998....	44	0.32
148	gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997....	44	0.32
149	dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.32
150	dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diph...	44	0.32
151	dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside d...	44	0.32
152	dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.32
153	gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c...	44	0.32
154	gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA cl...	44	0.32
155	gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphospha...	44	0.32
156	gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expr...	44	0.32
157	emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1	44	0.32
158	emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1	44	0.32
159	emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1	44	0.32
160	emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate ...	44	0.32
161	gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, com...	42	1.2
162	gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete...	42	1.2
163	gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, co...	42	1.2
164	gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence	42	1.2
165	emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chr...	42	1.2
166	emb|AL390879.20| Human DNA sequence from clone RP11-308D16 on ch...	42	1.2
167	ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.2
168	emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal ...	42	1.2
169	gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA	42	1.2
170	ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2...	42	1.2
171	gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside ...	42	1.2
172	gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, r...	42	1.2
173	gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 11...	42	1.2
174	gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside d...	42	1.2
175	gb|AC120985.3| Oryza sativa (japonica cultivar-group) chromosome...	40	4.9
176	gb|CP000097.1| Synechococcus sp. CC9902, complete genome	40	4.9
177	gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kina...	40	4.9
178	gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosom...	40	4.9
179	gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome...	40	4.9
180	emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chro...	40	4.9
181	gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosom...	40	4.9
182	gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, co...	40	4.9
183	emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chro...	40	4.9
184	emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J...	40	4.9
185	emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P2...	40	4.9
186	emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-...	40	4.9
187	emb|BX018154.1|CNS08M66 Single read from an extremity of a full-...	40	4.9
188	emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on ch...	40	4.9
189	emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, ...	40	4.9
190	gb|AC108451.9| Homo sapiens chromosome 15, clone RP11-379K22, co...	40	4.9
191	emb|CR855308.6| Zebrafish DNA sequence from clone DKEY-71K24, co...	40	4.9
192	gb|AC108450.4| Homo sapiens chromosome 15, clone RP11-153O17, co...	40	4.9
193	gb|AC109633.5| Homo sapiens chromosome 8, clone CTD-2024D23, com...	40	4.9
194	emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in ...	40	4.9
195	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	40	4.9
196	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	4.9
197	gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783...	40	4.9
198	gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons ...	40	4.9
199	gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete...	40	4.9
200	gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, comple...	40	4.9
201	ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTC...	40	4.9
202	gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside d...	40	4.9

---

>gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kinase (NDPK) mRNA, complete
           cds
          Length = 720

 Score =  244 bits (123), Expect = 2e-61
 Identities = 162/175 (92%)
 Strand = Plus / Minus

                                                                       
Query: 196 gcctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccag 255
           ||||| |||||||||||||||||||||||  ||||| | || || |||||||||||||| 
Sbjct: 515 gcctcgtagatccagttgtgctggctgctggtccacccggcgagaccctcagggaaccac 456

                                                                       
Query: 256 agggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccg 315
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 455 agggcaatctccttcctggcattctcaactgagtcgcttccatggatgacgttcctgccg 396

                                                                  
Query: 316 atgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 395 atgtcaacggcgaagtcaccacggatggtgccaggctcagaggccagggggttgg 341



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 7   tcatatcaaagcaataccatat 28
           ||||||||||||||||||||||
Sbjct: 674 tcatatcaaagcaataccatat 653

---

>ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative nucleoside
           diphosphate kinase (OSJNBa0027P10.4), mRNA
          Length = 800

 Score =  186 bits (94), Expect = 3e-44
 Identities = 154/174 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 520 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 461

                                                                       
Query: 257 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 316
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 460 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 401

                                                                 
Query: 317 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||||| |||||||| |||||||||||||| ||||| | ||||||||||||||
Sbjct: 400 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttgg 347

---

>dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023136C24, full
           insert sequence
          Length = 734

 Score =  186 bits (94), Expect = 3e-44
 Identities = 154/174 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 532 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 473

                                                                       
Query: 257 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 316
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 472 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 413

                                                                 
Query: 317 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||||| |||||||| |||||||||||||| ||||| | ||||||||||||||
Sbjct: 412 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttgg 359

---

>gb|AY103833.1| Zea mays PCO135636 mRNA sequence
          Length = 929

 Score =  137 bits (69), Expect = 3e-29
 Identities = 144/169 (85%)
 Strand = Plus / Minus

                                                                       
Query: 202 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 261
           |||||||||  |||||||||||||  ||| |||||| ||||||| |||||||| ||||| 
Sbjct: 709 tagatccaggggtgctggctgctctgccaatcagcagggccctcggggaaccacagggca 650

                                                                       
Query: 262 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 321
           ||||||||  | ||| ||||||    ||| |||||||| |||||||||||||| ||||||
Sbjct: 649 atctccttattagcactctcaatgctgtcacttccatgaatgacattcctgccaatgtcg 590

                                                            
Query: 322 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           || || ||||| |||||||||||||||||||| || |||||||||||||
Sbjct: 589 acagcaaagtcgccacggatggtgccgggctcagaagccagggggttgg 541

---

>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete
             sequence
          Length = 141307

 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                         
Query: 197   cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256
             |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 53331 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 53390

                                                                      
Query: 257   gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 313
             | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 53391 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 53447



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                         
Query: 309   cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368
             |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 54738 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 54797

               
Query: 369   gg 370
             ||
Sbjct: 54798 gg 54799

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 197      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21738648 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21738707

                                                                         
Query: 257      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 313
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21738708 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21738764



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                            
Query: 309      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21740055 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21740114

