ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet67a02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY103838.1| Zea mays PCO113775 mRNA sequence 147 3e-32
2ref|XM_472726.1| Oryza sativa (japonica cultivar-group), predic... 145 1e-31
3emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4,... 145 1e-31
4dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
5dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
6dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
7dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
8gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein... 123 4e-25
9gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence 76 9e-11
10gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 geno... 76 9e-11
11gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 geno... 76 9e-11
12gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 geno... 76 9e-11
13gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 geno... 76 9e-11
14gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 geno... 76 9e-11
15gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 geno... 76 9e-11
16gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 gen... 76 9e-11
17gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 gen... 76 9e-11
18gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 geno... 76 9e-11
19gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 geno... 76 9e-11
20gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 geno... 76 9e-11
21gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 geno... 76 9e-11
22gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 geno... 76 9e-11
23gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 geno... 76 9e-11
24gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 geno... 76 9e-11
25gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 geno... 76 9e-11
26emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding p... 48 0.020
27gb|AY103995.1| Zea mays PCO102677 mRNA sequence 48 0.020
28gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of... 46 0.080
29ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra)... 44 0.32
30gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31r... 44 0.32
31gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31r... 44 0.32
32gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDN... 44 0.32
33gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosom... 44 0.32
34gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, c... 44 0.32
35gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosom... 44 0.32
36dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, co... 44 0.32
37gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete se... 42 1.2
38gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 1.2
39ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 4.9
40ref|XM_478692.1| Oryza sativa (japonica cultivar-group), mRNA 40 4.9
41ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 4.9
42ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 4.9
43ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group... 40 4.9
44gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosom... 40 4.9
45gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 4.9
46gb|L16687.2| Caenorhabditis elegans cosmid C04D8, complete sequence 40 4.9
47emb|AL391601.6| Human DNA sequence from clone RP11-551D9 on chro... 40 4.9
48emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 4.9
49emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, ... 40 4.9
50emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BA... 40 4.9
51gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 4.9
52gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, comp... 40 4.9
53gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 4.9
54dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
55dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
56dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 4.9
57dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
58emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chloroph... 40 4.9
59dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
60dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
61dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
62dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
63dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
64gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, compl... 40 4.9
65gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding prot... 40 4.9
66gb|DQ149245.1| Lactococcus lactis plasmid pSK11P, complete sequence 40 4.9 
>gb|AY103838.1| Zea mays PCO113775 mRNA sequence
          Length = 958

 Score =  147 bits (74), Expect = 3e-32
 Identities = 101/110 (91%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
           |||| |||||||||||||||||||||||||||||  |||||||||||||||||  |||||
Sbjct: 811 ataggccgagcgcgccgagcggcgtcttgccctgcccggcctcgaagtagaaggcgagca 752

                                                             
Query: 321 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           ||||||||||||||| ||| | ||||||||||||||||| ||||||||||
Sbjct: 751 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgc 702
to top
>ref|XM_472726.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  145 bits (73), Expect = 1e-31
 Identities = 100/109 (91%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
           |||| ||||| |||||||||||||||||||||||  ||||||||||||||||||||||||
Sbjct: 757 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 698

                                                            
Query: 321 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccg 369
           |||| |||||||||||||| | ||||||||||||||| | |||||||||
Sbjct: 697 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccg 649
to top
>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21,
             complete sequence
          Length = 138969

 Score =  145 bits (73), Expect = 1e-31
 Identities = 100/109 (91%)
 Strand = Plus / Plus

                                                                         
Query: 261   atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
             |||| ||||| |||||||||||||||||||||||  ||||||||||||||||||||||||
Sbjct: 19661 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 19720

                                                              
Query: 321   tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccg 369
             |||| |||||||||||||| | ||||||||||||||| | |||||||||
Sbjct: 19721 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccg 19769
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  145 bits (73), Expect = 1e-31
 Identities = 100/109 (91%)
 Strand = Plus / Plus

                                                                            
Query: 261      atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
                |||| ||||| |||||||||||||||||||||||  ||||||||||||||||||||||||
Sbjct: 22810886 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 22810945

