ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet66b02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_471773.1| Oryza sativa (japonica cultivar-group), predic... 204 2e-49
2emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4,... 204 2e-49
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
4dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 2e-49
5dbj|AK071948.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 4e-47
6gb|AY841792.1| Triticum aestivum cysteine protease (CP) mRNA, co... 127 3e-26
7tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for ... 127 3e-26
8gb|AF411121.1| Sandersonia aurantiaca cysteine proteinase precur... 115 1e-22
9gb|BT008950.1| Triticum aestivum clone wdk1c.pk009.j19:fis, full... 109 7e-21
10emb|AJ844006.1| Plantago major partial mRNA for cysteine proteas... 101 2e-18
11gb|AF242373.1|AF242373 Ipomoea batatas cysteine protease (SPCP2)... 101 2e-18
12gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence 100 7e-18
13emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase 100 7e-18
14gb|AY104312.1| Zea mays PCO074362 mRNA sequence 100 7e-18
15dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP,... 100 7e-18
16gb|AF138266.1|AF138266 Ipomoea batatas papain-like cysteine prot... 96 1e-16
17gb|AF138265.1|AF138265 Ipomoea batatas papain-like cysteine prot... 96 1e-16
18gb|AF138264.1|AF138264 Ipomoea batatas papain-like cysteine prot... 96 1e-16
19gb|AF216785.1|AF216785 Ipomoea batatas papain-like cysteine prot... 96 1e-16
20gb|AF216784.1|AF216784 Ipomoea batatas papain-like cysteine prot... 96 1e-16
21gb|AF216783.1|AF216783 Ipomoea batatas papain-like cysteine prot... 96 1e-16
22gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS... 94 4e-16
23emb|X03971.1|CPCPROR Carica papaya mRNA 3'region for cysteine pr... 94 4e-16
24gb|AF462226.1| Narcissus pseudonarcissus putative cysteine prote... 92 2e-15
25ref|XM_507484.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 3e-14
26ref|XM_507483.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 3e-14
27ref|XM_465566.1| Oryza sativa (japonica cultivar-group), mRNA 88 3e-14
28ref|XM_507482.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 3e-14
29ref|XM_506801.2| PREDICTED Oryza sativa (japonica cultivar-group... 88 3e-14
30dbj|AK061947.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
31dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
32dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
33dbj|AK099269.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
34dbj|AK098908.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
35dbj|AK071907.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
36gb|AF007215.1|AF007215 Lavatera thuringiaca stress-induced cyste... 88 3e-14
37dbj|AK119670.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 6e-12
38gb|AY662991.1| Petunia x hybrida cysteine proteinase (CP5) mRNA,... 78 3e-11
39gb|BT014429.1| Lycopersicon esculentum clone 133747F, mRNA sequence 76 1e-10
40dbj|AB161375.1| Aster tripolium CysP mRNA for cysteine protease,... 74 4e-10
41gb|AY800120.1| Populus tomentosa cysteine proteinase (CP) mRNA, ... 68 2e-08
42emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cyst... 68 2e-08
43dbj|AP006110.1| Lotus japonicus genomic DNA, chromosome 1, clone... 66 1e-07
44gb|AF082181.1|AF082181 Solanum melongena cysteine proteinase pre... 64 4e-07
45gb|AY373974.1| Ipomoea batatas cysteine proteinase precursor, mR... 62 2e-06
46dbj|AB090880.1| Aster tripolium mRNA for thiol protease, complet... 62 2e-06
47emb|Z13964.1|NTCYP8 N.tabacum mRNA for pre-pro-cysteine proteinase 60 6e-06
48emb|Z13959.1|NTCYP7 N.tabacum mRNA for pre-pro-cysteine proteinase 60 6e-06
49dbj|AB038598.1| Vigna mungo mRNA for cysteine protease, complete... 60 6e-06
50emb|AJ496571.2|HVU496571 Hordeum vulgare partial mRNA for putati... 58 2e-05
51gb|U71380.1|GMU71380 Glycine max thiol protease isoform A mRNA, ... 58 2e-05
52gb|U71379.1|GMU71379 Glycine max thiol protease isoform B mRNA, ... 58 2e-05
53ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDR... 56 9e-05
54ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, com... 56 9e-05
55gb|AY919605.1| Theileria orientalis cysteine protease 1 gene, co... 56 9e-05
56gb|AY662989.1| Petunia x hybrida cysteine proteinase (CP3) mRNA,... 56 9e-05
57gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cystei... 56 9e-05
58gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase... 56 9e-05
59emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, ... 56 9e-05
60emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, B... 56 9e-05
61dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible ... 56 9e-05
62emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
63emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
64gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete s... 56 9e-05
65dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol ... 56 9e-05
66dbj|AB159780.1| Theileria orientalis ToCP 1 mRNA for cysteine pr... 56 9e-05
67gb|AY110841.1| Zea mays CL908_1 mRNA sequence 56 9e-05
68gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRN... 56 9e-05
69gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome... 54 4e-04
70emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease 54 4e-04
71emb|AJ606072.1| Gossypium hirsutum mRNA for putative papain-like... 54 4e-04
72dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 54 4e-04
73dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 4e-04
74dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene... 54 4e-04
75gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 54 4e-04
76emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine prote... 52 0.001
77emb|AJ009878.1|CAR9878 Cicer arietinum mRNA for cysteine proteinase 52 0.001
78gb|DQ084023.1| Nicotiana benthamiana cysteine proteinase glycina... 52 0.001
79gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete se... 50 0.006
80dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
81gb|AF454959.1| Brassica oleracea senescence-associated cysteine ... 50 0.006
82dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
83dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
84gb|U68221.1|BNU68221 Brassica napus cysteine protease (LSC790) m... 50 0.006
85gb|AY919606.1| Theileria orientalis cysteine protease 3 gene, co... 48 0.023
86gb|AY912450.1| Theileria orientalis tocp1 variant tocp5 gene, pa... 48 0.023
87gb|AY912448.1| Theileria orientalis tocp1 variant tocp3 mRNA, co... 48 0.023
88emb|Z32795.1|GMCYSEND G.max (Fiskeby V) mRNA for cysteine endope... 48 0.023
89gb|AF167986.1|AF167986 Glycine max putative cysteine proteinase ... 48 0.023
90gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protea... 46 0.090
91gb|DQ344624.1| Triticum aestivum vacuolar ATP synthase subunit E... 46 0.090
92gb|AF139913.1|AF139913 Trypanosoma congolense cysteine protease ... 46 0.090
93gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, ... 44 0.36
94emb|Z48736.1|LECYP3GN L.esculentum cyp-3 gene for pre-pro-cystei... 44 0.36
95emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene ... 44 0.36
96emb|AJ242994.1|NTA242994 Nicotiana tabacum mRNA for putative pre... 44 0.36
97gb|AY017414.1| Nicotiana tabacum CPR2-like cysteine proteinase g... 44 0.36
98gb|L38514.1|TRBRANGB Trypanosoma rangeli (clone 3) rangelipain g... 44 0.36
99gb|L38513.1|TRBRANGA Trypanosoma rangeli (clone 2) rangelipain g... 44 0.36
100gb|L38512.1|TRBRANG Trypanosoma rangeli (clone 1) rangelipain ge... 44 0.36
101ref|XM_630282.1| Dictyostelium discoideum hypothetical protein (... 42 1.4
102gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence 42 1.4
103emb|AL357139.11| Human DNA sequence from clone RP11-793L10 on ch... 42 1.4
104emb|Z30338.1|VSCYSPROT V.sativa mRNA for cysteine proteinase 42 1.4
105emb|X54358.1|PSCC15A P.sativum mRNA of cDNA clone 15a 42 1.4
106gb|AY161277.1| Vicia faba pre-pro cysteine proteinase gene, comp... 42 1.4
107gb|U59465.1|VFU59465 Vicia faba pre-pro-cysteine proteinase (VFC... 42 1.4
108gb|AY713477.2| Cryptobia salmositica cysteine proteinase (CYS) g... 40 5.6
109gb|AC138715.3| Mus musculus BAC clone RP23-283E23 from chromosom... 40 5.6
110gb|AC103574.7| Rattus norvegicus 1 BAC CH230-205C19 (Children's ... 40 5.6
111emb|Z99955.1|PVZ99955 Phaseolus vulgaris Moldavian encoding cyst... 40 5.6
112emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine pro... 40 5.6
113emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1 40 5.6
114gb|AC025366.11| Homo sapiens chromosome 8, clone RP11-238I10, co... 40 5.6
115gb|AY090898.1| Cryptobia salmositica 49 kDa cysteine proteinase ... 40 5.6
116emb|X55436.1|BTINAG B. thuringiensis InA gene for immune inhibit... 40 5.6
117gb|AY111351.1| Zea mays CL1876_2 mRNA sequence 40 5.6
118gb|AY106223.1| Zea mays PCO114759 mRNA sequence 40 5.6
119emb|AL606904.12| Mouse DNA sequence from clone RP23-182D20 on ch... 40 5.6
120emb|AL583884.20| Mouse DNA sequence from clone RP23-324B16 on ch... 40 5.6
121gb|L25130.1|TRBACYSPRO Trypanosoma congolense cysteine protease ... 40 5.6
122dbj|D45403.1|MZECYPA Corn mRNA for cysteine proteinase, clone CC... 40 5.6 
>ref|XM_471773.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1146

