| Clone Name | rbaet69d09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kinase (NDPK) mRNA, complete cds Length = 720 Score = 244 bits (123), Expect = 2e-61 Identities = 162/175 (92%) Strand = Plus / Minus Query: 196 gcctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccag 255 ||||| ||||||||||||||||||||||| ||||| | || || |||||||||||||| Sbjct: 515 gcctcgtagatccagttgtgctggctgctggtccacccggcgagaccctcagggaaccac 456 Query: 256 agggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccg 315 ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 455 agggcaatctccttcctggcattctcaactgagtcgcttccatggatgacgttcctgccg 396 Query: 316 atgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||| Sbjct: 395 atgtcaacggcgaagtcaccacggatggtgccaggctcagaggccagggggttgg 341 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 7 tcatatcaaagcaataccatat 28 |||||||||||||||||||||| Sbjct: 674 tcatatcaaagcaataccatat 653
>ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative nucleoside diphosphate kinase (OSJNBa0027P10.4), mRNA Length = 800 Score = 186 bits (94), Expect = 3e-44 Identities = 154/174 (88%) Strand = Plus / Minus Query: 197 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256 ||||||||||||| ||||||| ||||||||||||| || | ||||||||||||||| | Sbjct: 520 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 461 Query: 257 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 316 | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| | Sbjct: 460 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 401 Query: 317 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||||| |||||||| |||||||||||||| ||||| | |||||||||||||| Sbjct: 400 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttgg 347
>dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023136C24, full insert sequence Length = 734 Score = 186 bits (94), Expect = 3e-44 Identities = 154/174 (88%) Strand = Plus / Minus Query: 197 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256 ||||||||||||| ||||||| ||||||||||||| || | ||||||||||||||| | Sbjct: 532 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 473 Query: 257 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 316 | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| | Sbjct: 472 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 413 Query: 317 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||||| |||||||| |||||||||||||| ||||| | |||||||||||||| Sbjct: 412 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttgg 359
>gb|AY103833.1| Zea mays PCO135636 mRNA sequence Length = 929 Score = 137 bits (69), Expect = 3e-29 Identities = 144/169 (85%) Strand = Plus / Minus Query: 202 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 261 ||||||||| ||||||||||||| ||| |||||| ||||||| |||||||| ||||| Sbjct: 709 tagatccaggggtgctggctgctctgccaatcagcagggccctcggggaaccacagggca 650 Query: 262 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 321 |||||||| | ||| |||||| ||| |||||||| |||||||||||||| |||||| Sbjct: 649 atctccttattagcactctcaatgctgtcacttccatgaatgacattcctgccaatgtcg 590 Query: 322 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 || || ||||| |||||||||||||||||||| || ||||||||||||| Sbjct: 589 acagcaaagtcgccacggatggtgccgggctcagaagccagggggttgg 541
>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete sequence Length = 141307 Score = 121 bits (61), Expect = 2e-24 Identities = 103/117 (88%) Strand = Plus / Plus Query: 197 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256 ||||||||||||| ||||||| ||||||||||||| || | ||||||||||||||| | Sbjct: 53331 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 53390 Query: 257 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 313 | || |||||||||||||| ||||| || ||||||||||| |||||||||||||||| Sbjct: 53391 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 53447 Score = 75.8 bits (38), Expect = 9e-11 Identities = 56/62 (90%) Strand = Plus / Plus Query: 309 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368 |||||| |||||||| |||||||| |||||||||||||| ||||| | |||||||||||| Sbjct: 54738 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 54797 Query: 369 gg 370 || Sbjct: 54798 gg 54799
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 121 bits (61), Expect = 2e-24 Identities = 103/117 (88%) Strand = Plus / Plus Query: 197 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256 ||||||||||||| ||||||| ||||||||||||| || | ||||||||||||||| | Sbjct: 21738648 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21738707 Query: 257 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 313 | || |||||||||||||| ||||| || ||||||||||| |||||||||||||||| Sbjct: 21738708 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21738764 Score = 75.8 bits (38), Expect = 9e-11 Identities = 56/62 (90%) Strand = Plus / Plus Query: 309 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368 |||||| |||||||| |||||||| |||||||||||||| ||||| | |||||||||||| Sbjct: 21740055 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21740114 Query: 369 gg 370 || Sbjct: 21740115 gg 21740116
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 121 bits (61), Expect = 2e-24 Identities = 103/117 (88%) Strand = Plus / Plus Query: 197 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 256 ||||||||||||| ||||||| ||||||||||||| || | ||||||||||||||| | Sbjct: 21750311 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21750370 Query: 257 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 313 | || |||||||||||||| ||||| || ||||||||||| |||||||||||||||| Sbjct: 21750371 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21750427 Score = 75.8 bits (38), Expect = 9e-11 Identities = 56/62 (90%) Strand = Plus / Plus Query: 309 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368 |||||| |||||||| |||||||| |||||||||||||| ||||| | |||||||||||| Sbjct: 21751718 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21751777 Query: 369 gg 370 || Sbjct: 21751778 gg 21751779
>gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphate kinase (SoNDPK1) mRNA, complete cds Length = 742 Score = 113 bits (57), Expect = 4e-22 Identities = 141/169 (83%) Strand = Plus / Minus Query: 202 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 261 ||||||||| ||||||||||||| ||| ||||| |||||||| |||||||| || || Sbjct: 498 tagatccaggggtgctggctgctctgccaatcagcgaggccctcggggaaccacagagca 439 Query: 262 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 321 |||||||| | ||| |||||| ||| |||||||||||||||||||| || |||||| Sbjct: 438 atctccttgttagcactctcaatgctgtcacttccatggatgacattccttccaatgtcg 379 Query: 322 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 || || ||||| ||||||||||| |||||||| || |||||||||||| Sbjct: 378 acagcaaagtcgccacggatggttccgggctcagaaaccagggggttgg 330
>gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I mRNA, complete cds Length = 573 Score = 101 bits (51), Expect = 2e-18 Identities = 114/135 (84%) Strand = Plus / Minus Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293 |||| |||||||||||||||| | ||||| ||||| ||||| ||||||| |||||||| Sbjct: 503 agcagggccctcagggaaccacaatgcgatttccttggtggcactctcaacagagtcgct 444 Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 353 ||| ||||| |||||||| || ||||| | |||||||||||||||||| || || ||||| Sbjct: 443 tccgtggatcacattccttccaatgtcaatggcgaagtcaccacggatagttccaggctc 384 Query: 354 ggaggccagggggtt 368 || |||| |||||| Sbjct: 383 agatgccaaggggtt 369
