ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet68c04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF055328.1|AF055328 Hordeum vulgare glucan endo-1,3-beta-gluc... 347 1e-92
2gb|M96938.1|BLYGLCNHI Hordeum vulgare glucan endo-1,3-beta-gluco... 214 1e-52
3emb|AJ890250.1| Triticum aestivum partial mRNA for putative gluc... 119 5e-24
4gb|DQ207707.1| Zea mays cultivar inbred line Mo17 IDP449 marker 40 3.5
5gb|AC121364.2| Oryza sativa (japonica cultivar-group) chromosome... 40 3.5
6ref|XM_798356.1| Trypanosoma brucei TREU927 hypothetical protein... 40 3.5
7gb|AC157561.10| Mus musculus chromosome 7, clone RP23-356A20, co... 40 3.5
8dbj|AK153596.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 40 3.5
9dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.5
10gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, comple... 40 3.5
11emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on ch... 40 3.5
12emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chr... 40 3.5 
>gb|AF055328.1|AF055328 Hordeum vulgare glucan endo-1,3-beta-glucosidase isoenzyme I (BHVG1)
            gene, complete cds
          Length = 3327

 Score =  347 bits (175), Expect = 1e-92
 Identities = 178/179 (99%)
 Strand = Plus / Minus

                                                                        
Query: 92   gatctggttacacacttcactgctgcaatacgtccatgcatcttatttagggcgatatat 151
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 3308 gatctggttacacacttcactgctgcaatacgtccatgcatcttatttaggccgatatat 3249

                                                                        
Query: 152  cgacgtgtacgtatatagtatccacgttacccttcactcctgcattatacgcagcttatt 211
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3248 cgacgtgtacgtatatagtatccacgttacccttcactcctgcattatacgcagcttatt 3189

                                                                       
Query: 212  tattactgtattaggttgacgtacgtacgcatgcacggacgacgctactggaaccggat 270
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3188 tattactgtattaggttgacgtacgtacgcatgcacggacgacgctactggaaccggat 3130
to top
>gb|M96938.1|BLYGLCNHI Hordeum vulgare glucan endo-1,3-beta-glucosidase (isoenzyme I) mRNA,
            3' end
          Length = 1025

 Score =  214 bits (108), Expect = 1e-52
 Identities = 108/108 (100%)
 Strand = Plus / Minus

                                                                        
Query: 163  tatatagtatccacgttacccttcactcctgcattatacgcagcttatttattactgtat 222
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1014 tatatagtatccacgttacccttcactcctgcattatacgcagcttatttattactgtat 955

                                                            
Query: 223  taggttgacgtacgtacgcatgcacggacgacgctactggaaccggat 270
            ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 954  taggttgacgtacgtacgcatgcacggacgacgctactggaaccggat 907
to top
>emb|AJ890250.1| Triticum aestivum partial mRNA for putative glucan
            endo-1,3-beta-D-glucosidase (wgluc5 gene)
          Length = 1242

 Score =  119 bits (60), Expect = 5e-24
 Identities = 185/221 (83%), Gaps = 18/221 (8%)
 Strand = Plus / Minus

                                                                        
Query: 2    cctcaatatctttctctttattcatgacagacggcatag--caccacctgcaatggttgc 59
            ||||||| || ||||||||||||||||||||||  |||   ||||||||| |||||| ||
Sbjct: 1239 cctcaatttccttctctttattcatgacagacgatatataacaccacctggaatggtcgc 1180

                                                                        
Query: 60   act---cttgcatgaatcg-tgttatgacatgcattgatctggttacacacttcactgct 115
            |||   ||||||||||||| |||| ||||||||| |   || |||||||  |||||||||
Sbjct: 1179 actactcttgcatgaatcgatgttctgacatgcact---ctcgttacac--ttcactgct 1125

                                                                        
Query: 116  gcaatacgtccatgcatcttatttagggcga---tatatcgacgtgtacgtatatagtat 172
            |||||||||    ||| ||||||||||  ||   ||| ||||||||||||||||| ||| 
Sbjct: 1124 gcaatacgt----gcagcttatttaggctgacaatatgtcgacgtgtacgtatattgtac 1069

                                                     
Query: 173  ccacgttacccttcactcctgcattatacgcagcttattta 213
            ||||||||| ||||||||||||| |||||||||||||||||
Sbjct: 1068 ccacgttacacttcactcctgcactatacgcagcttattta 1028
to top
>gb|DQ207707.1| Zea mays cultivar inbred line Mo17 IDP449 marker
          Length = 508

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 227 ttgacgtacgtacgcatgca 246
           ||||||||||||||||||||
Sbjct: 164 ttgacgtacgtacgcatgca 145
to top
>gb|AC121364.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0052E20, complete sequence
          Length = 162434

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    tgcaatggttgcactcttgc 67
             ||||||||||||||||||||
Sbjct: 33398 tgcaatggttgcactcttgc 33417
to top
>ref|XM_798356.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.160.0520)
            partial mRNA
          Length = 4818

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 189  tcctgcattatacgcagctt 208
            ||||||||||||||||||||
Sbjct: 4241 tcctgcattatacgcagctt 4222
to top
>gb|AC157561.10| Mus musculus chromosome 7, clone RP23-356A20, complete sequence
          Length = 232927

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 87     gcattgatctggttacacacttca 110
              ||||||||||||||||||| ||||
Sbjct: 106861 gcattgatctggttacacatttca 106884
to top
>dbj|AK153596.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630010I08 product:unclassifiable, full
           insert sequence
          Length = 1375

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 9   atctttctctttattcatga 28
           ||||||||||||||||||||
Sbjct: 327 atctttctctttattcatga 308
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 48       tgcaatggttgcactcttgc 67
                ||||||||||||||||||||
Sbjct: 22929385 tgcaatggttgcactcttgc 22929404
to top
>gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, complete sequence
          Length = 140465

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      atctttctctttattcatga 28
              ||||||||||||||||||||
Sbjct: 139940 atctttctctttattcatga 139921
to top
>emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on chromosome 13, complete
              sequence
          Length = 219226

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      atctttctctttattcatga 28
              ||||||||||||||||||||
Sbjct: 150464 atctttctctttattcatga 150483
to top
>emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chromosome 15, complete
             sequence
          Length = 148496

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     aatatctttctctttattca 25
             ||||||||||||||||||||
Sbjct: 95328 aatatctttctctttattca 95309


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,867,056
Number of Sequences: 3902068
Number of extensions: 1867056
Number of successful extensions: 34747
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34725
Number of HSP's gapped (non-prelim): 21
length of query: 270
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 248
effective length of database: 17,147,199,772
effective search space: 4252505543456
effective search space used: 4252505543456
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top