 Score =  204 bits (103), Expect = 2e-49
 Identities = 175/199 (87%)
 Strand = Plus / Minus

                                                                        
Query: 209  tccttcttagaggtatggatggcggtaaccgtggagaccatggaatcgacaccgcacttg 268
            ||||| || |||||||||||||| || || | ||||||||||||||| ||||||||||||
Sbjct: 1139 tcctttttggaggtatggatggcagtcactgaggagaccatggaatcaacaccgcacttg 1080

                                                                        
Query: 269  tttttgacatgtggacccctgcagatcttgtagtacccgctctcgccccagttctcgccc 328
            || ||| |||| || |||||||||||||||||||||||  |||| |||||||||||||||
Sbjct: 1079 ttcttgtcatgaggtcccctgcagatcttgtagtaccccttctccccccagttctcgccc 1020

                                                                        
Query: 329  catgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgtaaccagct 388
            || |||||||| ||||||||||| || |||||||||||||||| ||||||||| || || 
Sbjct: 1019 cacgagttcttgatgatccagtacggcttctccttgaagcggatcggtgcgtatcctgcc 960

                               
Query: 389  gatccatagccaaccagga 407
            ||||| |||||||| ||||
Sbjct: 959  gatccgtagccaacaagga 941
to top
>emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0054B09,
             complete sequence
          Length = 146506

 Score =  204 bits (103), Expect = 2e-49
 Identities = 175/199 (87%)
 Strand = Plus / Minus

                                                                         
Query: 209   tccttcttagaggtatggatggcggtaaccgtggagaccatggaatcgacaccgcacttg 268
             ||||| || |||||||||||||| || || | ||||||||||||||| ||||||||||||
Sbjct: 22071 tcctttttggaggtatggatggcagtcactgaggagaccatggaatcaacaccgcacttg 22012

                                                                         
Query: 269   tttttgacatgtggacccctgcagatcttgtagtacccgctctcgccccagttctcgccc 328
             || ||| |||| || |||||||||||||||||||||||  |||| |||||||||||||||
Sbjct: 22011 ttcttgtcatgaggtcccctgcagatcttgtagtaccccttctccccccagttctcgccc 21952

                                                                         
Query: 329   catgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgtaaccagct 388
             || |||||||| ||||||||||| || |||||||||||||||| ||||||||| || || 
Sbjct: 21951 cacgagttcttgatgatccagtacggcttctccttgaagcggatcggtgcgtatcctgcc 21892

                                
Query: 389   gatccatagccaaccagga 407
             ||||| |||||||| ||||
Sbjct: 21891 gatccgtagccaacaagga 21873
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  204 bits (103), Expect = 2e-49
 Identities = 175/199 (87%)
 Strand = Plus / Minus