                  
Query: 369      gg 370
                ||
Sbjct: 21740115 gg 21740116

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 197      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21750311 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21750370

                                                                         
Query: 257      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 313
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21750371 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21750427



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                            
Query: 309      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21751718 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21751777

                  
Query: 369      gg 370
                ||
Sbjct: 21751778 gg 21751779

---

>gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphate kinase (SoNDPK1) mRNA,
           complete cds
          Length = 742

 Score =  113 bits (57), Expect = 4e-22
 Identities = 141/169 (83%)
 Strand = Plus / Minus

                                                                       
Query: 202 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 261
           |||||||||  |||||||||||||  ||| ||||| |||||||| |||||||| || || 
Sbjct: 498 tagatccaggggtgctggctgctctgccaatcagcgaggccctcggggaaccacagagca 439

                                                                       
Query: 262 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 321
           ||||||||  | ||| ||||||    ||| |||||||||||||||||||| || ||||||
Sbjct: 438 atctccttgttagcactctcaatgctgtcacttccatggatgacattccttccaatgtcg 379

                                                            
Query: 322 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           || || ||||| ||||||||||| |||||||| ||  ||||||||||||
Sbjct: 378 acagcaaagtcgccacggatggttccgggctcagaaaccagggggttgg 330

---

>gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I mRNA, complete cds
          Length = 573

 Score =  101 bits (51), Expect = 2e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                       
Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293
           |||| |||||||||||||||| |  ||||| |||||  ||||| ||||||| ||||||||
Sbjct: 503 agcagggccctcagggaaccacaatgcgatttccttggtggcactctcaacagagtcgct 444

                                                                       
Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 353
           ||| ||||| |||||||| || ||||| | |||||||||||||||||| || || |||||
Sbjct: 443 tccgtggatcacattccttccaatgtcaatggcgaagtcaccacggatagttccaggctc 384

                          
Query: 354 ggaggccagggggtt 368
            || |||| ||||||
Sbjct: 383 agatgccaaggggtt 369

---

>gb|AY104578.1| Zea mays PCO113042 mRNA sequence
          Length = 943

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           |||||||||||||| |||||||||||| |  | ||||| || ||||||||||||||||||
Sbjct: 575 tcagggaaccagagagcgatctccttcttcccgttctccacggagtcgcttccatggatg 516

                                                          
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccggg 350
           |||||||||||||  || |||||| |||| ||||| ||||| |||||
Sbjct: 515 acattcctgccgacttccacggcgtagtccccacgaatggtaccggg 469

---

>ref|XM_478187.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 450

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                     
Query: 341 tggtgccggg 350
           ||||||||||
Sbjct: 301 tggtgccggg 292

---

>gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside diphosphate
           kinase 1 mRNA, complete cds
          Length = 683

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                     
Query: 341 tggtgccggg 350
           ||||||||||
Sbjct: 301 tggtgccggg 292

---

>dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphate kinase, complete cds
          Length = 683

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 442 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 383

                                                                       
Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 382 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 323

                     
Query: 341 tggtgccggg 350
           ||||||||||
Sbjct: 322 tggtgccggg 313

---

>dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033095O19, full
           insert sequence
          Length = 866

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 540 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 481

                                                                       
Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 480 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 421

                     
Query: 341 tggtgccggg 350
           ||||||||||
Sbjct: 420 tggtgccggg 411

---

>gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence
          Length = 727

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 451 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 392

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           ||||||||||| ||||| |  || || |||||||||||
Sbjct: 391 acattcctgccaatgtcaatagcaaaatcaccacggat 354

---

>emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleoside diphosphate kinase
          Length = 590

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 388 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 329

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           ||||||||||| ||||| |  || || |||||||||||
Sbjct: 328 acattcctgccaatgtcaatagcaaaatcaccacggat 291

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                            
Query: 221      tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280
                |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 18281744 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 18281803

                                               
Query: 281      caactgagtcgcttccatggatgacattcct 311
                | || |||||||| |||||||||||||||||
Sbjct: 18281804 ccacggagtcgctcccatggatgacattcct 18281834

---

>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1218_C12
          Length = 105861

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 221   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 84987 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 85046

                                            
Query: 281   caactgagtcgcttccatggatgacattcct 311
             | || |||||||| |||||||||||||||||
Sbjct: 85047 ccacggagtcgctcccatggatgacattcct 85077

---

>dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0038F10
          Length = 153929

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 221   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 11239 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 11298

                                            
Query: 281   caactgagtcgcttccatggatgacattcct 311
             | || |||||||| |||||||||||||||||
Sbjct: 11299 ccacggagtcgctcccatggatgacattcct 11329

---

>ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 308
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 309 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

             
Query: 369 gg 370
           ||
Sbjct: 282 gg 281

---

>ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 308
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 309 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

             
Query: 369 gg 370
           ||
Sbjct: 282 gg 281

---

>dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate kinase I, complete cds
          Length = 828

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 295 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcg 354
           |||||||||||||| ||||| ||||||| |||||| |||||||||||||| || ||||| 
Sbjct: 380 ccatggatgacatttctgccaatgtcgatggcgaaatcaccacggatggttcctggctct 321

                           
Query: 355 gaggccagggggttgg 370
           || || || |||||||
Sbjct: 320 gaagcaagagggttgg 305

---

>ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosphate kinase
           (AN8216.2), mRNA
          Length = 486

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| ||||||||||
Sbjct: 360 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttgg 302

---

>gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase (swoH) gene,
           complete cds
          Length = 776

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| ||||||||||
Sbjct: 650 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttgg 592

