ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet69b05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-6... 42 0.10
2gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete se... 42 0.10
3gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, c... 42 0.10
4ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical pro... 40 0.41
5gb|AC141113.5| Medicago truncatula clone mth2-7h7, complete sequ... 38 1.6
6gb|AC144515.14| Medicago truncatula clone mth2-5j8, complete seq... 38 1.6
7emb|CR361548.8| Zebrafish DNA sequence from clone CH211-140M22 i... 38 1.6
8gb|AC174293.6| Medicago truncatula clone mth2-70h5, complete seq... 38 1.6
9gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Canc... 38 1.6
10emb|AL844155.6| Mouse DNA sequence from clone RP23-163L4 on chro... 38 1.6
11gb|AC084288.9| Mus musculus Strain C57BL6/J Chromosome 2 BAC, RP... 38 1.6
12emb|AL807381.6| Zebrafish DNA sequence from clone CH211-222N24, ... 38 1.6
13emb|AL133243.3|CNS01DUG BAC sequence from the SPG4 candidate reg... 38 1.6
14emb|BX248124.7| Zebrafish DNA sequence from clone CH211-214E3 in... 38 1.6
15ref|XM_632887.1| Dictyostelium discoideum NAD+ synthase (glutami... 36 6.4
16ref|XM_635845.1| Dictyostelium discoideum hypothetical protein (... 36 6.4
17ref|XM_473821.1| Oryza sativa (japonica cultivar-group), predic... 36 6.4
18gb|AE014826.1| Plasmodium falciparum 3D7 chromosome 14 section 1... 36 6.4
19gb|AC166342.3| Mus musculus BAC clone RP24-340A12 from chromosom... 36 6.4
20gb|AF039041.2| Caenorhabditis elegans cosmid W03F8, complete seq... 36 6.4
21gb|AC124736.3| Mus musculus BAC clone RP23-318J20 from chromosom... 36 6.4
22gb|AF094394.1| Fuernrohria setifolia ribosomal protein L16 (rpl1... 36 6.4
23gb|AC125466.4| Mus musculus BAC clone RP23-477O24 from chromosom... 36 6.4
24gb|AC122393.3| Mus musculus BAC clone RP24-83E21 from chromosome... 36 6.4
25gb|AC122806.4| Mus musculus BAC clone RP23-297C11 from 8, comple... 36 6.4
26gb|AC147501.9| Medicago truncatula clone mth2-12n2, complete seq... 36 6.4
27emb|CR522882.5| Zebrafish DNA sequence from clone CH211-209M4 in... 36 6.4
28emb|Z83745.1|HS453A3 Human DNA sequence from clone RP3-453A3 on ... 36 6.4
29emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 36 6.4
30emb|AL451082.6| Human DNA sequence from clone RP11-307B16 on chr... 36 6.4
31emb|AL445209.4| Human DNA sequence from clone RP11-52L5 on chrom... 36 6.4
32emb|AL359378.12| Human DNA sequence from clone RP11-203H2 on chr... 36 6.4
33emb|AL158823.11| Human DNA sequence from clone RP11-151F5 on chr... 36 6.4
34emb|BX571864.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 36 6.4
35emb|AL606691.4|OSJN00081 Oryza sativa genomic DNA, chromosome 4,... 36 6.4
36emb|CR391926.10| Zebrafish DNA sequence from clone CH211-275N22 ... 36 6.4
37emb|CR385074.10| Zebrafish DNA sequence from clone CH211-258K6 i... 36 6.4
38emb|AL645685.12| Mouse DNA sequence from clone RP23-198I4 on chr... 36 6.4
39emb|AL732549.16| Mouse DNA sequence from clone RP23-142E14 on ch... 36 6.4
40emb|BX569794.8| Zebrafish DNA sequence from clone DKEYP-15B2 in ... 36 6.4
41emb|BX323069.12| Zebrafish DNA sequence from clone DKEYP-69D2 in... 36 6.4
42gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig co... 36 6.4
43gb|AC127891.2| Homo sapiens 12 BAC RP11-91I24 (Roswell Park Canc... 36 6.4
44gb|AC129031.1| Homo sapiens 12 BAC RP11-106H17 (Roswell Park Can... 36 6.4
45gb|AC092995.7| Homo sapiens 3 BAC RP11-692L6 (Roswell Park Cance... 36 6.4
46gb|AC105940.2| Homo sapiens chromosome 1 clone RP11-335O13, comp... 36 6.4
47emb|BX569785.12| Zebrafish DNA sequence from clone DKEY-159F4 in... 36 6.4
48ref|XM_628197.1| Cryptosporidium parvum Iowa II hypothetical pro... 36 6.4
49emb|AL954812.14| Zebrafish DNA sequence from clone DKEY-50G15, c... 36 6.4
50dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.4
51dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.4
52gb|AC103726.5| Homo sapiens chromosome 8, clone RP11-737F9, comp... 36 6.4
53gb|AC154812.2| Mus musculus BAC clone RP24-532D12 from chromosom... 36 6.4
54gb|AC026333.28| Homo sapiens 12 BAC RP11-324E6 (Roswell Park Can... 36 6.4
55gb|AC009971.8| Homo sapiens BAC clone RP11-443F4 from 2, complet... 36 6.4
56gb|AC084610.1|CBRG44C02 Caenorhabditis briggsae cosmid G44C02, c... 36 6.4
57dbj|AP003350.3| Oryza sativa (japonica cultivar-group) genomic D... 36 6.4
58gb|AC121253.3| Homo sapiens chromosome 3 clone RP11-208G16, comp... 36 6.4
59emb|BX470223.14| Zebrafish DNA sequence from clone DKEY-45P9 in ... 36 6.4
60gb|AC151485.5| Monodelphis domestica, clone XX-214B11, complete ... 36 6.4
61emb|AJ329993.1|HSA329993 Homo sapiens genomic sequence surroundi... 36 6.4
62emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in ... 36 6.4
63gb|AC154712.2| Mus musculus BAC clone RP24-359J22 from 16, compl... 36 6.4
64emb|AJ506745.1|OSA506745 Oryza sativa (japonica cultivar-group) ... 36 6.4
65dbj|AP005887.2| Homo sapiens genomic DNA, chromosome 8q24, clone... 36 6.4
66dbj|AP005714.3| Homo sapiens genomic DNA, chromosome 8q24, clone... 36 6.4
67gb|CP000219.1| Drosophila melanogaster genomic scaffold 21100002... 36 6.4
68emb|AL133168.6|CNS01DU7 Human chromosome 14 DNA sequence BAC R-1... 36 6.4
69dbj|D89861.1| Cyanidioschyzon merolae mitochondrial DNA, complet... 36 6.4

>gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-64h15, complete
             sequence
          Length = 45758

 Score = 42.1 bits (21), Expect = 0.10
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 13    ttattatttttgctcaattaa 33
             |||||||||||||||||||||
Sbjct: 12268 ttattatttttgctcaattaa 12288



to top

>gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete sequence
          Length = 124037

 Score = 42.1 bits (21), Expect = 0.10
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 13    ttattatttttgctcaattaa 33
             |||||||||||||||||||||
Sbjct: 11525 ttattatttttgctcaattaa 11505



to top

>gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, complete sequence
          Length = 178059

 Score = 42.1 bits (21), Expect = 0.10
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    tatttttgctcaattaacaac 37
             |||||||||||||||||||||
Sbjct: 79311 tatttttgctcaattaacaac 79291



to top

>ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical protein (PB103910.00.0)
            partial mRNA
          Length = 3190

 Score = 40.1 bits (20), Expect = 0.41
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   attattatttttgctcaatt 31
            ||||||||||||||||||||
Sbjct: 1392 attattatttttgctcaatt 1373



to top

>gb|AC141113.5| Medicago truncatula clone mth2-7h7, complete sequence
          Length = 138094

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     ttattatttttgctcaatt 31
              |||||||||||||||||||
Sbjct: 130770 ttattatttttgctcaatt 130788



to top

>gb|AC144515.14| Medicago truncatula clone mth2-5j8, complete sequence
          Length = 119095

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    ttattatttttgctcaatt 31
             |||||||||||||||||||
Sbjct: 38096 ttattatttttgctcaatt 38114



to top

>emb|CR361548.8| Zebrafish DNA sequence from clone CH211-140M22 in linkage group 1,
             complete sequence
          Length = 146409

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 12    attattatttttgctcaattaac 34
             ||||||||||||||| |||||||
Sbjct: 44329 attattatttttgctaaattaac 44351



to top

>gb|AC174293.6| Medicago truncatula clone mth2-70h5, complete sequence
          Length = 132047