                                                                 
Query: 321      tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccg 369
                |||| |||||||||||||| | ||||||||||||||| | |||||||||
Sbjct: 22810946 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccg 22810994
to top
>dbj|AK108672.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-148-H08, full
           insert sequence
          Length = 1377

 Score =  145 bits (73), Expect = 1e-31
 Identities = 100/109 (91%)
 Strand = Plus / Plus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
           |||| ||||| |||||||||||||||||||||||  ||||||||||||||||||||||||
Sbjct: 41  ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 100

                                                            
Query: 321 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccg 369
           |||| |||||||||||||| | ||||||||||||||| | |||||||||
Sbjct: 101 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccg 149
to top
>dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G02, full
           insert sequence
          Length = 1138

 Score =  145 bits (73), Expect = 1e-31
 Identities = 100/109 (91%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
           |||| ||||| |||||||||||||||||||||||  ||||||||||||||||||||||||
Sbjct: 819 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 760

                                                            
Query: 321 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccg 369
           |||| |||||||||||||| | ||||||||||||||| | |||||||||
Sbjct: 759 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccg 711
to top
>dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055K10, full
           insert sequence
          Length = 1144

 Score =  145 bits (73), Expect = 1e-31
 Identities = 100/109 (91%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
           |||| ||||| |||||||||||||||||||||||  ||||||||||||||||||||||||
Sbjct: 820 ataggccgagggcgccgagcggcgtcttgccctggccggcctcgaagtagaagatgagca 761

                                                            
Query: 321 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccg 369
           |||| |||||||||||||| | ||||||||||||||| | |||||||||
Sbjct: 760 tggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccg 712
to top
>gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein CP24 (Lhcb6-1) mRNA,
           complete cds
          Length = 1040

 Score =  123 bits (62), Expect = 4e-25
 Identities = 98/110 (89%)
 Strand = Plus / Minus

                                                                       
Query: 261 atagaccgagcgcgccgagcggcgtcttgccctgttcggcctcgaagtagaagatgagca 320
           |||| ||||||||||||||  |||||||||||||  | |||||||||||||||  |||||
Sbjct: 774 ataggccgagcgcgccgaggcgcgtcttgccctgcccagcctcgaagtagaaggcgagca 715

                                                             
Query: 321 tggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           ||||||||||||||| ||| | ||||||||||||||||| ||||||||||
Sbjct: 714 tggcaagcatggcgatgcgggcgtgcttgatctcggccagcttgagccgc 665
to top
>gb|DQ427744.1| Sorghum propinquum locus HHU11 genomic sequence
          Length = 757

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 757 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 700
to top
>gb|DQ427743.1| Sorghum bicolor voucher PI585454 locus HHU11 genomic sequence
          Length = 755

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 698
to top
>gb|DQ427742.1| Sorghum bicolor voucher PI267539 locus HHU11 genomic sequence
          Length = 755

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 698
to top
>gb|DQ427741.1| Sorghum bicolor voucher PI267408 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427740.1| Sorghum bicolor voucher PI221607 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427739.1| Sorghum bicolor voucher PI152702 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427738.1| Sorghum bicolor voucher NSL92371 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427737.1| Sorghum bicolor voucher NSL87902b locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427736.1| Sorghum bicolor voucher NSL87902a locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427735.1| Sorghum bicolor voucher NSL87666 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427734.1| Sorghum bicolor voucher NSL77217 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427733.1| Sorghum bicolor voucher NSL77034 locus HHU11 genomic sequence
          Length = 755

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 755 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 698
to top
>gb|DQ427732.1| Sorghum bicolor voucher NSL56174 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427731.1| Sorghum bicolor voucher NSL55243 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427730.1| Sorghum bicolor voucher NSL51365 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427729.1| Sorghum bicolor voucher NSL51030 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>gb|DQ427728.1| Sorghum bicolor voucher NSL50875 locus HHU11 genomic sequence
          Length = 761

