ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet66f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC145802.2| Xenopus tropicalis clone CH216-80C17, complete se... 42 0.14
2emb|AL606754.6| Human DNA sequence from clone RP11-479E16 on chr... 42 0.14
3gb|AC122395.4| Mus musculus BAC clone RP24-86H17 from chromosome... 40 0.54
4ref|XM_739811.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 0.54
5emb|BX640495.10| Zebrafish DNA sequence from clone CH211-107H7 i... 40 0.54
6ref|XM_642033.1| Dictyostelium discoideum hypothetical protein (... 38 2.1
7gb|AC121812.3| Mus musculus chromosome 7 clone RP23-454P17, comp... 38 2.1
8ref|XM_630010.1| Dictyostelium discoideum hypothetical protein (... 38 2.1
9gb|AC160545.8| Mus musculus chromosome 1, clone RP23-217K18, com... 38 2.1
10gb|AC147342.3| Pan troglodytes BAC clone CH251-13D13 from Y, com... 38 2.1
11gb|AC147684.4| Pan troglodytes BAC clone CH251-497P9 from Y, com... 38 2.1
12gb|AC147665.3| Pan troglodytes BAC clone CH251-134K23 from Y, co... 38 2.1
13gb|AC147686.2| Pan troglodytes BAC clone CH251-285E7 from Y, com... 38 2.1
14gb|AC147657.2| Pan troglodytes BAC clone CH251-433L14 from Y, co... 38 2.1
15gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, co... 38 2.1
16gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, co... 38 2.1
17gb|AC107846.4| Mus musculus chromosome 1, clone RP23-309I23, com... 38 2.1
18emb|CR352242.13| Zebrafish DNA sequence from clone CH211-218G4 i... 38 2.1
19ref|XM_718648.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 2.1
20ref|XM_732843.1| Plasmodium chabaudi chabaudi hypothetical prote... 38 2.1
21gb|AC144378.2| Pan troglodytes BAC clone RP43-20D17 from Y, comp... 38 2.1
22gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, compl... 38 2.1
23gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chrom... 38 2.1
24emb|AL590432.9| Human DNA sequence from clone RP11-141A19 on chr... 38 2.1
25dbj|BS000673.1| Pan troglodytes chromosome Y clone:PTB-403A06, c... 38 2.1
26dbj|BS000602.1| Pan troglodytes chromosome Y clone:PTB-547B05, c... 38 2.1
27gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 2.1
28gb|AC147670.4| Pan troglodytes BAC clone CH251-94F1 from chromos... 38 2.1
29gb|AC151848.4| Pan troglodytes BAC clone CH251-346F2 from chromo... 38 2.1
30gb|AC150006.3| Pan troglodytes BAC clone CH251-416C12 from chrom... 38 2.1
31gb|AC147571.5| Pan troglodytes BAC clone CH251-422I9 from chromo... 38 2.1
32ref|XM_573620.1| PREDICTED: Rattus norvegicus similar to Mblk1-r... 38 2.1
33gb|AC146011.4| Pan troglodytes BAC clone RP43-42M15 from chromos... 38 2.1
34gb|AC027663.14|AC027663 Homo sapiens chromosome 1 clone RP11-285... 38 2.1
35gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, co... 36 8.4
36gb|AC152976.1| Mus musculus BAC RP23-103K17 (Roswell Park Cance... 36 8.4
37gb|AE014828.1| Plasmodium falciparum 3D7 chromosome 14 section 1... 36 8.4
38gb|AC115767.14| Mus musculus chromosome 6, clone RP23-83K15, com... 36 8.4
39ref|NM_052885.2| Homo sapiens solute carrier family 2 (facilitat... 36 8.4
40gb|AC154710.2| Mus musculus BAC clone RP24-357L12 from chromosom... 36 8.4
41gb|AC102668.12| Mus musculus chromosome 6, clone RP23-296I18, co... 36 8.4
42gb|AC078855.13| Homo sapiens 3 BAC RP11-558M24 (Roswell Park Can... 36 8.4
43gb|AC121800.2| Mus musculus BAC clone RP23-430F24 from 6, comple... 36 8.4
44ref|XM_672332.1| Plasmodium berghei strain ANKA hypothetical pro... 36 8.4
45emb|AL159158.12| Human DNA sequence from clone RP11-81G4 on chro... 36 8.4
46emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete... 36 8.4
47emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome 36 8.4
48emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, comple... 36 8.4
49emb|CR848813.6| Zebrafish DNA sequence from clone DKEY-260J20 in... 36 8.4
50emb|BX677664.9| Zebrafish DNA sequence from clone DKEYP-122B11 i... 36 8.4
51gb|AC121335.5| Homo sapiens 12 BAC RP13-515F16 (Roswell Park Can... 36 8.4
52gb|AC025257.22| Homo sapiens 12 BAC RP11-56G10 (Roswell Park Can... 36 8.4
53emb|CR626416.1| full-length cDNA clone CS0DF003YB20 of Fetal bra... 36 8.4
54gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 36 8.4
55gb|AC140242.5| Mus musculus BAC clone RP23-290N4 from chromosome... 36 8.4
56dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 36 8.4
57gb|AC007250.2| Homo sapiens BAC clone RP11-334G22 from 2, comple... 36 8.4
58gb|AC008920.7|AC008920 Homo sapiens chromosome 5 clone CTD-2278A... 36 8.4
59gb|AC140780.3| Mus musculus BAC clone RP24-500J16 from chromosom... 36 8.4
60emb|AL953908.7| Zebrafish DNA sequence from clone CH211-202A12, ... 36 8.4
61dbj|AP003713.3| Oryza sativa (japonica cultivar-group) genomic D... 36 8.4
62emb|BX649367.6| Zebrafish DNA sequence from clone CH211-133F22 i... 36 8.4
63gb|AC174643.3| Mus musculus BAC clone RP24-235D23 from chromosom... 36 8.4
64gb|AC139182.4| Mus musculus BAC clone RP24-125O22 from 8, comple... 36 8.4 
>gb|AC145802.2| Xenopus tropicalis clone CH216-80C17, complete sequence
          Length = 163910