---

>gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA, partial cds
          Length = 595

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 286 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 345
           |||||||||||||| ||||||||||||||||| ||||  || | ||| || |||||||||
Sbjct: 267 gagtcgcttccatgaatgacattcctgccgatctcgatcgcaaggtccccgcggatggtg 208

                
Query: 346 ccggg 350
           |||||
Sbjct: 207 ccggg 203

---

>ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosphate kinase
           (Afu5g03490) partial mRNA
          Length = 462

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| || |||||||
Sbjct: 336 gccgacgtcgatagcgaagtcaccacggatggtgccgggagcggaggcaagagggttgg 278

---

>emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cosmid contig 62D11
          Length = 102165

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                        
Query: 328   aagtcaccacggatggtgccgggctcggaggccagggggttgg 370
             |||||||||||||||||||||||  ||||||| ||||||||||
Sbjct: 14775 aagtcaccacggatggtgccgggagcggaggcgagggggttgg 14817



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 249   gaaccagagggcgatctccttcctggcattctcaactgagtcg 291
             |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 14630 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 14672

---

>emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosmid contig 21D9
          Length = 55380

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 328  aagtcaccacggatggtgccgggctcggaggccagggggttgg 370
            |||||||||||||||||||||||  ||||||| ||||||||||
Sbjct: 4628 aagtcaccacggatggtgccgggagcggaggcgagggggttgg 4586



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 249  gaaccagagggcgatctccttcctggcattctcaactgagtcg 291
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 4773 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 4731

---

>gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate kinase mRNA, complete cds
          Length = 755

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 103/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 218 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 277
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 470 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatctccttccttgcac 411

                                                                       
Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 337
           ||||||| |  || |||||||| |||||||||||||| ||||| |  ||  | |||||||
Sbjct: 410 tctcaacagcatcacttccatgaatgacattcctgccaatgtcaatagcataatcaccac 351

                  
Query: 338 ggatggt 344
           |||||||
Sbjct: 350 ggatggt 344

---

>dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate kinase, complete
            cds
          Length = 4240

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 328  aagtcaccacggatggtgccgggctcggaggccagggggttgg 370
            |||||||||||||||||||||||  ||||||| ||||||||||
Sbjct: 3268 aagtcaccacggatggtgccgggagcggaggcgagggggttgg 3226



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 249  gaaccagagggcgatctccttcctggcattctcaactgagtcg 291
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 3413 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 3371

---

>ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21
           nucleoside-diphosphate kinase (CNE02610) partial mRNA
          Length = 530

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 241 ccctcagggaaccagagggcgatctccttc 270
           ||||||||||||||||||||||||||||||
Sbjct: 425 ccctcagggaaccagagggcgatctccttc 396

---

>gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kinase (NDK) gene,
           complete cds
          Length = 928

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 325 gcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||||||||||||||||||||||||  ||||||| || |||||||
Sbjct: 737 gcgaagtcaccacggatggtgccgggagcggaggcaagagggttgg 692



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 249 gaaccagagggcgatctccttcctggcattctc 281
           |||||||||||| ||||||||| |||| |||||
Sbjct: 865 gaaccagagggcaatctccttcttggcgttctc 833

---

>dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043K17, full
            insert sequence
          Length = 2012

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 221  tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttc 270
            |||||||||||||||| |  || |||||||||||||| ||||||||||||
Sbjct: 1752 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttc 1703

---

>gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndpk) mRNA, partial
           cds
          Length = 178

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagag 257
           |||||||||||||| ||   ||||||| |||||  || || |||| || |||||||| ||
Sbjct: 119 ctcatagatccagtggttaaggctgctgctccaggcaacagggccttctgggaaccacag 60

                                                                    
Query: 258 ggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgcc 314
            || ||||||||||| ||| || | |||||||| || ||||| || |||||||||||
Sbjct: 59  tgctatctccttccttgcactccccactgagtcactcccatgaatcacattcctgcc 3

---

>ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus similar to
           nucleoside-diphosphate kinase 1 isoform a (LOC580218),
           mRNA
          Length = 546

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggct 352
           |||||||||||||| | ||||||||||||||||||| ||||
Sbjct: 420 gccgatgtcgacggagtagtcaccacggatggtgccaggct 380

---

>gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 661

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293
           |||| |||||||||||||||| |  || || |||||  | ||| |||||||||| || ||
Sbjct: 430 agcagggccctcagggaaccacaatgcaatttccttgttagcactctcaactgaatcact 371

                                                        
Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacg 338
           ||||||||| |||||||| || ||||| |  || |||||||||||
Sbjct: 370 tccatggataacattccttccaatgtcaatagcaaagtcaccacg 326

---

>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7
          Length = 344615

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 298    tggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 353
              |||||||| || | |||||||| |||||| |  |||||||||||||||||||||||
Sbjct: 172638 tggatgacgttgcggccgatgttgacggccagatcaccacggatggtgccgggctc 172693

---

>gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 655

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 436 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 377

                                                           
Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 376 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 329

---

>gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 771

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 445 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 386

                                                           
Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 385 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 338

---

>gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 753

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 102/127 (80%)
 Strand = Plus / Minus

                                                                       
Query: 218 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 277
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaattccttcggggaaccaaagagcaatctccttcctagcac 421

                                                                       
Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 337
           ||||||| |  || |||||||| || ||||||||||| || || |  || || |||||||
Sbjct: 420 tctcaacagcatcacttccatgaataacattcctgccaatatcaatagcaaaatcaccac 361