                                                                            
Query: 209      tccttcttagaggtatggatggcggtaaccgtggagaccatggaatcgacaccgcacttg 268
                ||||| || |||||||||||||| || || | ||||||||||||||| ||||||||||||
Sbjct: 14184305 tcctttttggaggtatggatggcagtcactgaggagaccatggaatcaacaccgcacttg 14184246

                                                                            
Query: 269      tttttgacatgtggacccctgcagatcttgtagtacccgctctcgccccagttctcgccc 328
                || ||| |||| || |||||||||||||||||||||||  |||| |||||||||||||||
Sbjct: 14184245 ttcttgtcatgaggtcccctgcagatcttgtagtaccccttctccccccagttctcgccc 14184186

                                                                            
Query: 329      catgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgtaaccagct 388
                || |||||||| ||||||||||| || |||||||||||||||| ||||||||| || || 
Sbjct: 14184185 cacgagttcttgatgatccagtacggcttctccttgaagcggatcggtgcgtatcctgcc 14184126

                                   
Query: 389      gatccatagccaaccagga 407
                ||||| |||||||| ||||
Sbjct: 14184125 gatccgtagccaacaagga 14184107
to top
>dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023111H18, full
            insert sequence
          Length = 1981

 Score =  204 bits (103), Expect = 2e-49
 Identities = 175/199 (87%)
 Strand = Plus / Minus

                                                                        
Query: 209  tccttcttagaggtatggatggcggtaaccgtggagaccatggaatcgacaccgcacttg 268
            ||||| || |||||||||||||| || || | ||||||||||||||| ||||||||||||
Sbjct: 1707 tcctttttggaggtatggatggcagtcactgaggagaccatggaatcaacaccgcacttg 1648

                                                                        
Query: 269  tttttgacatgtggacccctgcagatcttgtagtacccgctctcgccccagttctcgccc 328
            || ||| |||| || |||||||||||||||||||||||  |||| |||||||||||||||
Sbjct: 1647 ttcttgtcatgaggtcccctgcagatcttgtagtaccccttctccccccagttctcgccc 1588

                                                                        
Query: 329  catgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgtaaccagct 388
            || |||||||| ||||||||||| || |||||||||||||||| ||||||||| || || 
Sbjct: 1587 cacgagttcttgatgatccagtacggcttctccttgaagcggatcggtgcgtatcctgcc 1528

                               
Query: 389  gatccatagccaaccagga 407
            ||||| |||||||| ||||
Sbjct: 1527 gatccgtagccaacaagga 1509
to top
>dbj|AK071948.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013078J21, full
            insert sequence
          Length = 1334

 Score =  196 bits (99), Expect = 4e-47
 Identities = 174/199 (87%)
 Strand = Plus / Minus

                                                                        
Query: 209  tccttcttagaggtatggatggcggtaaccgtggagaccatggaatcgacaccgcacttg 268
            ||||| || |||||||||||||| || || | ||||||||||||||| ||||||||||||
Sbjct: 1150 tcctttttggaggtatggatggcagtcactgaggagaccatggaatcaacaccgcacttg 1091

                                                                        
Query: 269  tttttgacatgtggacccctgcagatcttgtagtacccgctctcgccccagttctcgccc 328
            || ||| |||| || |||||||||||||||||||||||  |||| |||||||||||||||
Sbjct: 1090 ttcttgtcatgaggtcccctgcagatcttgtagtaccccttctccccccagttctcgccc 1031

                                                                        
Query: 329  catgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgtaaccagct 388
            |  |||||||| ||||||||||| || |||||||||||||||| ||||||||| || || 
Sbjct: 1030 cgcgagttcttgatgatccagtacggcttctccttgaagcggatcggtgcgtatcctgcc 971

                               
Query: 389  gatccatagccaaccagga 407
            ||||| |||||||| ||||
Sbjct: 970  gatccgtagccaacaagga 952
to top
>gb|AY841792.1| Triticum aestivum cysteine protease (CP) mRNA, complete cds
          Length = 1525

 Score =  127 bits (64), Expect = 3e-26
 Identities = 120/136 (88%), Gaps = 2/136 (1%)
 Strand = Plus / Minus