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 313 gatgagcatggcaagcatggcgaggcgcgagtgcttgatctcggccaccttgagccgc 370
           |||||||||||| |||||||||||||| | ||||||||||||||| | ||||||||||
Sbjct: 761 gatgagcatggcgagcatggcgaggcgggcgtgcttgatctcggcgagcttgagccgc 704
to top
>emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding protein CP29
          Length = 1162

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||||| |||||||||||| ||||
Sbjct: 760 catggcgaggcgcgcgtgcttgatctccgcca 729
to top
>gb|AY103995.1| Zea mays PCO102677 mRNA sequence
          Length = 1225

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||||| |||||||||||| ||||
Sbjct: 805 catggcgaggcgcgcgtgcttgatctccgcca 774
to top
>gb|AE005909.1| Caulobacter crescentus CB15 section 235 of 359 of the complete genome
          Length = 10294

 Score = 46.1 bits (23), Expect = 0.080
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 271  cgcgccgagcggcgtcttgccct 293
            |||||||||||||||||||||||
Sbjct: 9269 cgcgccgagcggcgtcttgccct 9291
to top
>ref|NM_139299.1| Mus musculus interleukin 31 receptor A (Il31ra), mRNA
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273
to top
>gb|AY509151.1| Mus musculus muzcytor17x2 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2728

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170
to top
>gb|AY509150.1| Mus musculus muzcytor17x1 interleukin 31RA (Il31ra) mRNA, complete
            cds
          Length = 2748

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1191 taaaagaagtcacggacacaga 1170
to top
>gb|BC066164.1| Mus musculus interleukin 31 receptor A, mRNA (cDNA clone MGC:76531
            IMAGE:30475340), complete cds
          Length = 2020

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1016 taaaagaagtcacggacacaga 995
to top
>gb|AC159196.2| Mus musculus BAC clone RP23-430O17 from chromosome 13, complete
             sequence
          Length = 198595

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 127   taaaagaagtcacggacacaga 148
             ||||||||||||||||||||||
Sbjct: 22923 taaaagaagtcacggacacaga 22902
to top
>gb|AF486621.1| Mus musculus gp130-like monocyte receptor mRNA, complete cds
          Length = 2151

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 127 taaaagaagtcacggacacaga 148
           ||||||||||||||||||||||
Sbjct: 874 taaaagaagtcacggacacaga 853
to top
>gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosome 13, complete
             sequence
          Length = 189362

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 127   taaaagaagtcacggacacaga 148
             ||||||||||||||||||||||
Sbjct: 22495 taaaagaagtcacggacacaga 22516
to top
>dbj|AB083111.1| Mus musculus mRNA for cytokine receptor NR10, complete cds
          Length = 3680

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 127  taaaagaagtcacggacacaga 148
            ||||||||||||||||||||||
Sbjct: 1294 taaaagaagtcacggacacaga 1273
to top
>gb|AC149483.1| Populus trichocarpa clone Pop1-69I13, complete sequence
          Length = 51685

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 181  atcccattcaatccatgcgtc 201
            |||||||||||||||||||||
Sbjct: 5637 atcccattcaatccatgcgtc 5617
to top
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 281     ggcgtcttgccctgttcggcc 301
               |||||||||||||||||||||
Sbjct: 1975855 ggcgtcttgccctgttcggcc 1975875
to top
>ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1156

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgcca 760
to top
>ref|XM_478692.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1152

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 786 catggcgaggcgggcgtgcttgatctccgcca 755
to top
>ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1162

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgcca 762
to top
>ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1183

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgcca 762
to top
>ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1221

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 807 catggcgaggcgggcgtgcttgatctccgcca 776
to top
>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete
             sequence
          Length = 199215

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    tatatattacatggtacata 74
             ||||||||||||||||||||
Sbjct: 53057 tatatattacatggtacata 53076
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 266     ccgagcgcgccgagcggcgt 285
               ||||||||||||||||||||
Sbjct: 1691401 ccgagcgcgccgagcggcgt 1691420
to top
>gb|L16687.2| Caenorhabditis elegans cosmid C04D8, complete sequence
          Length = 21034

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 303   cgaagtagaagatgagcatg 322
             ||||||||||||||||||||
Sbjct: 13041 cgaagtagaagatgagcatg 13022
to top
>emb|AL391601.6| Human DNA sequence from clone RP11-551D9 on chromosome 13, complete
             sequence
          Length = 145871