                  
Query: 338 ggatggt 344
           |||||||
Sbjct: 360 ggatggt 354

---

>dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886
          Length = 635

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 324 ggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           |||||||||||||||||||||||| ||  ||||||| || |||||||
Sbjct: 361 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttgg 315

---

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                              
Query: 324     ggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
               |||||||||||||||||||||||| ||  ||||||| || |||||||
Sbjct: 1532690 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttgg 1532736



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 249     gaaccagagggcgatctccttcctggcattctc 281
               |||||||||||| ||||||||| |||| |||||
Sbjct: 1532554 gaaccagagggcaatctccttcttggcgttctc 1532586

---

>gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate kinase mRNA, complete cds
          Length = 653

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 300
           |||||||||||||| ||  | ||||||||| | ||| | ||||| |  || |||||||| 
Sbjct: 428 ccctcagggaaccacagaccaatctccttctttgcactttcaacagcatcacttccatga 369

                                                          
Query: 301 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 347
           || ||||| ||||| |||||||  || || |||||||||||||||||
Sbjct: 368 atcacatttctgccaatgtcgattgcaaaatcaccacggatggtgcc 322

---

>emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphosphate kinase
          Length = 639

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 292 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 377 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 328

---

>gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase mRNA, partial cds
          Length = 355

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 286 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 345
           ||||||||||||||||| || || |  |||||||||| |  |||||| || |||||||||
Sbjct: 324 gagtcgcttccatggatcacgtttcgcccgatgtcgatgcagaagtccccgcggatggtg 265

                 
Query: 346 ccgggc 351
           ||||||
Sbjct: 264 ccgggc 259

---

>gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside diphosphate kinase I (NDK
           I) mRNA, complete cds
          Length = 724

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 104/130 (80%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 300
           |||||||||||||| ||||| ||||| ||  | ||| | ||||| |  |||||||| |||
Sbjct: 432 ccctcagggaaccacagggcaatctcttttgttgcactttcaacagcatcgcttccgtgg 373

                                                                       
Query: 301 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggcc 360
           || || || ||||| ||||||| ||| || || ||||||||||| || ||||| || || 
Sbjct: 372 ataacgtttctgccaatgtcgatggcaaaatctccacggatggtaccaggctctgaagct 313

                     
Query: 361 agggggttgg 370
           || |||||||
Sbjct: 312 agagggttgg 303

---

>dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds
          Length = 629

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 292 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 365 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 316

---

>ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (MG08622.4) partial
           cds
          Length = 726

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 318 gtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370
           ||||| |||| ||||||||||||||||||| ||  | ||||| ||||||||||
Sbjct: 594 gtcgatggcgtagtcaccacggatggtgccaggggccgaggcaagggggttgg 542

---

>dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside diphosphate kinase
           1, complete cds
          Length = 635

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 295 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 347
           ||||| |||||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 417 ccatgaatgacattcctgccaatgtcaatagcaaaatcaccacggatggtgcc 365

---

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 247    gggaaccagagggcgatctccttc 270
              ||||||||||||||||||||||||
Sbjct: 701410 gggaaccagagggcgatctccttc 701433

---

>emb|BX072516.1|CNS09S48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 442 ccacggatggtgccgggctcggag 465

---

>emb|BX072515.1|CNS09S47 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggag 349

---

>emb|BX063953.1|CNS09LID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 433 ccacggatggtgccgggctcggag 456

---

>emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 250

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 225 ccacggatggtgccgggctcggag 202

---

>emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggag 349

---

>emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 340 ccacggatggtgccgggctcggag 317

---

>emb|BX048701.1|CNS099QP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 197 ccacggatggtgccgggctcggag 174

---

>emb|BX044675.1|CNS096MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 341 ccacggatggtgccgggctcggag 318

---

>emb|BX039425.1|CNS092L1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 349 ccacggatggtgccgggctcggag 326

---

>emb|BX038906.1|CNS0926M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 298

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 243 ccacggatggtgccgggctcggag 266

---

>emb|BX038905.1|CNS0926L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 402 ccacggatggtgccgggctcggag 379

---

>emb|BX038259.1|CNS091ON Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 422 ccacggatggtgccgggctcggag 445

---

>emb|BX038258.1|CNS091OM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 361 ccacggatggtgccgggctcggag 338

---

>emb|BX038116.1|CNS091KO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 247 ccacggatggtgccgggctcggag 270

---

>emb|BX038115.1|CNS091KN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggag 349

---

>emb|BX037581.1|CNS0915T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 429 ccacggatggtgccgggctcggag 452

---

>emb|BX037580.1|CNS0915S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 372 ccacggatggtgccgggctcggag 349

---

>emb|BX036658.1|CNS090G6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 313 ccacggatggtgccgggctcggag 290

---

>emb|BX032742.1|CNS08XFE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggag 239

---

>emb|BX031659.1|CNS08WLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 400 ccacggatggtgccgggctcggag 423

---

>emb|BX031658.1|CNS08WLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 346 ccacggatggtgccgggctcggag 323

---

>emb|BX025663.1|CNS08RYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 425 ccacggatggtgccgggctcggag 448

---

>emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 581

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 363 ccacggatggtgccgggctcggag 340

---

>emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 532

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggag 239

---

>emb|BX024508.1|CNS08R2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 419 ccacggatggtgccgggctcggag 442

---

>emb|BX024507.1|CNS08R2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 365 ccacggatggtgccgggctcggag 342

---

>emb|BX023654.1|CNS08QEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 418 ccacggatggtgccgggctcggag 441

---

>emb|BX022916.1|CNS08PUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 344 ccacggatggtgccgggctcggag 367