>gb|AY104578.1| Zea mays PCO113042 mRNA sequence Length = 943 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 |||||||||||||| |||||||||||| | | ||||| || |||||||||||||||||| Sbjct: 575 tcagggaaccagagagcgatctccttcttcccgttctccacggagtcgcttccatggatg 516 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccggg 350 ||||||||||||| || |||||| |||| ||||| ||||| ||||| Sbjct: 515 acattcctgccgacttccacggcgtagtccccacgaatggtaccggg 469
>ref|XM_478187.1| Oryza sativa (japonica cultivar-group), mRNA Length = 450 Score = 99.6 bits (50), Expect = 6e-18 Identities = 110/130 (84%) Strand = Plus / Minus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280 |||||||||||||||| | || |||||||||||||| |||||||||||| | | || | Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362 Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340 | || |||||||| |||||||||||||||||||| | || ||||| ||||| |||||| Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302 Query: 341 tggtgccggg 350 |||||||||| Sbjct: 301 tggtgccggg 292
>gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside diphosphate kinase 1 mRNA, complete cds Length = 683 Score = 99.6 bits (50), Expect = 6e-18 Identities = 110/130 (84%) Strand = Plus / Minus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280 |||||||||||||||| | || |||||||||||||| |||||||||||| | | || | Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362 Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340 | || |||||||| |||||||||||||||||||| | || ||||| ||||| |||||| Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302 Query: 341 tggtgccggg 350 |||||||||| Sbjct: 301 tggtgccggg 292
>dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphate kinase, complete cds Length = 683 Score = 99.6 bits (50), Expect = 6e-18 Identities = 110/130 (84%) Strand = Plus / Minus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280 |||||||||||||||| | || |||||||||||||| |||||||||||| | | || | Sbjct: 442 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 383 Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340 | || |||||||| |||||||||||||||||||| | || ||||| ||||| |||||| Sbjct: 382 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 323 Query: 341 tggtgccggg 350 |||||||||| Sbjct: 322 tggtgccggg 313
>dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033095O19, full insert sequence Length = 866 Score = 99.6 bits (50), Expect = 6e-18 Identities = 110/130 (84%) Strand = Plus / Minus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280 |||||||||||||||| | || |||||||||||||| |||||||||||| | | || | Sbjct: 540 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 481 Query: 281 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 340 | || |||||||| |||||||||||||||||||| | || ||||| ||||| |||||| Sbjct: 480 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 421 Query: 341 tggtgccggg 350 |||||||||| Sbjct: 420 tggtgccggg 411
>gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence Length = 727 Score = 83.8 bits (42), Expect = 4e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| || |||||||||||||| ||| ||||||| | || |||||||||||| Sbjct: 451 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 392 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 ||||||||||| ||||| | || || ||||||||||| Sbjct: 391 acattcctgccaatgtcaatagcaaaatcaccacggat 354
>emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleoside diphosphate kinase Length = 590 Score = 83.8 bits (42), Expect = 4e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| || |||||||||||||| ||| ||||||| | || |||||||||||| Sbjct: 388 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 329 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 ||||||||||| ||||| | || || ||||||||||| Sbjct: 328 acattcctgccaatgtcaatagcaaaatcaccacggat 291
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 77.8 bits (39), Expect = 2e-11 Identities = 78/91 (85%) Strand = Plus / Plus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280 |||||||||||||||| | || |||||||||||||| |||||||||||| | | || | Sbjct: 18281744 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 18281803 Query: 281 caactgagtcgcttccatggatgacattcct 311 | || |||||||| ||||||||||||||||| Sbjct: 18281804 ccacggagtcgctcccatggatgacattcct 18281834
>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1218_C12 Length = 105861 Score = 77.8 bits (39), Expect = 2e-11 Identities = 78/91 (85%) Strand = Plus / Plus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280 |||||||||||||||| | || |||||||||||||| |||||||||||| | | || | Sbjct: 84987 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 85046 Query: 281 caactgagtcgcttccatggatgacattcct 311 | || |||||||| ||||||||||||||||| Sbjct: 85047 ccacggagtcgctcccatggatgacattcct 85077
>dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0038F10 Length = 153929 Score = 77.8 bits (39), Expect = 2e-11 Identities = 78/91 (85%) Strand = Plus / Plus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 280 |||||||||||||||| | || |||||||||||||| |||||||||||| | | || | Sbjct: 11239 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 11298 Query: 281 caactgagtcgcttccatggatgacattcct 311 | || |||||||| ||||||||||||||||| Sbjct: 11299 ccacggagtcgctcccatggatgacattcct 11329
>ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP KINASE) (NCU04202.1) partial mRNA Length = 459 Score = 75.8 bits (38), Expect = 9e-11 Identities = 101/122 (82%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 308 |||||||||||| ||||||||| |||| ||||| || |||||| || ||| ||| || Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343 Query: 309 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368 | ||| ||||||| || ||||||||||||||||||||||| ||||||| |||||||| Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283 Query: 369 gg 370 || Sbjct: 282 gg 281
>ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP KINASE) (NCU04202.1) partial mRNA Length = 459 Score = 75.8 bits (38), Expect = 9e-11 Identities = 101/122 (82%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 308 |||||||||||| ||||||||| |||| ||||| || |||||| || ||| ||| || Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343 Query: 309 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 368 | ||| ||||||| || ||||||||||||||||||||||| ||||||| |||||||| Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283 Query: 369 gg 370 || Sbjct: 282 gg 281
>dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate kinase I, complete cds Length = 828 Score = 71.9 bits (36), Expect = 1e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 295 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcg 354 |||||||||||||| ||||| ||||||| |||||| |||||||||||||| || ||||| Sbjct: 380 ccatggatgacatttctgccaatgtcgatggcgaaatcaccacggatggttcctggctct 321 Query: 355 gaggccagggggttgg 370 || || || ||||||| Sbjct: 320 gaagcaagagggttgg 305
>ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosphate kinase (AN8216.2), mRNA Length = 486 Score = 69.9 bits (35), Expect = 6e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||| ||||| |||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 360 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttgg 302
>gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase (swoH) gene, complete cds Length = 776 Score = 69.9 bits (35), Expect = 6e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||| ||||| |||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 650 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttgg 592
>gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA, partial cds Length = 595 Score = 65.9 bits (33), Expect = 9e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 286 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 345 |||||||||||||| ||||||||||||||||| |||| || | ||| || ||||||||| Sbjct: 267 gagtcgcttccatgaatgacattcctgccgatctcgatcgcaaggtccccgcggatggtg 208 Query: 346 ccggg 350 ||||| Sbjct: 207 ccggg 203
>ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosphate kinase (Afu5g03490) partial mRNA Length = 462 Score = 61.9 bits (31), Expect = 1e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||| ||||| |||||||||||||||||||||||||| ||||||| || ||||||| Sbjct: 336 gccgacgtcgatagcgaagtcaccacggatggtgccgggagcggaggcaagagggttgg 278
>emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cosmid contig 62D11 Length = 102165 Score = 61.9 bits (31), Expect = 1e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 328 aagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 14775 aagtcaccacggatggtgccgggagcggaggcgagggggttgg 14817 Score = 46.1 bits (23), Expect = 0.080 Identities = 38/43 (88%) Strand = Plus / Plus Query: 249 gaaccagagggcgatctccttcctggcattctcaactgagtcg 291 |||||||||||| ||||||||| |||| ||||| || |||||| Sbjct: 14630 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 14672
>emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosmid contig 21D9 Length = 55380 Score = 61.9 bits (31), Expect = 1e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 328 aagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 4628 aagtcaccacggatggtgccgggagcggaggcgagggggttgg 4586 Score = 46.1 bits (23), Expect = 0.080 Identities = 38/43 (88%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttcctggcattctcaactgagtcg 291 |||||||||||| ||||||||| |||| ||||| || |||||| Sbjct: 4773 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 4731
>gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate kinase mRNA, complete cds Length = 755 Score = 61.9 bits (31), Expect = 1e-06 Identities = 103/127 (81%) Strand = Plus / Minus Query: 218 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 277 |||||||| |||||| |||| || || |||||||| || || ||||||||||| ||| Sbjct: 470 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatctccttccttgcac 411 Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 337 ||||||| | || |||||||| |||||||||||||| ||||| | || | ||||||| Sbjct: 410 tctcaacagcatcacttccatgaatgacattcctgccaatgtcaatagcataatcaccac 351 Query: 338 ggatggt 344 ||||||| Sbjct: 350 ggatggt 344
>dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate kinase, complete cds Length = 4240 Score = 61.9 bits (31), Expect = 1e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 328 aagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 3268 aagtcaccacggatggtgccgggagcggaggcgagggggttgg 3226 Score = 46.1 bits (23), Expect = 0.080 Identities = 38/43 (88%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttcctggcattctcaactgagtcg 291 |||||||||||| ||||||||| |||| ||||| || |||||| Sbjct: 3413 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 3371
>ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21 nucleoside-diphosphate kinase (CNE02610) partial mRNA Length = 530 Score = 60.0 bits (30), Expect = 5e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 241 ccctcagggaaccagagggcgatctccttc 270 |||||||||||||||||||||||||||||| Sbjct: 425 ccctcagggaaccagagggcgatctccttc 396
>gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kinase (NDK) gene, complete cds Length = 928 Score = 60.0 bits (30), Expect = 5e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 325 gcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 |||||||||||||||||||||||||| ||||||| || ||||||| Sbjct: 737 gcgaagtcaccacggatggtgccgggagcggaggcaagagggttgg 692 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttcctggcattctc 281 |||||||||||| ||||||||| |||| ||||| Sbjct: 865 gaaccagagggcaatctccttcttggcgttctc 833
>dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043K17, full insert sequence Length = 2012 Score = 60.0 bits (30), Expect = 5e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 221 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttc 270 |||||||||||||||| | || |||||||||||||| |||||||||||| Sbjct: 1752 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttc 1703
>gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndpk) mRNA, partial cds Length = 178 Score = 58.0 bits (29), Expect = 2e-05 Identities = 95/117 (81%) Strand = Plus / Minus Query: 198 ctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagag 257 |||||||||||||| || ||||||| ||||| || || |||| || |||||||| || Sbjct: 119 ctcatagatccagtggttaaggctgctgctccaggcaacagggccttctgggaaccacag 60 Query: 258 ggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgcc 314 || ||||||||||| ||| || | |||||||| || ||||| || ||||||||||| Sbjct: 59 tgctatctccttccttgcactccccactgagtcactcccatgaatcacattcctgcc 3
>ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus similar to nucleoside-diphosphate kinase 1 isoform a (LOC580218), mRNA Length = 546 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccgggct 352 |||||||||||||| | ||||||||||||||||||| |||| Sbjct: 420 gccgatgtcgacggagtagtcaccacggatggtgccaggct 380
>gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds Length = 661 Score = 58.0 bits (29), Expect = 2e-05 Identities = 86/105 (81%) Strand = Plus / Minus Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293 |||| |||||||||||||||| | || || ||||| | ||| |||||||||| || || Sbjct: 430 agcagggccctcagggaaccacaatgcaatttccttgttagcactctcaactgaatcact 371 Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacg 338 ||||||||| |||||||| || ||||| | || ||||||||||| Sbjct: 370 tccatggataacattccttccaatgtcaatagcaaagtcaccacg 326
>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7 Length = 344615 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 353 |||||||| || | |||||||| |||||| | ||||||||||||||||||||||| Sbjct: 172638 tggatgacgttgcggccgatgttgacggccagatcaccacggatggtgccgggctc 172693
>gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds Length = 655 Score = 56.0 bits (28), Expect = 8e-05 Identities = 88/108 (81%) Strand = Plus / Minus Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293 |||| |||||||||||||||| | || || ||||| | ||| | ||||||| || || Sbjct: 436 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 377 Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341 ||||||||| |||||||| || ||||| | ||| |||||||||||||| Sbjct: 376 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 329
>gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase mRNA, complete cds Length = 771 Score = 56.0 bits (28), Expect = 8e-05 Identities = 88/108 (81%) Strand = Plus / Minus Query: 234 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 293 |||| |||||||||||||||| | || || ||||| | ||| | ||||||| || || Sbjct: 445 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 386 Query: 294 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341 ||||||||| |||||||| || ||||| | ||| |||||||||||||| Sbjct: 385 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 338
>gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphate kinase mRNA, complete cds Length = 753 Score = 54.0 bits (27), Expect = 3e-04 Identities = 102/127 (80%) Strand = Plus / Minus Query: 218 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 277 |||||||| |||||| |||| || || |||||||| || || ||||||||||| ||| Sbjct: 480 ggctgctctgccactctgcaattccttcggggaaccaaagagcaatctccttcctagcac 421 Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 337 ||||||| | || |||||||| || ||||||||||| || || | || || ||||||| Sbjct: 420 tctcaacagcatcacttccatgaataacattcctgccaatatcaatagcaaaatcaccac 361 Query: 338 ggatggt 344 ||||||| Sbjct: 360 ggatggt 354
>dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886 Length = 635 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 324 ggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 |||||||||||||||||||||||| || ||||||| || ||||||| Sbjct: 361 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttgg 315
>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102 Length = 1779707 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 324 ggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 |||||||||||||||||||||||| || ||||||| || ||||||| Sbjct: 1532690 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttgg 1532736 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 249 gaaccagagggcgatctccttcctggcattctc 281 |||||||||||| ||||||||| |||| ||||| Sbjct: 1532554 gaaccagagggcaatctccttcttggcgttctc 1532586
>gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate kinase mRNA, complete cds Length = 653 Score = 54.0 bits (27), Expect = 3e-04 Identities = 87/107 (81%) Strand = Plus / Minus Query: 241 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 300 |||||||||||||| || | ||||||||| | ||| | ||||| | || |||||||| Sbjct: 428 ccctcagggaaccacagaccaatctccttctttgcactttcaacagcatcacttccatga 369 Query: 301 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 347 || ||||| ||||| ||||||| || || ||||||||||||||||| Sbjct: 368 atcacatttctgccaatgtcgattgcaaaatcaccacggatggtgcc 322
>emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphosphate kinase Length = 639 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 292 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341 |||||||| || ||||||||||| ||||| | ||| |||||||||||||| Sbjct: 377 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 328
>gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase mRNA, partial cds Length = 355 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 286 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 345 ||||||||||||||||| || || | |||||||||| | |||||| || ||||||||| Sbjct: 324 gagtcgcttccatggatcacgtttcgcccgatgtcgatgcagaagtccccgcggatggtg 265 Query: 346 ccgggc 351 |||||| Sbjct: 264 ccgggc 259
>gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside diphosphate kinase I (NDK I) mRNA, complete cds Length = 724 Score = 52.0 bits (26), Expect = 0.001 Identities = 104/130 (80%) Strand = Plus / Minus Query: 241 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 300 |||||||||||||| ||||| ||||| || | ||| | ||||| | |||||||| ||| Sbjct: 432 ccctcagggaaccacagggcaatctcttttgttgcactttcaacagcatcgcttccgtgg 373 Query: 301 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggcc 360 || || || ||||| ||||||| ||| || || ||||||||||| || ||||| || || Sbjct: 372 ataacgtttctgccaatgtcgatggcaaaatctccacggatggtaccaggctctgaagct 313 Query: 361 agggggttgg 370 || ||||||| Sbjct: 312 agagggttgg 303
>dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds Length = 629 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 292 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 341 |||||||| || ||||||||||| ||||| | ||| |||||||||||||| Sbjct: 365 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 316
>ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (MG08622.4) partial cds Length = 726 Score = 50.1 bits (25), Expect = 0.005 Identities = 46/53 (86%) Strand = Plus / Minus Query: 318 gtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttgg 370 ||||| |||| ||||||||||||||||||| || | ||||| |||||||||| Sbjct: 594 gtcgatggcgtagtcaccacggatggtgccaggggccgaggcaagggggttgg 542
>dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside diphosphate kinase 1, complete cds Length = 635 Score = 50.1 bits (25), Expect = 0.005 Identities = 46/53 (86%) Strand = Plus / Minus Query: 295 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 347 ||||| |||||||||||||| ||||| | || || ||||||||||||||||| Sbjct: 417 ccatgaatgacattcctgccaatgtcaatagcaaaatcaccacggatggtgcc 365
>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete sequence Length = 1507550 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 247 gggaaccagagggcgatctccttc 270 |||||||||||||||||||||||| Sbjct: 701410 gggaaccagagggcgatctccttc 701433
>emb|BX072516.1|CNS09S48 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 605 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 442 ccacggatggtgccgggctcggag 465
>emb|BX072515.1|CNS09S47 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 662 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 372 ccacggatggtgccgggctcggag 349
>emb|BX063953.1|CNS09LID Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 838 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 433 ccacggatggtgccgggctcggag 456
>emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 250 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 225 ccacggatggtgccgggctcggag 202
>emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC29BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 827 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 372 ccacggatggtgccgggctcggag 349
>emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 408 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 340 ccacggatggtgccgggctcggag 317
>emb|BX048701.1|CNS099QP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 639 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 197 ccacggatggtgccgggctcggag 174
>emb|BX044675.1|CNS096MV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 341 ccacggatggtgccgggctcggag 318
>emb|BX039425.1|CNS092L1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 349 ccacggatggtgccgggctcggag 326
>emb|BX038906.1|CNS0926M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 298 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 243 ccacggatggtgccgggctcggag 266
>emb|BX038905.1|CNS0926L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 402 ccacggatggtgccgggctcggag 379
>emb|BX038259.1|CNS091ON Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 731 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 422 ccacggatggtgccgggctcggag 445
>emb|BX038258.1|CNS091OM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 715 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 361 ccacggatggtgccgggctcggag 338
>emb|BX038116.1|CNS091KO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 345 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 247 ccacggatggtgccgggctcggag 270
>emb|BX038115.1|CNS091KN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 372 ccacggatggtgccgggctcggag 349
>emb|BX037581.1|CNS0915T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 429 ccacggatggtgccgggctcggag 452
>emb|BX037580.1|CNS0915S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 718 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 372 ccacggatggtgccgggctcggag 349
>emb|BX036658.1|CNS090G6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 313 ccacggatggtgccgggctcggag 290
>emb|BX032742.1|CNS08XFE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 262 ccacggatggtgccgggctcggag 239
>emb|BX031659.1|CNS08WLB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 400 ccacggatggtgccgggctcggag 423
>emb|BX031658.1|CNS08WLA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 346 ccacggatggtgccgggctcggag 323
>emb|BX025663.1|CNS08RYR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 669 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 425 ccacggatggtgccgggctcggag 448
>emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 581 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 363 ccacggatggtgccgggctcggag 340
>emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 532 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 262 ccacggatggtgccgggctcggag 239