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 5     aagcacatattatatgtgcta 25
             |||||||||||||||||||||
Sbjct: 98064 aagcacatattatatgtgcta 98084
to top
>emb|AL606754.6| Human DNA sequence from clone RP11-479E16 on chromosome X Contains the
             3' end of the gene for a novel protein (FLJ31204),
             complete sequence
          Length = 106636

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     tataaagcacatattatatgt 21
             |||||||||||||||||||||
Sbjct: 54287 tataaagcacatattatatgt 54307
to top
>gb|AC122395.4| Mus musculus BAC clone RP24-86H17 from chromosome 9, complete sequence
          Length = 203891

 Score = 40.1 bits (20), Expect = 0.54
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     taatgactcttgcacaagac 46
              ||||||||||||||||||||
Sbjct: 129318 taatgactcttgcacaagac 129337
to top
>ref|XM_739811.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000210.02.0)
           partial mRNA
          Length = 888

 Score = 40.1 bits (20), Expect = 0.54
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 8   cacatattatatgtgctaat 27
           ||||||||||||||||||||
Sbjct: 274 cacatattatatgtgctaat 255
to top
>emb|BX640495.10| Zebrafish DNA sequence from clone CH211-107H7 in linkage group 20,
             complete sequence
          Length = 73842

 Score = 40.1 bits (20), Expect = 0.54
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     tataaagcacatattatatg 20
             ||||||||||||||||||||
Sbjct: 27565 tataaagcacatattatatg 27584
to top
>ref|XM_642033.1| Dictyostelium discoideum hypothetical protein (DDB0189368), partial
            mRNA
          Length = 3480

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 14   ttatatgtgctaataatga 32
            |||||||||||||||||||
Sbjct: 1753 ttatatgtgctaataatga 1735
to top
>gb|AC121812.3| Mus musculus chromosome 7 clone RP23-454P17, complete sequence
          Length = 162279

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     tataaagcacatattatat 19
             |||||||||||||||||||
Sbjct: 75025 tataaagcacatattatat 75043
to top
>ref|XM_630010.1| Dictyostelium discoideum hypothetical protein (DDB0183780), partial
           mRNA
          Length = 4752

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 14  ttatatgtgctaataatgactct 36
           ||||||||| |||||||||||||
Sbjct: 728 ttatatgtgataataatgactct 750
to top
>gb|AC160545.8| Mus musculus chromosome 1, clone RP23-217K18, complete sequence
          Length = 240081

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 4      aaagcacatattatatgtg 22
              |||||||||||||||||||
Sbjct: 227440 aaagcacatattatatgtg 227458
to top
>gb|AC147342.3| Pan troglodytes BAC clone CH251-13D13 from Y, complete sequence
          Length = 146106

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 144878 ctaataatgactcttgcac 144860
to top
>gb|AC147684.4| Pan troglodytes BAC clone CH251-497P9 from Y, complete sequence
          Length = 230902

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    ctaataatgactcttgcac 41
             |||||||||||||||||||
Sbjct: 96203 ctaataatgactcttgcac 96185
to top
>gb|AC147665.3| Pan troglodytes BAC clone CH251-134K23 from Y, complete sequence
          Length = 190790