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    ttattatttttgctcaatt 31
             |||||||||||||||||||
Sbjct: 55217 ttattatttttgctcaatt 55199



to top

>gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164078

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    attattatttttgctcaat 30
             |||||||||||||||||||
Sbjct: 37790 attattatttttgctcaat 37808



to top

>emb|AL844155.6| Mouse DNA sequence from clone RP23-163L4 on chromosome 2, complete
             sequence
          Length = 193188

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    attatttttgctcaattaa 33
             |||||||||||||||||||
Sbjct: 59072 attatttttgctcaattaa 59054



to top

>gb|AC084288.9| Mus musculus Strain C57BL6/J Chromosome 2 BAC, RP23-108H5, complete
             sequence
          Length = 200393

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    attatttttgctcaattaa 33
             |||||||||||||||||||
Sbjct: 27140 attatttttgctcaattaa 27158



to top

>emb|AL807381.6| Zebrafish DNA sequence from clone CH211-222N24, complete sequence
          Length = 230718

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     ttattatttttgctcaatt 31
              |||||||||||||||||||
Sbjct: 125095 ttattatttttgctcaatt 125077



to top

>emb|AL133243.3|CNS01DUG BAC sequence from the SPG4 candidate region at 2p21-2p22 BAC 559D11 of
              library RPCI-11 from chromosome 2 of Homo sapiens (Human)
          Length = 166318

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 19     tttttgctcaattaacaac 37
              |||||||||||||||||||
Sbjct: 135467 tttttgctcaattaacaac 135449



to top

>emb|BX248124.7| Zebrafish DNA sequence from clone CH211-214E3 in linkage group 12,
             complete sequence
          Length = 211571

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    acattattatttttgctca 28
             |||||||||||||||||||
Sbjct: 84970 acattattatttttgctca 84952



to top

>ref|XM_632887.1| Dictyostelium discoideum NAD+ synthase (glutamine-hydrolysing)
            (DDB0231365), partial mRNA
          Length = 2142

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 28   aattaacaactttaacac 45
            ||||||||||||||||||
Sbjct: 1940 aattaacaactttaacac 1957



to top

>ref|XM_635845.1| Dictyostelium discoideum hypothetical protein (DDB0204138), partial
           mRNA
          Length = 1347

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 16  ttatttttgctcaattaa 33
           ||||||||||||||||||
Sbjct: 926 ttatttttgctcaattaa 943



to top

>ref|XM_473821.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2736

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 11   cattattatttttgctca 28
            ||||||||||||||||||
Sbjct: 1788 cattattatttttgctca 1805



to top

>gb|AE014826.1| Plasmodium falciparum 3D7 chromosome 14 section 11 of 13 of the
             complete sequence
          Length = 250663

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 6     ggccacattattattttt 23
             ||||||||||||||||||
Sbjct: 58942 ggccacattattattttt 58925



to top

>gb|AC166342.3| Mus musculus BAC clone RP24-340A12 from chromosome 9, complete sequence
          Length = 174085

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 12    attattatttttgctcaattaa 33
             ||||| ||||||||||||||||
Sbjct: 95897 attatcatttttgctcaattaa 95876



to top

>gb|AF039041.2| Caenorhabditis elegans cosmid W03F8, complete sequence
          Length = 34767

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 27/30 (90%)
 Strand = Plus / Minus

                                           
Query: 12    attattatttttgctcaattaacaacttta 41
             ||||||||||||| |||| || ||||||||
Sbjct: 13787 attattatttttgttcaactaccaacttta 13758



to top

>gb|AC124736.3| Mus musculus BAC clone RP23-318J20 from chromosome 15, complete
             sequence
          Length = 201803

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 14    tattatttttgctcaatt 31
             ||||||||||||||||||
Sbjct: 53378 tattatttttgctcaatt 53395



to top

>gb|AF094394.1| Fuernrohria setifolia ribosomal protein L16 (rpl16) gene, intron;
           chloroplast gene for chloroplast product
          Length = 945

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 13  ttattatttttgctcaat 30
           ||||||||||||||||||
Sbjct: 258 ttattatttttgctcaat 241



to top

>gb|AC125466.4| Mus musculus BAC clone RP23-477O24 from chromosome 9, complete sequence
          Length = 150128

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 30    ttaacaactttaacactt 47
             ||||||||||||||||||
Sbjct: 93004 ttaacaactttaacactt 93021



to top

>gb|AC122393.3| Mus musculus BAC clone RP24-83E21 from chromosome 15, complete sequence
          Length = 223656