---

>emb|BX022915.1|CNS08PUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 585

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 379 ccacggatggtgccgggctcggag 356

---

>emb|BX021481.1|CNS08OQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 410 ccacggatggtgccgggctcggag 433

---

>emb|BX021480.1|CNS08OQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 390 ccacggatggtgccgggctcggag 367

---

>emb|BX021303.1|CNS08OLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggag 370

---

>emb|BX021302.1|CNS08OLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 613 ccacggatggtgccgggctcggag 590

---

>emb|BX021192.1|CNS08OIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 339 ccacggatggtgccgggctcggag 316

---

>emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 149

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 103 ccacggatggtgccgggctcggag 126

---

>emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggag 239

---

>emb|BX018153.1|CNS08M65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggag 324

---

>emb|BX018054.1|CNS08M3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggag 239

---

>emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 405 ccacggatggtgccgggctcggag 428

---

>emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 360 ccacggatggtgccgggctcggag 337

---

>emb|BX017207.1|CNS08LFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 590

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 223 ccacggatggtgccgggctcggag 246

---

>emb|BX017206.1|CNS08LFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 354 ccacggatggtgccgggctcggag 331

---

>emb|BX016645.1|CNS08L09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 409 ccacggatggtgccgggctcggag 432

---

>emb|BX014282.1|CNS08J6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggag 324

---

>emb|BX013424.1|CNS08IIS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 350 ccacggatggtgccgggctcggag 327

---

>emb|BX009576.1|CNS08FJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 396 ccacggatggtgccgggctcggag 419

---

>emb|BX009575.1|CNS08FJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 387 ccacggatggtgccgggctcggag 364

---

>emb|BX009569.1|CNS08FJP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggag 239

---

>emb|BX009487.1|CNS08FHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 357 ccacggatggtgccgggctcggag 334

---

>emb|BX007945.1|CNS08EAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 407 ccacggatggtgccgggctcggag 430

---

>emb|BX007944.1|CNS08EAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggag 239

---

>emb|BX006734.1|CNS08DCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 394 ccacggatggtgccgggctcggag 417

---

>emb|BX006733.1|CNS08DCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 348 ccacggatggtgccgggctcggag 325

---

>emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 262 ccacggatggtgccgggctcggag 239

---

>ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253
           (ENSANGG00000008764), mRNA
          Length = 873

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||||||||||||
Sbjct: 467 ccacggatggtgccgggctcggag 444

---

>ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05972.1)
           partial mRNA
          Length = 717

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccggg 350
           ||||| ||||| |||| |||||||||||||||| |||||
Sbjct: 591 gccgacgtcgatggcgtagtcaccacggatggtaccggg 553

---

>emb|BX025692.1|CNS08RZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 508

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 335 cacggatggtgccgggctcggag 357
           |||||||||||||||||||||||
Sbjct: 369 cacggatggtgccgggctcggag 347

---

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 323     cggcgaagtcaccacggatggtgccgg 349
               ||||||||||| |||||||||||||||
Sbjct: 5713180 cggcgaagtcagcacggatggtgccgg 5713206

---

>dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside diphosphate kinase 1,
           complete cds
          Length = 640

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 320
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 388 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 346

---

>gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase mRNA, complete cds
          Length = 704

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 101/127 (79%)
 Strand = Plus / Minus

                                                                       
Query: 218 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 277
           ||||||||  |||||| ||||  || || |||||||| || || || |||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatttccttccttgcac 421

                                                                       
Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 337
           |||||||||  || |||||||| || || |||||||| ||||| |  ||  | |||||||
Sbjct: 420 tctcaactgcatcacttccatgaataacgttcctgccaatgtcaatagcataatcaccac 361

                  
Query: 338 ggatggt 344
           |||||||
Sbjct: 360 ggatggt 354

---

>dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 420

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 326 cgaagtcaccacggatggtgccgggctcgga 356
           |||||||||| ||||||||||||||| ||||
Sbjct: 313 cgaagtcaccgcggatggtgccgggcgcgga 283

---

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 326     cgaagtcaccacggatggtgccgggctcgga 356
               |||||||||| ||||||||||||||| ||||
Sbjct: 1771041 cgaagtcaccgcggatggtgccgggcgcgga 1771011

---

>gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphosphate kinase (ndk) gene,
           complete cds
          Length = 608

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 324 ggcgaagtcaccacggatggtgccggg 350
           |||||||||||| ||||||||||||||
Sbjct: 464 ggcgaagtcaccgcggatggtgccggg 438

---

>dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds
          Length = 628

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 320
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 394 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 352

---

>ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucleoside diphosphate
           kinase AT4G09320 (NDPK1) mRNA, complete cds
          Length = 700

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 482 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 423

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           || |||||||| ||||| |  || ||||| ||||||||
Sbjct: 422 acgttcctgccaatgtcaatagcaaagtccccacggat 385

---

>gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expressed in mRNA,
           complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:11088 IMAGE:3830205), complete cds
          Length = 1045

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 466 tggatgacattcctgctgatgtggacgctgaagtcacc 429

---

>ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein expressed in (NME4),
           mRNA
          Length = 1059

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446

---

>ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM02776.1) partial mRNA
          Length = 609

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 313 ccgatgtcgacggcgaagtcaccacggatggtgccggg 350
           |||| ||||| ||||||||| ||||||||||| |||||
Sbjct: 485 ccgacgtcgatggcgaagtcgccacggatggttccggg 448

---

>ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphosphate kinase
           (Tb11.01.7800) partial mRNA
          Length = 462