>emb|BX024508.1|CNS08R2O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 419 ccacggatggtgccgggctcggag 442
>emb|BX024507.1|CNS08R2N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 818 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 365 ccacggatggtgccgggctcggag 342
>emb|BX023654.1|CNS08QEY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 418 ccacggatggtgccgggctcggag 441
>emb|BX022916.1|CNS08PUG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 541 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 344 ccacggatggtgccgggctcggag 367
>emb|BX022915.1|CNS08PUF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 585 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 379 ccacggatggtgccgggctcggag 356
>emb|BX021481.1|CNS08OQL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 845 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 410 ccacggatggtgccgggctcggag 433
>emb|BX021480.1|CNS08OQK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 659 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 390 ccacggatggtgccgggctcggag 367
>emb|BX021303.1|CNS08OLN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 347 ccacggatggtgccgggctcggag 370
>emb|BX021302.1|CNS08OLM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1032 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 613 ccacggatggtgccgggctcggag 590
>emb|BX021192.1|CNS08OIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 787 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 339 ccacggatggtgccgggctcggag 316
>emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 149 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 103 ccacggatggtgccgggctcggag 126
>emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 608 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 262 ccacggatggtgccgggctcggag 239
>emb|BX018153.1|CNS08M65 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 780 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 347 ccacggatggtgccgggctcggag 324
>emb|BX018054.1|CNS08M3E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA27BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 652 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 262 ccacggatggtgccgggctcggag 239
>emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 691 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 405 ccacggatggtgccgggctcggag 428
>emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 360 ccacggatggtgccgggctcggag 337
>emb|BX017207.1|CNS08LFV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 590 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 223 ccacggatggtgccgggctcggag 246
>emb|BX017206.1|CNS08LFU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 354 ccacggatggtgccgggctcggag 331
>emb|BX016645.1|CNS08L09 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 409 ccacggatggtgccgggctcggag 432
>emb|BX014282.1|CNS08J6M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA21BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 347 ccacggatggtgccgggctcggag 324
>emb|BX013424.1|CNS08IIS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20AH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 350 ccacggatggtgccgggctcggag 327
>emb|BX009576.1|CNS08FJW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 396 ccacggatggtgccgggctcggag 419
>emb|BX009575.1|CNS08FJV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 826 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 387 ccacggatggtgccgggctcggag 364
>emb|BX009569.1|CNS08FJP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 605 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 262 ccacggatggtgccgggctcggag 239
>emb|BX009487.1|CNS08FHF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 818 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 357 ccacggatggtgccgggctcggag 334
>emb|BX007945.1|CNS08EAL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 407 ccacggatggtgccgggctcggag 430
>emb|BX007944.1|CNS08EAK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 730 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 262 ccacggatggtgccgggctcggag 239
>emb|BX006734.1|CNS08DCY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 795 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 394 ccacggatggtgccgggctcggag 417
>emb|BX006733.1|CNS08DCX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 348 ccacggatggtgccgggctcggag 325
>emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 262 ccacggatggtgccgggctcggag 239
>ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253 (ENSANGG00000008764), mRNA Length = 873 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctcggag 357 |||||||||||||||||||||||| Sbjct: 467 ccacggatggtgccgggctcggag 444
>ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05972.1) partial mRNA Length = 717 Score = 46.1 bits (23), Expect = 0.080 Identities = 35/39 (89%) Strand = Plus / Minus Query: 312 gccgatgtcgacggcgaagtcaccacggatggtgccggg 350 ||||| ||||| |||| |||||||||||||||| ||||| Sbjct: 591 gccgacgtcgatggcgtagtcaccacggatggtaccggg 553
>emb|BX025692.1|CNS08RZK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 508 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 335 cacggatggtgccgggctcggag 357 ||||||||||||||||||||||| Sbjct: 369 cacggatggtgccgggctcggag 347
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 323 cggcgaagtcaccacggatggtgccgg 349 ||||||||||| ||||||||||||||| Sbjct: 5713180 cggcgaagtcagcacggatggtgccgg 5713206
>dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside diphosphate kinase 1, complete cds Length = 640 Score = 46.1 bits (23), Expect = 0.080 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 320 |||| ||||||||||| |||||||| || |||||||| ||||| Sbjct: 388 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 346
>gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase mRNA, complete cds Length = 704 Score = 46.1 bits (23), Expect = 0.080 Identities = 101/127 (79%) Strand = Plus / Minus Query: 218 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 277 |||||||| |||||| |||| || || |||||||| || || || |||||||| ||| Sbjct: 480 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatttccttccttgcac 421 Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 337 ||||||||| || |||||||| || || |||||||| ||||| | || | ||||||| Sbjct: 420 tctcaactgcatcacttccatgaataacgttcctgccaatgtcaatagcataatcaccac 361 Query: 338 ggatggt 344 ||||||| Sbjct: 360 ggatggt 354
>dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside diphosphate kinase, partial cds Length = 420 Score = 46.1 bits (23), Expect = 0.080 Identities = 29/31 (93%) Strand = Plus / Minus Query: 326 cgaagtcaccacggatggtgccgggctcgga 356 |||||||||| ||||||||||||||| |||| Sbjct: 313 cgaagtcaccgcggatggtgccgggcgcgga 283
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 46.1 bits (23), Expect = 0.080 Identities = 29/31 (93%) Strand = Plus / Minus Query: 326 cgaagtcaccacggatggtgccgggctcgga 356 |||||||||| ||||||||||||||| |||| Sbjct: 1771041 cgaagtcaccgcggatggtgccgggcgcgga 1771011
>gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphosphate kinase (ndk) gene, complete cds Length = 608 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Minus Query: 324 ggcgaagtcaccacggatggtgccggg 350 |||||||||||| |||||||||||||| Sbjct: 464 ggcgaagtcaccgcggatggtgccggg 438
>dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds Length = 628 Score = 46.1 bits (23), Expect = 0.080 Identities = 38/43 (88%) Strand = Plus / Minus Query: 278 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 320 |||| ||||||||||| |||||||| || |||||||| ||||| Sbjct: 394 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 352
>ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucleoside diphosphate kinase AT4G09320 (NDPK1) mRNA, complete cds Length = 700 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| || ||| |||| || ||||| || |||||||| Sbjct: 482 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 423 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 || |||||||| ||||| | || ||||| |||||||| Sbjct: 422 acgttcctgccaatgtcaatagcaaagtccccacggat 385
>gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein expressed in mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expressed in mRNA, complete cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein expressed in mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein expressed in mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein expressed in mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA (cDNA clone MGC:11088 IMAGE:3830205), complete cds Length = 1045 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 466 tggatgacattcctgctgatgtggacgctgaagtcacc 429
>ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein expressed in (NME4), mRNA Length = 1059 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446
>ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM02776.1) partial mRNA Length = 609 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 313 ccgatgtcgacggcgaagtcaccacggatggtgccggg 350 |||| ||||| ||||||||| ||||||||||| ||||| Sbjct: 485 ccgacgtcgatggcgaagtcgccacggatggttccggg 448
>ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphosphate kinase (Tb11.01.7800) partial mRNA Length = 462 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Minus Query: 322 acggcgaagtcaccacggatggtgcc 347 ||||||||||||||||| |||||||| Sbjct: 326 acggcgaagtcaccacgaatggtgcc 301
>ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053503697.100) partial mRNA Length = 5331 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 314 cgatgtcgacggcgaagtcacc 335 |||||||||||||||||||||| Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240
>ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053504105.200) partial mRNA Length = 5334 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 314 cgatgtcgacggcgaagtcacc 335 |||||||||||||||||||||| Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240
>emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate kinase Length = 536 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| |||||| |||| || ||||| || || ||||| Sbjct: 392 tcagggaaccacaaagcaatctcctttctggcactctcgacagagtcactaccgtggatc 333 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 |||||||| || ||||| | || ||||| |||||||| Sbjct: 332 acattccttccaatgtcaatagcaaagtccccacggat 295
>emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 26 Length = 199754 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| || ||| |||| || ||||| || |||||||| Sbjct: 136684 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 136625 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 || |||||||| ||||| | || ||||| |||||||| Sbjct: 136624 acgttcctgccaatgtcaatagcaaagtccccacggat 136587
>emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, BAC clone T30A10 (ESSA project) Length = 83369 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| || ||| |||| || ||||| || |||||||| Sbjct: 69413 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 69354 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 || |||||||| ||||| | || ||||| |||||||| Sbjct: 69353 acgttcctgccaatgtcaatagcaaagtccccacggat 69316
>emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 600 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 182 tggatgacattcctgctgatgtggacgctgaagtcacc 145
>emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal brain of Homo sapiens (human) Length = 873 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 353 tggatgacattcctgctgatgtggacgctgaagtcacc 316
>dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE2022389, highly similar to NUCLEOSIDE DIPHOSPHATE KINASE, MITOCHONDRIAL PRECURSOR (EC 2.7.4.6) Length = 1861 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 1342 tggatgacattcctgctgatgtggacgctgaagtcacc 1305
>emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 879 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 467 tggatgacattcctgctgatgtggacgctgaagtcacc 430
>emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1082 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 566 tggatgacattcctgctgatgtggacgctgaagtcacc 529
>emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal brain of Homo sapiens (human) Length = 1652 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 1249 tggatgacattcctgctgatgtggacgctgaagtcacc 1212
>gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 475 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| || ||| |||| || ||||| || |||||||| Sbjct: 380 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 321 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 || |||||||| ||||| | || ||||| |||||||| Sbjct: 320 acgttcctgccaatgtcaatagcaaagtccccacggat 283
>gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic cells nucleoside-diphosphate kinase 6 (NME4) mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase, complete cds, strain:JCM 11048 Length = 689 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 agtcaccacggatggtgccggg 350 |||||||||||||||||||||| Sbjct: 440 agtcaccacggatggtgccggg 419
>dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase, complete cds, strain:ATCC 33800 Length = 689 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 agtcaccacggatggtgccggg 350 |||||||||||||||||||||| Sbjct: 440 agtcaccacggatggtgccggg 419
>emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 518 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| || ||| |||| || ||||| || |||||||| Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 || |||||||| ||||| | || ||||| |||||||| Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggat 296
>emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL69ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 593 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| || ||| |||| || ||||| || |||||||| Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 || |||||||| ||||| | || ||||| |||||||| Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggat 296
>gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replication protein CDC47 (CDC47) and nucleoside diphosphate kinase (NDPK) genes, complete cds Length = 3852 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Minus Query: 322 acggcgaagtcaccacggatggtgcc 347 ||||||||||||||||| |||||||| Sbjct: 3427 acggcgaagtcaccacgaatggtgcc 3402
>gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002.01X non-metastatic cells 4 protein (NME4) mRNA, complete cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001.01X non-metastatic cells 4 protein (NME4) mRNA, complete cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000.01L non-metastatic cells 4 protein expressed in (NME4) mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999.01L non-metastatic cells 4 protein expressed in (NME4) mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998.01L non-metastatic cells 4 protein expressed in (NME4) mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997.01L non-metastatic cells 4 protein expressed in (NME4) mRNA, partial cds Length = 564 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415
>dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase, partial cds Length = 591 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 agtcaccacggatggtgccggg 350 |||||||||||||||||||||| Sbjct: 310 agtcaccacggatggtgccggg 289
>dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase, partial cds Length = 590 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 agtcaccacggatggtgccggg 350 |||||||||||||||||||||| Sbjct: 310 agtcaccacggatggtgccggg 289
>dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside diphosphate kinase, partial cds Length = 590 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 agtcaccacggatggtgccggg 350 |||||||||||||||||||||| Sbjct: 310 agtcaccacggatggtgccggg 289
>dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase, partial cds Length = 423 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 agtcaccacggatggtgccggg 350 |||||||||||||||||||||| Sbjct: 310 agtcaccacggatggtgccggg 289
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 agtcaccacggatggtgccggg 350 |||||||||||||||||||||| Sbjct: 89088 agtcaccacggatggtgccggg 89067
>gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA clone ZA87H07 Length = 714 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 181 tggatgacattcctgctgatgtggacgctgaagtcacc 144
>gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphosphate kinase type 1 (NDPK1) gene, complete cds Length = 450 Score = 44.1 bits (22), Expect = 0.32 Identities = 79/98 (80%) Strand = Plus / Minus Query: 244 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 303 ||||||||||| | || |||||||| || ||| |||| || ||||| || |||||||| Sbjct: 398 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 339 Query: 304 acattcctgccgatgtcgacggcgaagtcaccacggat 341 || |||||||| ||||| | || ||||| |||||||| Sbjct: 338 acgttcctgccaatgtcaatagcaaagtccccacggat 301
>gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA (cDNA clone MGC:9630 IMAGE:3913604), complete cds Length = 973 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446
>emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1 Length = 831 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttc 270 |||||||||||||||||||||| Sbjct: 483 gaaccagagggcgatctccttc 462
>emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1 Length = 853 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttc 270 |||||||||||||||||||||| Sbjct: 480 gaaccagagggcgatctccttc 459
>emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1 Length = 851 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 gaaccagagggcgatctccttc 270 |||||||||||||||||||||| Sbjct: 470 gaaccagagggcgatctccttc 449
>emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate kinase Length = 879 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 298 tggatgacattcctgccgatgtcgacggcgaagtcacc 335 |||||||||||||||| ||||| |||| ||||||||| Sbjct: 463 tggatgacattcctgctgatgtggacgctgaagtcacc 426
>gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, complete sequence Length = 215131 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 291 gcttccatggatgacattcct 311 ||||||||||||||||||||| Sbjct: 175569 gcttccatggatgacattcct 175589
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 325 gcgaagtcaccacggatggtgccgg 349 ||||||||| ||||||||||||||| Sbjct: 1400267 gcgaagtcagcacggatggtgccgg 1400243
>gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, complete sequence Length = 207310 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 291 gcttccatggatgacattcct 311 ||||||||||||||||||||| Sbjct: 205795 gcttccatggatgacattcct 205775
>gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence Length = 450 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 327 gaagtcaccacggatggtgccgggc 351 ||||||||| ||||||||||||||| Sbjct: 318 gaagtcaccgcggatggtgccgggc 294
>emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chromosome 1 Contains the 3' end of the RPS6KC1 gene for ribosomal protein S6 kinase 52kDa polypeptide 1, complete sequence Length = 122208 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 208 cagttgtgctggctgctcctc 228 ||||||||||||||||||||| Sbjct: 42834 cagttgtgctggctgctcctc 42854
>emb|AL390879.20| Human DNA sequence from clone RP11-308D16 on chromosome Xq25-27.1 Contains the 3' end of a novel gene, a serine/arginine repetitive matrix 1 (SRRM1) pseudogene (LOC347480), the GPR101 gene for G protein-coupled receptor 101 and four CpG islands, complete sequence Length = 172280 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 11 atcaaagcaataccatatata 31 ||||||||||||||||||||| Sbjct: 32813 atcaaagcaataccatatata 32793
>ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus similar to Nucleoside diphosphate kinase A (NDK A) (NDP kinase A) (Tumor metastatic process-associated protein) (Metastasis inhibition factor nm23) (nm23-H1) (Granzyme A-activated DNase) (GAAD) (LOC580157), mRNA Length = 537 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 315 gatgtcgacggcgaagtcaccacggatggtgcc 347 ||||||||| | | ||||||||||||||||||| Sbjct: 408 gatgtcgacagagtagtcaccacggatggtgcc 376
>emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal wing disc ) Length = 573 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 327 gaagtcaccacggatggtgccgggc 351 ||||||||| ||||||||||||||| Sbjct: 352 gaagtcaccgcggatggtgccgggc 328
>gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA Length = 650 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 327 gaagtcaccacggatggtgccgggc 351 ||||||||| ||||||||||||||| Sbjct: 413 gaagtcaccgcggatggtgccgggc 389
>ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2210-RA (awd), mRNA Length = 683 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 327 gaagtcaccacggatggtgccgggc 351 ||||||||| ||||||||||||||| Sbjct: 462 gaagtcaccgcggatggtgccgggc 438
>gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside diphosphate kinase (ndkA) mRNA, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.2 Identities = 39/45 (86%) Strand = Plus / Minus Query: 247 gggaaccagagggcgatctccttcctggcattctcaactgagtcg 291 |||||||| ||||||||||||||| ||| ||||| || |||||| Sbjct: 455 gggaaccaaagggcgatctccttctcggcgttctcgacggagtcg 411
>gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, region 100D1-100F2, BAC clone BACR48C22, complete sequence Length = 181446 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 327 gaagtcaccacggatggtgccgggc 351 ||||||||| ||||||||||||||| Sbjct: 115598 gaagtcaccgcggatggtgccgggc 115622
>gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 117 of 118 of the complete sequence Length = 232050 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 327 gaagtcaccacggatggtgccgggc 351 ||||||||| ||||||||||||||| Sbjct: 154870 gaagtcaccgcggatggtgccgggc 154894
>gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside diphosphate kinase mRNA, complete cds Length = 573 Score = 42.1 bits (21), Expect = 1.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 295 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 347 ||||| || ||||| ||||| ||||||| || || ||||||||||||||||| Sbjct: 352 ccatgaatcacatttctgccaatgtcgattgcaaaatcaccacggatggtgcc 300
>gb|AC120985.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1532_D06, complete sequence Length = 127150 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ccatatataaaatatagagc 42 |||||||||||||||||||| Sbjct: 78500 ccatatataaaatatagagc 78519
>gb|CP000097.1| Synechococcus sp. CC9902, complete genome Length = 2234828 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctc 353 |||||||||||||||||||| Sbjct: 2073845 ccacggatggtgccgggctc 2073864
>gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kinase mRNA, partial cds Length = 679 Score = 40.1 bits (20), Expect = 4.9 Identities = 50/60 (83%) Strand = Plus / Minus Query: 240 gccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatg 299 |||||| |||||||| || | ||||||||||| ||| ||||||| | |||||| ||||| Sbjct: 435 gccctctgggaaccacagcccaatctccttcctcgcactctcaaccgcgtcgctcccatg 376
>gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosome 16, complete sequence Length = 198296 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 218 ggctgctcctccactcagca 237 |||||||||||||||||||| Sbjct: 12027 ggctgctcctccactcagca 12008
>gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome 1, complete sequence Length = 141921 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 aatacaaatctcaaaactgt 128 |||||||||||||||||||| Sbjct: 50683 aatacaaatctcaaaactgt 50702
>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete sequence Length = 233365 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 107 gaaatacaaatctcaaaactgtaa 130 |||||||||||||||| ||||||| Sbjct: 161004 gaaatacaaatctcaatactgtaa 161027
>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence Length = 205642 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 296 catggatgacattcctgccgatgt 319 |||||||||||||||||| ||||| Sbjct: 161801 catggatgacattcctgctgatgt 161778
>gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, complete sequence Length = 170622 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 aatacaaatctcaaaactgt 128 |||||||||||||||||||| Sbjct: 5137 aatacaaatctcaaaactgt 5118
>emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chromosome 1 Contains the 5' end of a novel gene (FLJ45235), a novel gene, the 5' end of the gene for Kelch motif containing protein, a ribosomal protein S27 (metallopanstimulin 1) (RPS27) pseudogene and a CpG island, complete sequence Length = 127227 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 108 aaatacaaatctcaaaactgtaaa 131 |||||||||||||||||| ||||| Sbjct: 118372 aaatacaaatctcaaaacagtaaa 118349
>emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J4 on chromosome 1q24.1-24.3 Contains two genes for novel proteins (FLJ10514) and two CpG islands, complete sequence Length = 133936 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 108 aaatacaaatctcaaaactgtaaa 131 |||||||||||||||||| ||||| Sbjct: 24849 aaatacaaatctcaaaacagtaaa 24826
>emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P24 on chromosome 20 Contains STSs and GSSs, complete sequence Length = 78371 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 255 gagggcgatctccttcctggcatt 278 |||| ||||||||||||||||||| Sbjct: 53754 gaggccgatctccttcctggcatt 53731
>emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 292 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 ccacggatggtgccgggctc 353 |||||||||||||||||||| Sbjct: 20 ccacggatggtgccgggctc 1
>emb|BX018154.1|CNS08M66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 213 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 334 ccacggatggtgccgggctcggag 357 ||||||||||||||| |||||||| Sbjct: 139 ccacggatggtgccgagctcggag 162
>emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on chromosome 11 Contains the gene for a novel protein simialr to cell division cycle associated 4 Cdca4, a ribosomal protein L15 (Rpl15) pseudogene, the 3' end of a novel gene and two CpG islands, complete sequence Length = 183089 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 83 tcagttcacacaaacaaggt 102 |||||||||||||||||||| Sbjct: 11641 tcagttcacacaaacaaggt 11660
>emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, complete sequence Length = 131030 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 gctgctcctccactcagcaa 238 |||||||||||||||||||| Sbjct: 81587 gctgctcctccactcagcaa 81568
>gb|AC108451.9| Homo sapiens chromosome 15, clone RP11-379K22, complete sequence Length = 198707 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 68 cacaaagagataacttcagttcac 91 ||||||||||||||||||| |||| Sbjct: 160314 cacaaagagataacttcagatcac 160291
>emb|CR855308.6| Zebrafish DNA sequence from clone DKEY-71K24, complete sequence Length = 59116 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 caataccatatataaaatat 37 |||||||||||||||||||| Sbjct: 47722 caataccatatataaaatat 47703
>gb|AC108450.4| Homo sapiens chromosome 15, clone RP11-153O17, complete sequence Length = 146943 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 68 cacaaagagataacttcagttcac 91 ||||||||||||||||||| |||| Sbjct: 109452 cacaaagagataacttcagatcac 109475
>gb|AC109633.5| Homo sapiens chromosome 8, clone CTD-2024D23, complete sequence Length = 134242 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 atatataaaatatagagcag 44 |||||||||||||||||||| Sbjct: 27726 atatataaaatatagagcag 27745
>emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in linkage group 5, complete sequence Length = 124378 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 108 aaatacaaatctcaaaactg 127 |||||||||||||||||||| Sbjct: 23939 aaatacaaatctcaaaactg 23920
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 ccatatataaaatatagagc 42 |||||||||||||||||||| Sbjct: 7465431 ccatatataaaatatagagc 7465450
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 313 ccgatgtcgacggcgaagtc 332 |||||||||||||||||||| Sbjct: 7419314 ccgatgtcgacggcgaagtc 7419295
>gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783, complete sequence Length = 41150 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 240 gccctcagggaaccagaggg 259 |||||||||||||||||||| Sbjct: 13565 gccctcagggaaccagaggg 13584
>gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons 26, 27, and 28 Length = 840 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 240 gccctcagggaaccagaggg 259 |||||||||||||||||||| Sbjct: 468 gccctcagggaaccagaggg 449
>gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete cds Length = 8091 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 240 gccctcagggaaccagaggg 259 |||||||||||||||||||| Sbjct: 5115 gccctcagggaaccagaggg 5096
>gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, complete sequence Length = 209201 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 218 ggctgctcctccactcagca 237 |||||||||||||||||||| Sbjct: 186624 ggctgctcctccactcagca 186605
>ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTCH3), mRNA Length = 8091 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 240 gccctcagggaaccagaggg 259 |||||||||||||||||||| Sbjct: 5115 gccctcagggaaccagaggg 5096
>gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside diphosphate kinase mRNA, complete cds Length = 601 Score = 40.1 bits (20), Expect = 4.9 Identities = 83/104 (79%) Strand = Plus / Minus Query: 241 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 300 ||||| |||||||| || ||||| ||||||| || ||||||| | || || ||||| Sbjct: 406 ccctcggggaaccacagaccgatcaccttcctcgcgctctcaaccgcatcactaccatga 347 Query: 301 atgacattcctgccgatgtcgacggcgaagtcaccacggatggt 344 || ||||| ||||| ||||||| || || |||||||||||||| Sbjct: 346 atcacatttctgccaatgtcgattgcaaaatcaccacggatggt 303 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,448,985 Number of Sequences: 3902068 Number of extensions: 3448985 Number of successful extensions: 81235 Number of sequences better than 10.0: 202 Number of HSP's better than 10.0 without gapping: 201 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 80788 Number of HSP's gapped (non-prelim): 434 length of query: 370 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 348 effective length of database: 17,147,199,772 effective search space: 5967225520656 effective search space used: 5967225520656 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)