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 14     tattatttttgctcaatt 31
              ||||||||||||||||||
Sbjct: 194448 tattatttttgctcaatt 194465



to top

>gb|AC122806.4| Mus musculus BAC clone RP23-297C11 from 8, complete sequence
          Length = 184206

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 16    ttatttttgctcaattaa 33
             ||||||||||||||||||
Sbjct: 12762 ttatttttgctcaattaa 12779



to top

>gb|AC147501.9| Medicago truncatula clone mth2-12n2, complete sequence
          Length = 140523

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 14    tattatttttgctcaattaaca 35
             |||||||||| |||||||||||
Sbjct: 89160 tattatttttcctcaattaaca 89139



to top

>emb|CR522882.5| Zebrafish DNA sequence from clone CH211-209M4 in linkage group 15,
             complete sequence
          Length = 129430

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    attattatttttgctcaa 29
             ||||||||||||||||||
Sbjct: 18546 attattatttttgctcaa 18529



to top

>emb|Z83745.1|HS453A3 Human DNA sequence from clone RP3-453A3 on chromosome Xp11 Contains a
             protein phosphatase 1, regulatory (inhibitor) subunit 11
             (PPP1R11) pseudogene and the 5' end of the gene for a
             novel protein (FLJ31204), complete sequence
          Length = 130926

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 29    attaacaactttaacact 46
             ||||||||||||||||||
Sbjct: 38665 attaacaactttaacact 38682



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 23     tgctcaattaacaacttt 40
              ||||||||||||||||||
Sbjct: 151982 tgctcaattaacaacttt 151999



to top

>emb|AL451082.6| Human DNA sequence from clone RP11-307B16 on chromosome 1 Contains the
             5' end of the PPFIA4 gene for eceptor type protein
             tyrosine phosphatase f polypeptide (PTPRF) interacting
             protein (liprin) alpha 4, complete sequence
          Length = 64355

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     cacattattatttttgct 26
             ||||||||||||||||||
Sbjct: 47211 cacattattatttttgct 47194



to top

>emb|AL445209.4| Human DNA sequence from clone RP11-52L5 on chromosome 13 Contains a
             transcription elongation factor B (SIII), polypeptide 1
             (15kDa, elongin C) (TCEB1) pseudogene, a novel gene, the
             POU4F1 gene for POU domain, class 4, transcription factor
             1 (BRN3A, RDC-1), the 3' end a novel gene (contains
             FLJ13449, possible ortholog of mouse 2810449K13Rik
             protein) and 3 CpG islands, complete sequence
          Length = 157302

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 8     ccacattattatttttgc 25
             ||||||||||||||||||
Sbjct: 25826 ccacattattatttttgc 25809



to top

>emb|AL359378.12| Human DNA sequence from clone RP11-203H2 on chromosome 6 Contains part
             of a novel gene and the 3' end of a novel gene, complete
             sequence
          Length = 100919

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 30    ttaacaactttaacactt 47
             ||||||||||||||||||
Sbjct: 49271 ttaacaactttaacactt 49288



to top

>emb|AL158823.11| Human DNA sequence from clone RP11-151F5 on chromosome 9 Contains part of
              the AKAP2 (PALM2) gene for A kinase (PRKA) anchor protein 2
              (paralemmin 2), a ribosomal protein L21 (RPL21) pseudogene
              and a CpG island, complete sequence
          Length = 175558

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 15     attatttttgctcaattaacaa 36
              ||||||||||||||||| ||||
Sbjct: 171863 attatttttgctcaattcacaa 171842



to top

>emb|BX571864.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
             6/17
          Length = 349071

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    cattattatttttgctca 28
             ||||||||||||||||||
Sbjct: 26362 cattattatttttgctca 26345



to top

>emb|AL606691.4|OSJN00081 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0060N03,
             complete sequence
          Length = 179798

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    cattattatttttgctca 28
             ||||||||||||||||||
Sbjct: 34162 cattattatttttgctca 34145



to top

>emb|CR391926.10| Zebrafish DNA sequence from clone CH211-275N22 in linkage group 1,
              complete sequence
          Length = 147649

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 12     attattatttttgctcaattaa 33
              ||||||||| ||||||||||||
Sbjct: 102464 attattattattgctcaattaa 102485



to top

>emb|CR385074.10| Zebrafish DNA sequence from clone CH211-258K6 in linkage group 23,
              complete sequence
          Length = 163114