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 322 acggcgaagtcaccacggatggtgcc 347
           ||||||||||||||||| ||||||||
Sbjct: 326 acggcgaagtcaccacgaatggtgcc 301

---

>ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053503697.100) partial mRNA
          Length = 5331

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 314  cgatgtcgacggcgaagtcacc 335
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240

---

>ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053504105.200) partial mRNA
          Length = 5334

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 314  cgatgtcgacggcgaagtcacc 335
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240

---

>emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate kinase
          Length = 536

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| |  || |||||||| |||||| |||| || ||||| || || ||||| 
Sbjct: 392 tcagggaaccacaaagcaatctcctttctggcactctcgacagagtcactaccgtggatc 333

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           |||||||| || ||||| |  || ||||| ||||||||
Sbjct: 332 acattccttccaatgtcaatagcaaagtccccacggat 295

---

>emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 26
          Length = 199754

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                          
Query: 244    tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
              ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 136684 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 136625

                                                    
Query: 304    acattcctgccgatgtcgacggcgaagtcaccacggat 341
              || |||||||| ||||| |  || ||||| ||||||||
Sbjct: 136624 acgttcctgccaatgtcaatagcaaagtccccacggat 136587

---

>emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, BAC clone T30A10 (ESSA project)
          Length = 83369

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                         
Query: 244   tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
             ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 69413 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 69354

                                                   
Query: 304   acattcctgccgatgtcgacggcgaagtcaccacggat 341
             || |||||||| ||||| |  || ||||| ||||||||
Sbjct: 69353 acgttcctgccaatgtcaatagcaaagtccccacggat 69316

---

>emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 600

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 182 tggatgacattcctgctgatgtggacgctgaagtcacc 145

---

>emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal brain of Homo sapiens
           (human)
          Length = 873

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 353 tggatgacattcctgctgatgtggacgctgaagtcacc 316

---

>dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE2022389, highly similar to
            NUCLEOSIDE DIPHOSPHATE KINASE, MITOCHONDRIAL PRECURSOR
            (EC 2.7.4.6)
          Length = 1861

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 298  tggatgacattcctgccgatgtcgacggcgaagtcacc 335
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1342 tggatgacattcctgctgatgtggacgctgaagtcacc 1305

---

>emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 467 tggatgacattcctgctgatgtggacgctgaagtcacc 430

---

>emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 566 tggatgacattcctgctgatgtggacgctgaagtcacc 529

---

>emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal brain of Homo sapiens
            (human)
          Length = 1652

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 298  tggatgacattcctgccgatgtcgacggcgaagtcacc 335
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1249 tggatgacattcctgctgatgtggacgctgaagtcacc 1212

---

>gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 475

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 380 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 321

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           || |||||||| ||||| |  || ||||| ||||||||
Sbjct: 320 acgttcctgccaatgtcaatagcaaagtccccacggat 283

---

>gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic cells
           nucleoside-diphosphate kinase 6 (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:JCM 11048
          Length = 689

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 329 agtcaccacggatggtgccggg 350
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419

---

>dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:ATCC 33800
          Length = 689

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 329 agtcaccacggatggtgccggg 350
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419

---

>emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 518

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           || |||||||| ||||| |  || ||||| ||||||||
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggat 296

---

>emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL69ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 593

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           || |||||||| ||||| |  || ||||| ||||||||
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggat 296

---

>gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replication protein CDC47 (CDC47) and
            nucleoside diphosphate kinase (NDPK) genes, complete cds
          Length = 3852

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 322  acggcgaagtcaccacggatggtgcc 347
            ||||||||||||||||| ||||||||
Sbjct: 3427 acggcgaagtcaccacgaatggtgcc 3402

---

>gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 591

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 329 agtcaccacggatggtgccggg 350
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 329 agtcaccacggatggtgccggg 350
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 329 agtcaccacggatggtgccggg 350
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 423

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 329 agtcaccacggatggtgccggg 350
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 329   agtcaccacggatggtgccggg 350
             ||||||||||||||||||||||
Sbjct: 89088 agtcaccacggatggtgccggg 89067

---

>gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA clone ZA87H07
          Length = 714

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 181 tggatgacattcctgctgatgtggacgctgaagtcacc 144

---

>gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphosphate kinase type 1 (NDPK1)
           gene, complete cds
          Length = 450

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 398 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 339

                                                 
Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341
           || |||||||| ||||| |  || ||||| ||||||||
Sbjct: 338 acgttcctgccaatgtcaatagcaaagtccccacggat 301

---

>gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:9630 IMAGE:3913604), complete cds
          Length = 973

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446

---

>emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1
          Length = 831

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 249 gaaccagagggcgatctccttc 270
           ||||||||||||||||||||||
Sbjct: 483 gaaccagagggcgatctccttc 462

---

>emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1
          Length = 853

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 249 gaaccagagggcgatctccttc 270
           ||||||||||||||||||||||
Sbjct: 480 gaaccagagggcgatctccttc 459

---

>emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1
          Length = 851

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 249 gaaccagagggcgatctccttc 270
           ||||||||||||||||||||||
Sbjct: 470 gaaccagagggcgatctccttc 449

---

>emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate kinase
          Length = 879

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 463 tggatgacattcctgctgatgtggacgctgaagtcacc 426

---

>gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, complete sequence
          Length = 215131

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 291    gcttccatggatgacattcct 311
              |||||||||||||||||||||
Sbjct: 175569 gcttccatggatgacattcct 175589