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    ctaataatgactcttgcac 41
             |||||||||||||||||||
Sbjct: 49338 ctaataatgactcttgcac 49320
to top
>gb|AC147686.2| Pan troglodytes BAC clone CH251-285E7 from Y, complete sequence
          Length = 176158

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 143436 ctaataatgactcttgcac 143418
to top
>gb|AC147657.2| Pan troglodytes BAC clone CH251-433L14 from Y, complete sequence
          Length = 173252

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    ctaataatgactcttgcac 41
             |||||||||||||||||||
Sbjct: 65835 ctaataatgactcttgcac 65817
to top
>gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, complete sequence
          Length = 241654

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 106279 ctaataatgactcttgcac 106261
to top
>gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, complete sequence
          Length = 196240

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 157407 ctaataatgactcttgcac 157389
to top
>gb|AC107846.4| Mus musculus chromosome 1, clone RP23-309I23, complete sequence
          Length = 178870

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 4     aaagcacatattatatgtg 22
             |||||||||||||||||||
Sbjct: 89120 aaagcacatattatatgtg 89102
to top
>emb|CR352242.13| Zebrafish DNA sequence from clone CH211-218G4 in linkage group 23,
             complete sequence
          Length = 123503

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 2     ataaagcacatattatatgtgct 24
             ||||||||||| |||||||||||
Sbjct: 95856 ataaagcacattttatatgtgct 95834
to top
>ref|XM_718648.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00365)
            partial mRNA
          Length = 3108

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 11   atattatatgtgctaataa 29
            |||||||||||||||||||
Sbjct: 3001 atattatatgtgctaataa 2983
to top
>ref|XM_732843.1| Plasmodium chabaudi chabaudi hypothetical protein (PC300026.00.0)
          partial mRNA
          Length = 192

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 11 atattatatgtgctaataa 29
          |||||||||||||||||||
Sbjct: 85 atattatatgtgctaataa 67
to top
>gb|AC144378.2| Pan troglodytes BAC clone RP43-20D17 from Y, complete sequence
          Length = 194240

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 138690 ctaataatgactcttgcac 138708
to top
>gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, complete sequence
          Length = 191133

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    ctaataatgactcttgcac 41
             |||||||||||||||||||
Sbjct: 56311 ctaataatgactcttgcac 56293
to top
>gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chromosome y, complete
              sequence
          Length = 196802

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 188583 ctaataatgactcttgcac 188565
to top
>emb|AL590432.9| Human DNA sequence from clone RP11-141A19 on chromosome 1 Contains the
             3' end of a novel gene and a novel gene, complete sequence
          Length = 95760

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 8     cacatattatatgtgctaa 26
             |||||||||||||||||||
Sbjct: 16069 cacatattatatgtgctaa 16087
to top
>dbj|BS000673.1| Pan troglodytes chromosome Y clone:PTB-403A06, complete sequence
          Length = 132888

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    ctaataatgactcttgcac 41
             |||||||||||||||||||
Sbjct: 62929 ctaataatgactcttgcac 62947
to top
>dbj|BS000602.1| Pan troglodytes chromosome Y clone:PTB-547B05, complete sequences
          Length = 211728

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 137813 ctaataatgactcttgcac 137831
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 23       ctaataatgactcttgcac 41
                |||||||||||||||||||
Sbjct: 14270968 ctaataatgactcttgcac 14270986



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 23       ctaataatgactcttgcac 41
                |||||||||||||||||||
Sbjct: 13446709 ctaataatgactcttgcac 13446727



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 23      ctaataatgactcttgcac 41
               |||||||||||||||||||
Sbjct: 9749127 ctaataatgactcttgcac 9749109



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 23      ctaataatgactcttgcac 41
               |||||||||||||||||||
Sbjct: 9046635 ctaataatgactcttgcac 9046653



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 23      ctaataatgactcttgcac 41
               |||||||||||||||||||
Sbjct: 8280580 ctaataatgactcttgcac 8280562



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 23      ctaataatgactcttgcac 41
               |||||||||||||||||||
Sbjct: 4485477 ctaataatgactcttgcac 4485495



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 829721 ctaataatgactcttgcac 829739
to top
>gb|AC147670.4| Pan troglodytes BAC clone CH251-94F1 from chromosome y, complete sequence
          Length = 172123

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 106412 ctaataatgactcttgcac 106430
to top
>gb|AC151848.4| Pan troglodytes BAC clone CH251-346F2 from chromosome y, complete
             sequence
          Length = 147582