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    aaatgtcttttgcccattct 31
             ||||||||||||||||||||
Sbjct: 67934 aaatgtcttttgcccattct 67953
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 266     ccgagcgcgccgagcggcgt 285
               ||||||||||||||||||||
Sbjct: 3026363 ccgagcgcgccgagcggcgt 3026382
to top
>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
          Length = 194916

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   aaatcatcttatagaccgag 270
             ||||||||||||||||||||
Sbjct: 55520 aaatcatcttatagaccgag 55539
to top
>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project)
          Length = 95266

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   aaatcatcttatagaccgag 270
             ||||||||||||||||||||
Sbjct: 42512 aaatcatcttatagaccgag 42531
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 264    gaccgagcgcgccgagcggc 283
              ||||||||||||||||||||
Sbjct: 404087 gaccgagcgcgccgagcggc 404068
to top
>gb|AC113380.2| Homo sapiens chromosome 5 clone RP11-304B20, complete sequence
          Length = 143534

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     actatatattacatggtaca 72
              ||||||||||||||||||||
Sbjct: 110106 actatatattacatggtaca 110125
to top
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 266     ccgagcgcgccgagcggcgt 285
               ||||||||||||||||||||
Sbjct: 2175170 ccgagcgcgccgagcggcgt 2175189
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 328      catggcgaggcgcgagtgcttgatctcggcca 359
                |||||||||||| | |||||||||||| ||||
Sbjct: 22263178 catggcgaggcgggcgtgcttgatctccgcca 22263209
to top
>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0567H04
          Length = 181420

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 328   catggcgaggcgcgagtgcttgatctcggcca 359
             |||||||||||| | |||||||||||| ||||
Sbjct: 68424 catggcgaggcgggcgtgcttgatctccgcca 68455
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 351     tctcggccaccttgagccgc 370
               ||||||||||||||||||||
Sbjct: 3855385 tctcggccaccttgagccgc 3855404
to top
>dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B02, full
           insert sequence
          Length = 1234

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgcca 762
to top
>emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chlorophyll a/b-binding protein
          Length = 470

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 107 catggcgaggcgggcgtgcttgatctccgcca 76
to top
>dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F11, full
           insert sequence
          Length = 1152

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 786 catggcgaggcgggcgtgcttgatctccgcca 755
to top
>dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D03, full
           insert sequence
          Length = 1169

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 800 catggcgaggcgggcgtgcttgatctccgcca 769
to top
>dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C12, full
           insert sequence
          Length = 1183

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 793 catggcgaggcgggcgtgcttgatctccgcca 762
to top
>dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H13, full
           insert sequence
          Length = 1156

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgcca 760
to top
>dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-F01, full
           insert sequence
          Length = 1221

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 807 catggcgaggcgggcgtgcttgatctccgcca 776
to top
>gb|AC121960.3| Mus musculus BAC clone RP24-248C17 from 14, complete sequence
          Length = 160030

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    tatatattacatggtacata 74
             ||||||||||||||||||||
Sbjct: 14348 tatatattacatggtacata 14329
to top
>gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding protein (RCABP69) mRNA,
           complete cds
          Length = 1178

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 328 catggcgaggcgcgagtgcttgatctcggcca 359
           |||||||||||| | |||||||||||| ||||
Sbjct: 791 catggcgaggcgggcgtgcttgatctccgcca 760
to top
>gb|DQ149245.1| Lactococcus lactis plasmid pSK11P, complete sequence
          Length = 75814

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     aatgaatcaaatgtcttttg 23
             ||||||||||||||||||||
Sbjct: 43229 aatgaatcaaatgtcttttg 43210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,266,156
Number of Sequences: 3902068
Number of extensions: 4266156
Number of successful extensions: 68966
Number of sequences better than 10.0: 66
Number of HSP's better than 10.0 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68293
Number of HSP's gapped (non-prelim): 673
length of query: 370
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 348
effective length of database: 17,147,199,772
effective search space: 5967225520656
effective search space used: 5967225520656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top