---

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 325     gcgaagtcaccacggatggtgccgg 349
               ||||||||| |||||||||||||||
Sbjct: 1400267 gcgaagtcagcacggatggtgccgg 1400243

---

>gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, complete sequence
          Length = 207310

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 291    gcttccatggatgacattcct 311
              |||||||||||||||||||||
Sbjct: 205795 gcttccatggatgacattcct 205775

---

>gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence
          Length = 450

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 gaagtcaccacggatggtgccgggc 351
           ||||||||| |||||||||||||||
Sbjct: 318 gaagtcaccgcggatggtgccgggc 294

---

>emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chromosome 1 Contains the
             3' end of the RPS6KC1 gene for ribosomal protein S6 kinase
             52kDa polypeptide 1, complete sequence
          Length = 122208

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 208   cagttgtgctggctgctcctc 228
             |||||||||||||||||||||
Sbjct: 42834 cagttgtgctggctgctcctc 42854

---

>emb|AL390879.20| Human DNA sequence from clone RP11-308D16 on chromosome Xq25-27.1
             Contains the 3' end of a novel gene, a serine/arginine
             repetitive matrix 1 (SRRM1) pseudogene (LOC347480), the
             GPR101 gene for G protein-coupled receptor 101 and four
             CpG islands, complete sequence
          Length = 172280

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    atcaaagcaataccatatata 31
             |||||||||||||||||||||
Sbjct: 32813 atcaaagcaataccatatata 32793

---

>ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus similar to Nucleoside
           diphosphate kinase A (NDK A) (NDP kinase A) (Tumor
           metastatic process-associated protein) (Metastasis
           inhibition factor nm23) (nm23-H1) (Granzyme A-activated
           DNase) (GAAD) (LOC580157), mRNA
          Length = 537

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 315 gatgtcgacggcgaagtcaccacggatggtgcc 347
           ||||||||| | | |||||||||||||||||||
Sbjct: 408 gatgtcgacagagtagtcaccacggatggtgcc 376

---

>emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal wing disc )
          Length = 573

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 gaagtcaccacggatggtgccgggc 351
           ||||||||| |||||||||||||||
Sbjct: 352 gaagtcaccgcggatggtgccgggc 328

---

>gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA
          Length = 650

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 gaagtcaccacggatggtgccgggc 351
           ||||||||| |||||||||||||||
Sbjct: 413 gaagtcaccgcggatggtgccgggc 389

---

>ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2210-RA (awd), mRNA
          Length = 683

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 gaagtcaccacggatggtgccgggc 351
           ||||||||| |||||||||||||||
Sbjct: 462 gaagtcaccgcggatggtgccgggc 438

---

>gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside diphosphate kinase
           (ndkA) mRNA, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 247 gggaaccagagggcgatctccttcctggcattctcaactgagtcg 291
           |||||||| |||||||||||||||  ||| ||||| || ||||||
Sbjct: 455 gggaaccaaagggcgatctccttctcggcgttctcgacggagtcg 411

---

>gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, region 100D1-100F2, BAC clone
              BACR48C22, complete sequence
          Length = 181446

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 327    gaagtcaccacggatggtgccgggc 351
              ||||||||| |||||||||||||||
Sbjct: 115598 gaagtcaccgcggatggtgccgggc 115622

---

>gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 117 of 118 of the complete
              sequence
          Length = 232050

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 327    gaagtcaccacggatggtgccgggc 351
              ||||||||| |||||||||||||||
Sbjct: 154870 gaagtcaccgcggatggtgccgggc 154894

---

>gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 573

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 295 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 347
           ||||| || ||||| ||||| |||||||  || || |||||||||||||||||
Sbjct: 352 ccatgaatcacatttctgccaatgtcgattgcaaaatcaccacggatggtgcc 300

---

>gb|AC120985.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06,
             complete sequence
          Length = 127150

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ccatatataaaatatagagc 42
             ||||||||||||||||||||
Sbjct: 78500 ccatatataaaatatagagc 78519

---

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 334     ccacggatggtgccgggctc 353
               ||||||||||||||||||||
Sbjct: 2073845 ccacggatggtgccgggctc 2073864

---

>gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kinase mRNA, partial
           cds
          Length = 679

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 240 gccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatg 299
           |||||| |||||||| ||  | ||||||||||| ||| ||||||| | |||||| |||||
Sbjct: 435 gccctctgggaaccacagcccaatctccttcctcgcactctcaaccgcgtcgctcccatg 376

---

>gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosome 16, complete
             sequence
          Length = 198296

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 218   ggctgctcctccactcagca 237
             ||||||||||||||||||||
Sbjct: 12027 ggctgctcctccactcagca 12008

---

>gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome 1, complete sequence
          Length = 141921

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 109   aatacaaatctcaaaactgt 128
             ||||||||||||||||||||
Sbjct: 50683 aatacaaatctcaaaactgt 50702

---

>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete
              sequence
          Length = 233365

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 107    gaaatacaaatctcaaaactgtaa 130
              |||||||||||||||| |||||||
Sbjct: 161004 gaaatacaaatctcaatactgtaa 161027

---

>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence
          Length = 205642

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 296    catggatgacattcctgccgatgt 319
              |||||||||||||||||| |||||
Sbjct: 161801 catggatgacattcctgctgatgt 161778

---

>gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, complete sequence
          Length = 170622

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 109  aatacaaatctcaaaactgt 128
            ||||||||||||||||||||
Sbjct: 5137 aatacaaatctcaaaactgt 5118