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    ctaataatgactcttgcac 41
             |||||||||||||||||||
Sbjct: 38848 ctaataatgactcttgcac 38866
to top
>gb|AC150006.3| Pan troglodytes BAC clone CH251-416C12 from chromosome y, complete
             sequence
          Length = 178982

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    ctaataatgactcttgcac 41
             |||||||||||||||||||
Sbjct: 98163 ctaataatgactcttgcac 98181
to top
>gb|AC147571.5| Pan troglodytes BAC clone CH251-422I9 from chromosome y, complete
              sequence
          Length = 169828

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 106188 ctaataatgactcttgcac 106170
to top
>ref|XM_573620.1| PREDICTED: Rattus norvegicus similar to Mblk1-related protein-1
            (LOC498385), mRNA
          Length = 2284

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1    tataaagcacatattatat 19
            |||||||||||||||||||
Sbjct: 2121 tataaagcacatattatat 2139
to top
>gb|AC146011.4| Pan troglodytes BAC clone RP43-42M15 from chromosome y, complete sequence
          Length = 204487

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     ctaataatgactcttgcac 41
              |||||||||||||||||||
Sbjct: 197529 ctaataatgactcttgcac 197547
to top
>gb|AC027663.14|AC027663 Homo sapiens chromosome 1 clone RP11-285I23, complete sequence
          Length = 170969

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 8      cacatattatatgtgctaa 26
              |||||||||||||||||||
Sbjct: 114632 cacatattatatgtgctaa 114650
to top
>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence
          Length = 184600

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 30     tgactcttgcacaagact 47
              ||||||||||||||||||
Sbjct: 136311 tgactcttgcacaagact 136294
to top
>gb|AC152976.1| Mus musculus  BAC RP23-103K17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 194151

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     tataaagcacatattata 18
             ||||||||||||||||||
Sbjct: 70463 tataaagcacatattata 70446
to top
>gb|AE014828.1| Plasmodium falciparum 3D7 chromosome 14 section 13 of 13 of the
             complete sequence
          Length = 273275

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     aaagcacatattatatgt 21
             ||||||||||||||||||
Sbjct: 49012 aaagcacatattatatgt 49029
to top
>gb|AC115767.14| Mus musculus chromosome 6, clone RP23-83K15, complete sequence
          Length = 257790

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      tataaagcacatattata 18
              ||||||||||||||||||
Sbjct: 255593 tataaagcacatattata 255610
to top
>ref|NM_052885.2| Homo sapiens solute carrier family 2 (facilitated glucose
            transporter), member 13 (SLC2A13), mRNA
          Length = 7003

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1    tataaagcacatattata 18
            ||||||||||||||||||
Sbjct: 5771 tataaagcacatattata 5754
to top
>gb|AC154710.2| Mus musculus BAC clone RP24-357L12 from chromosome 14, complete sequence
          Length = 163421

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 16     atatgtgctaataatgac 33
              ||||||||||||||||||
Sbjct: 107867 atatgtgctaataatgac 107850
to top
>gb|AC102668.12| Mus musculus chromosome 6, clone RP23-296I18, complete sequence
          Length = 186488

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      tataaagcacatattata 18
              ||||||||||||||||||
Sbjct: 152714 tataaagcacatattata 152697
to top
>gb|AC078855.13| Homo sapiens 3 BAC RP11-558M24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 173849

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     acatattatatgtgctaa 26
             ||||||||||||||||||
Sbjct: 41725 acatattatatgtgctaa 41708
to top
>gb|AC121800.2| Mus musculus BAC clone RP23-430F24 from 6, complete sequence
          Length = 188312

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 36    ttgcacaagactattacaacat 57
             ||||||| ||||||||||||||
Sbjct: 41882 ttgcacatgactattacaacat 41861
to top
>ref|XM_672332.1| Plasmodium berghei strain ANKA hypothetical protein (PB000196.01.0)
            partial mRNA
          Length = 5376

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 9    acatattatatgtgctaataat 30
            |||||||| |||||||||||||
Sbjct: 2358 acatattacatgtgctaataat 2379
to top
>emb|AL159158.12| Human DNA sequence from clone RP11-81G4 on chromosome 13 Contains the
            5' end of a novel gene (KIAA0916) and two CpG islands,
            complete sequence
          Length = 154682

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 3    taaagcacatattatatg 20
            ||||||||||||||||||
Sbjct: 3851 taaagcacatattatatg 3868
to top
>emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete genome
          Length = 1512977

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      tataaagcacatattata 18
              ||||||||||||||||||
Sbjct: 751263 tataaagcacatattata 751280
to top
>emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome
          Length = 1499920