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 25     ctcaattaacaactttaa 42
              ||||||||||||||||||
Sbjct: 139859 ctcaattaacaactttaa 139876



to top

>emb|AL645685.12| Mouse DNA sequence from clone RP23-198I4 on chromosome 1 Contains a
           ribosomal protein S13 (Rps13) pseudogene, a ribosomal
           protein S27 (Rps27) pseudogene a novel genes and the 3'
           end of a novel gene, complete sequence
          Length = 218950

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 12  attattatttttgctcaa 29
           ||||||||||||||||||
Sbjct: 732 attattatttttgctcaa 715



to top

>emb|AL732549.16| Mouse DNA sequence from clone RP23-142E14 on chromosome 1, complete
            sequence
          Length = 7276

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   attattatttttgctcaa 29
            ||||||||||||||||||
Sbjct: 6008 attattatttttgctcaa 5991



to top

>emb|BX569794.8| Zebrafish DNA sequence from clone DKEYP-15B2 in linkage group 6,
             complete sequence
          Length = 162388

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 29    attaacaactttaacact 46
             ||||||||||||||||||
Sbjct: 80868 attaacaactttaacact 80885



to top

>emb|BX323069.12| Zebrafish DNA sequence from clone DKEYP-69D2 in linkage group 25,
             complete sequence
          Length = 54390

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 5     aggccacattattatttt 22
             ||||||||||||||||||
Sbjct: 31320 aggccacattattatttt 31303



to top

>gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig containing Eve, the hox
              cluster, cholinesterase, and COLP5alpha genes, complete
              sequence
          Length = 796348

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 13     ttattatttttgctcaat 30
              ||||||||||||||||||
Sbjct: 542972 ttattatttttgctcaat 542955



to top

>gb|AC127891.2| Homo sapiens 12 BAC RP11-91I24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 113065

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     cattattatttttgctca 28
              ||||||||||||||||||
Sbjct: 104327 cattattatttttgctca 104310



to top

>gb|AC129031.1| Homo sapiens 12 BAC RP11-106H17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 88645

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    cattattatttttgctca 28
             ||||||||||||||||||
Sbjct: 77907 cattattatttttgctca 77890



to top

>gb|AC092995.7| Homo sapiens 3 BAC RP11-692L6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 115749

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 9     cacattattatttttgctcaat 30
             |||||||||||||||| |||||
Sbjct: 46946 cacattattatttttggtcaat 46967



to top

>gb|AC105940.2| Homo sapiens chromosome 1 clone RP11-335O13, complete sequence
          Length = 177140

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     cacattattatttttgct 26
             ||||||||||||||||||
Sbjct: 36957 cacattattatttttgct 36940



to top

>emb|BX569785.12| Zebrafish DNA sequence from clone DKEY-159F4 in linkage group 10,
             complete sequence
          Length = 140734

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 21    tttgctcaattaacaact 38
             ||||||||||||||||||
Sbjct: 20085 tttgctcaattaacaact 20068



to top

>ref|XM_628197.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd7_10),
           partial mRNA
          Length = 2427

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 26  tcaattaacaactttaacactt 47
           ||||||||||||||||| ||||
Sbjct: 645 tcaattaacaactttaaaactt 666



to top

>emb|AL954812.14| Zebrafish DNA sequence from clone DKEY-50G15, complete sequence
          Length = 192304

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    aattaacaactttaacac 45
             ||||||||||||||||||
Sbjct: 27782 aattaacaactttaacac 27765



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 11       cattattatttttgctca 28
                ||||||||||||||||||
Sbjct: 30766740 cattattatttttgctca 30766723



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 6        ggccacattattattttt 23
                ||||||||||||||||||
Sbjct: 19142607 ggccacattattattttt 19142624



to top

>gb|AC103726.5| Homo sapiens chromosome 8, clone RP11-737F9, complete sequence
          Length = 143480

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    cattattatttttgctca 28
             ||||||||||||||||||
Sbjct: 84070 cattattatttttgctca 84053



to top

>gb|AC154812.2| Mus musculus BAC clone RP24-532D12 from chromosome 9, complete sequence
          Length = 169822

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 12    attattatttttgctcaattaa 33
             ||||| ||||||||||||||||
Sbjct: 10921 attatcatttttgctcaattaa 10900



to top

>gb|AC026333.28| Homo sapiens 12 BAC RP11-324E6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 204793