---

>emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chromosome 1 Contains the 5'
              end of a novel gene (FLJ45235), a novel gene, the 5' end of
              the gene for Kelch motif containing protein, a ribosomal
              protein S27 (metallopanstimulin 1)  (RPS27) pseudogene and
              a CpG island, complete sequence
          Length = 127227

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 108    aaatacaaatctcaaaactgtaaa 131
              |||||||||||||||||| |||||
Sbjct: 118372 aaatacaaatctcaaaacagtaaa 118349

---

>emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J4 on chromosome 1q24.1-24.3
             Contains two genes for novel proteins (FLJ10514) and two
             CpG islands, complete sequence
          Length = 133936

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 108   aaatacaaatctcaaaactgtaaa 131
             |||||||||||||||||| |||||
Sbjct: 24849 aaatacaaatctcaaaacagtaaa 24826

---

>emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P24 on chromosome 20 Contains STSs
             and GSSs, complete sequence
          Length = 78371

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 255   gagggcgatctccttcctggcatt 278
             |||| |||||||||||||||||||
Sbjct: 53754 gaggccgatctccttcctggcatt 53731

---

>emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 292

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 334 ccacggatggtgccgggctc 353
           ||||||||||||||||||||
Sbjct: 20  ccacggatggtgccgggctc 1

---

>emb|BX018154.1|CNS08M66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 213

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 334 ccacggatggtgccgggctcggag 357
           ||||||||||||||| ||||||||
Sbjct: 139 ccacggatggtgccgagctcggag 162

---

>emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on chromosome 11 Contains the
             gene for a novel protein simialr to cell division cycle
             associated 4 Cdca4, a ribosomal protein L15 (Rpl15)
             pseudogene, the 3' end of a novel gene and two CpG
             islands, complete sequence
          Length = 183089

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    tcagttcacacaaacaaggt 102
             ||||||||||||||||||||
Sbjct: 11641 tcagttcacacaaacaaggt 11660

---

>emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, complete sequence
          Length = 131030

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gctgctcctccactcagcaa 238
             ||||||||||||||||||||
Sbjct: 81587 gctgctcctccactcagcaa 81568

---

>gb|AC108451.9| Homo sapiens chromosome 15, clone RP11-379K22, complete sequence
          Length = 198707

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 68     cacaaagagataacttcagttcac 91
              ||||||||||||||||||| ||||
Sbjct: 160314 cacaaagagataacttcagatcac 160291

---

>emb|CR855308.6| Zebrafish DNA sequence from clone DKEY-71K24, complete sequence
          Length = 59116

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    caataccatatataaaatat 37
             ||||||||||||||||||||
Sbjct: 47722 caataccatatataaaatat 47703

---

>gb|AC108450.4| Homo sapiens chromosome 15, clone RP11-153O17, complete sequence
          Length = 146943

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 68     cacaaagagataacttcagttcac 91
              ||||||||||||||||||| ||||
Sbjct: 109452 cacaaagagataacttcagatcac 109475

---

>gb|AC109633.5| Homo sapiens chromosome 8, clone CTD-2024D23, complete sequence
          Length = 134242

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    atatataaaatatagagcag 44
             ||||||||||||||||||||
Sbjct: 27726 atatataaaatatagagcag 27745

---

>emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in linkage group 5,
             complete sequence
          Length = 124378

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   aaatacaaatctcaaaactg 127
             ||||||||||||||||||||
Sbjct: 23939 aaatacaaatctcaaaactg 23920

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 23      ccatatataaaatatagagc 42
               ||||||||||||||||||||
Sbjct: 7465431 ccatatataaaatatagagc 7465450

---

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 313     ccgatgtcgacggcgaagtc 332
               ||||||||||||||||||||
Sbjct: 7419314 ccgatgtcgacggcgaagtc 7419295

---

>gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783, complete sequence
          Length = 41150

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 240   gccctcagggaaccagaggg 259
             ||||||||||||||||||||
Sbjct: 13565 gccctcagggaaccagaggg 13584

---

>gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons 26, 27, and 28
          Length = 840

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 gccctcagggaaccagaggg 259
           ||||||||||||||||||||
Sbjct: 468 gccctcagggaaccagaggg 449

---

>gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete cds
          Length = 8091

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 240  gccctcagggaaccagaggg 259
            ||||||||||||||||||||
Sbjct: 5115 gccctcagggaaccagaggg 5096

---

>gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, complete sequence
          Length = 209201

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 218    ggctgctcctccactcagca 237
              ||||||||||||||||||||
Sbjct: 186624 ggctgctcctccactcagca 186605

---

>ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTCH3), mRNA
          Length = 8091

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 240  gccctcagggaaccagaggg 259
            ||||||||||||||||||||
Sbjct: 5115 gccctcagggaaccagaggg 5096

---

>gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 601

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 300
           ||||| |||||||| ||  ||||| ||||||| ||  ||||||| |  || || ||||| 
Sbjct: 406 ccctcggggaaccacagaccgatcaccttcctcgcgctctcaaccgcatcactaccatga 347

                                                       
Query: 301 atgacattcctgccgatgtcgacggcgaagtcaccacggatggt 344
           || ||||| ||||| |||||||  || || ||||||||||||||
Sbjct: 346 atcacatttctgccaatgtcgattgcaaaatcaccacggatggt 303


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,448,985
Number of Sequences: 3902068
Number of extensions: 3448985
Number of successful extensions: 81235
Number of sequences better than 10.0: 202
Number of HSP's better than 10.0 without gapping: 201
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 80788
Number of HSP's gapped (non-prelim): 434
length of query: 370
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 348
effective length of database: 17,147,199,772
effective search space: 5967225520656
effective search space used: 5967225520656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---