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      tataaagcacatattata 18
              ||||||||||||||||||
Sbjct: 747796 tataaagcacatattata 747813
to top
>emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, complete genome
          Length = 1516355

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      tataaagcacatattata 18
              ||||||||||||||||||
Sbjct: 771414 tataaagcacatattata 771431
to top
>emb|CR848813.6| Zebrafish DNA sequence from clone DKEY-260J20 in linkage group 5,
             complete sequence
          Length = 206722

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    attatatgtgctaataat 30
             ||||||||||||||||||
Sbjct: 66381 attatatgtgctaataat 66364
to top
>emb|BX677664.9| Zebrafish DNA sequence from clone DKEYP-122B11 in linkage group 2,
              complete sequence
          Length = 170975

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     atattatatgtgctaata 28
              ||||||||||||||||||
Sbjct: 109904 atattatatgtgctaata 109921
to top
>gb|AC121335.5| Homo sapiens 12 BAC RP13-515F16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 78001

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 1     tataaagcacatattata 18
             ||||||||||||||||||
Sbjct: 28435 tataaagcacatattata 28452
to top
>gb|AC025257.22| Homo sapiens 12 BAC RP11-56G10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 142008

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     atattatatgtgctaata 28
              ||||||||||||||||||
Sbjct: 103764 atattatatgtgctaata 103747
to top
>emb|CR626416.1| full-length cDNA clone CS0DF003YB20 of Fetal brain of Homo
          sapiens (human)
          Length = 1200

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 1  tataaagcacatattata 18
          ||||||||||||||||||
Sbjct: 41 tataaagcacatattata 24
to top
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 40      acaagactattacaacat 57
               ||||||||||||||||||
Sbjct: 2554377 acaagactattacaacat 2554394
to top
>gb|AC140242.5| Mus musculus BAC clone RP23-290N4 from chromosome 8, complete sequence
          Length = 168835

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 6     agcacatattatatgtgc 23
             ||||||||||||||||||
Sbjct: 98160 agcacatattatatgtgc 98143
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 15       tatatgtgctaataatga 32
                ||||||||||||||||||
Sbjct: 21099519 tatatgtgctaataatga 21099536
to top
>gb|AC007250.2| Homo sapiens BAC clone RP11-334G22 from 2, complete sequence
          Length = 180557

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 13    attatatgtgctaataatgact 34
             ||||||| ||||||||||||||
Sbjct: 86570 attatatctgctaataatgact 86591
to top
>gb|AC008920.7|AC008920 Homo sapiens chromosome 5 clone CTD-2278A17, complete sequence
          Length = 120261

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 1     tataaagcacatattatatgtgctaa 26
             |||||||||||| |||||||| ||||
Sbjct: 70222 tataaagcacatgttatatgttctaa 70197
to top
>gb|AC140780.3| Mus musculus BAC clone RP24-500J16 from chromosome 5, complete sequence
          Length = 166260

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 4     aaagcacatattatatgt 21
             ||||||||||||||||||
Sbjct: 98665 aaagcacatattatatgt 98648
to top
>emb|AL953908.7| Zebrafish DNA sequence from clone CH211-202A12, complete sequence
          Length = 193129

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    attatatgtgctaataat 30
             ||||||||||||||||||
Sbjct: 93147 attatatgtgctaataat 93164
to top
>dbj|AP003713.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0528E12
          Length = 139750

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    tatatgtgctaataatga 32
             ||||||||||||||||||
Sbjct: 96520 tatatgtgctaataatga 96537
to top
>emb|BX649367.6| Zebrafish DNA sequence from clone CH211-133F22 in linkage group 20,
             complete sequence
          Length = 161289

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    atattatatgtgctaata 28
             ||||||||||||||||||
Sbjct: 95226 atattatatgtgctaata 95209
to top
>gb|AC174643.3| Mus musculus BAC clone RP24-235D23 from chromosome 8, complete sequence
          Length = 197695

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 6      agcacatattatatgtgc 23
              ||||||||||||||||||
Sbjct: 114420 agcacatattatatgtgc 114403
to top
>gb|AC139182.4| Mus musculus BAC clone RP24-125O22 from 8, complete sequence
          Length = 159792

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 6    agcacatattatatgtgc 23
            ||||||||||||||||||
Sbjct: 5808 agcacatattatatgtgc 5791


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 485,964
Number of Sequences: 3902068
Number of extensions: 485964
Number of successful extensions: 35088
Number of sequences better than 10.0: 64
Number of HSP's better than 10.0 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34851
Number of HSP's gapped (non-prelim): 237
length of query: 59
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 38
effective length of database: 17,151,101,840
effective search space: 651741869920
effective search space used: 651741869920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top