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 30    ttaacaactttaacactt 47
             ||||||||||||||||||
Sbjct: 26930 ttaacaactttaacactt 26947



to top

>gb|AC009971.8| Homo sapiens BAC clone RP11-443F4 from 2, complete sequence
          Length = 195915

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     attatttttgctcaatta 32
              ||||||||||||||||||
Sbjct: 164361 attatttttgctcaatta 164344



to top

>gb|AC084610.1|CBRG44C02 Caenorhabditis briggsae cosmid G44C02, complete sequence
          Length = 41805

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 8     ccacattattatttttgc 25
             ||||||||||||||||||
Sbjct: 38179 ccacattattatttttgc 38196



to top

>dbj|AP003350.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0702H08
          Length = 166899

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      ggccacattattattttt 23
              ||||||||||||||||||
Sbjct: 108024 ggccacattattattttt 108041



to top

>gb|AC121253.3| Homo sapiens chromosome 3 clone RP11-208G16, complete sequence
          Length = 142193

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 12    attattatttttgctcaa 29
             ||||||||||||||||||
Sbjct: 88249 attattatttttgctcaa 88266



to top

>emb|BX470223.14| Zebrafish DNA sequence from clone DKEY-45P9 in linkage group 10,
             complete sequence
          Length = 247644

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 21    tttgctcaattaacaact 38
             ||||||||||||||||||
Sbjct: 75433 tttgctcaattaacaact 75450



to top

>gb|AC151485.5| Monodelphis domestica, clone XX-214B11, complete sequence
          Length = 182310

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 17    tatttttgctcaattaac 34
             ||||||||||||||||||
Sbjct: 78916 tatttttgctcaattaac 78933



to top

>emb|AJ329993.1|HSA329993 Homo sapiens genomic sequence surrounding NotI site, clone
           NL1-VB16R
          Length = 901

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 14  tattatttttgctcaatt 31
           ||||||||||||||||||
Sbjct: 656 tattatttttgctcaatt 673



to top

>emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in linkage group 8,
             complete sequence
          Length = 163766

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    cattattatttttgctca 28
             ||||||||||||||||||
Sbjct: 37392 cattattatttttgctca 37409



to top

>gb|AC154712.2| Mus musculus BAC clone RP24-359J22 from 16, complete sequence
          Length = 144031

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     attattatttttgctcaa 29
              ||||||||||||||||||
Sbjct: 122350 attattatttttgctcaa 122367



to top

>emb|AJ506745.1|OSA506745 Oryza sativa (japonica cultivar-group) hkt5 pseudogene, exons 1-3
          Length = 3203

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 11   cattattatttttgctca 28
            ||||||||||||||||||
Sbjct: 1170 cattattatttttgctca 1187



to top

>dbj|AP005887.2| Homo sapiens genomic DNA, chromosome 8q24, clone: KB1252A6, complete
            sequence
          Length = 149431

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 11   cattattatttttgctca 28
            ||||||||||||||||||
Sbjct: 2741 cattattatttttgctca 2758



to top

>dbj|AP005714.3| Homo sapiens genomic DNA, chromosome 8q24, clone: KB857C2, complete
             sequence
          Length = 104612

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    cattattatttttgctca 28
             ||||||||||||||||||
Sbjct: 80829 cattattatttttgctca 80846



to top

>gb|CP000219.1| Drosophila melanogaster genomic scaffold 211000022280778
          Length = 150125

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 14    tattatttttgctcaattaaca 35
             ||||||||||| ||||||||||
Sbjct: 79337 tattatttttgatcaattaaca 79358



to top

>emb|AL133168.6|CNS01DU7 Human chromosome 14 DNA sequence BAC R-187K17 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195115

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 16     ttatttttgctcaattaa 33
              ||||||||||||||||||
Sbjct: 148216 ttatttttgctcaattaa 148233



to top

>dbj|D89861.1| Cyanidioschyzon merolae mitochondrial DNA, complete sequence
          Length = 32211

 Score = 36.2 bits (18), Expect = 6.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    tattatttttgctcaatt 31
             ||||||||||||||||||
Sbjct: 26366 tattatttttgctcaatt 26349


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,028,411
Number of Sequences: 3902068
Number of extensions: 1028411
Number of successful extensions: 322579
Number of sequences better than 10.0: 69
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 322027
Number of HSP's gapped (non-prelim): 552
length of query: 49
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 29
effective length of database: 17,155,003,908
effective search space: 497495113332
effective search space used: 497495113332
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top