                                                                        
Query: 236  accgtggagaccatggaatcgacaccgcacttgtttttgacatgtgga-cccctgcagat 294
            ||||||||||||||||| ||||| ||||||||||||   || | |||| |||||||||||
Sbjct: 1196 accgtggagaccatggagtcgacgccgcacttgtttcgcacgt-tggagcccctgcagat 1138

                                                                        
Query: 295  cttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatccagtatgg 354
            ||||||||| ||  | || |||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 1137 cttgtagtaacccttgtccccccagttctcgccccatgagttcttgatgatccagtaggg 1078

                            
Query: 355  tttctccttgaagcgg 370
             |||||||||||||||
Sbjct: 1077 cttctccttgaagcgg 1062
to top
>tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for putative cysteine proteinase
            precursor (sf42 gene)
          Length = 1438

 Score =  127 bits (64), Expect = 3e-26
 Identities = 120/136 (88%), Gaps = 2/136 (1%)
 Strand = Plus / Minus

                                                                        
Query: 236  accgtggagaccatggaatcgacaccgcacttgtttttgacatgtgga-cccctgcagat 294
            ||||||||||||||||| ||||| |||||||||||    || | |||| |||||||||||
Sbjct: 1129 accgtggagaccatggagtcgacgccgcacttgttgcgcacgt-tggagcccctgcagat 1071

                                                                        
Query: 295  cttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatccagtatgg 354
            ||||||||||||  | || ||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 1070 cttgtagtaccccttgtccccccagttctcgccccacgagttcttgatgatccagtatgg 1011

                            
Query: 355  tttctccttgaagcgg 370
             |||||||||||||||
Sbjct: 1010 cttctccttgaagcgg 995
to top
>gb|AF411121.1| Sandersonia aurantiaca cysteine proteinase precursor (PRT22) mRNA,
            partial cds
          Length = 1310

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Minus

                                                                        
Query: 287  ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
            ||||| ||||||||||| ||| |||| ||||||||||| |||||||||||||| ||||||
Sbjct: 1016 ctgcaaatcttgtagtatccgttctctccccagttctctccccatgagttcttgatgatc 957

                                                              
Query: 347  cagtatggtttctccttgaagcggagcggtgcgtaaccagctgatccata 396
            |||||||| || |||||||||||||  |||||  |||||||||| |||||
Sbjct: 956  cagtatggcttttccttgaagcggattggtgcaaaaccagctgagccata 907
to top
>gb|BT008950.1| Triticum aestivum clone wdk1c.pk009.j19:fis, full insert mRNA
           sequence
          Length = 935

 Score =  109 bits (55), Expect = 7e-21
 Identities = 115/135 (85%)
 Strand = Plus / Minus

                                                                       
Query: 236 accgtggagaccatggaatcgacaccgcacttgtttttgacatgtggacccctgcagatc 295
           ||||||||||||||||| ||||| || ||||||||    || |  |  ||||||||||||
Sbjct: 610 accgtggagaccatggagtcgacgccacacttgttgcgcacgttcgagcccctgcagatc 551

                                                                       
Query: 296 ttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatccagtatggt 355
           |||||||| ||  | || |||||||||||||||||||||||||| ||||||||||| || 
Sbjct: 550 ttgtagtaacccttgtccccccagttctcgccccatgagttcttgatgatccagtagggc 491

                          
Query: 356 ttctccttgaagcgg 370
           |||||||||||||||
Sbjct: 490 ttctccttgaagcgg 476
to top
>emb|AJ844006.1| Plantago major partial mRNA for cysteine protease 2 (cpr2 gene)
          Length = 967

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                       
Query: 284 cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
           |||||||||||||||||||| |||||||| |||||| |||| |||||||| |||||||||
Sbjct: 673 cccctgcagatcttgtagtagccgctctctccccagctctctccccatgaattctttatg 614

                      
Query: 344 atccagtatgg 354
           |||||||||||
Sbjct: 613 atccagtatgg 603
to top
>gb|AF242373.1|AF242373 Ipomoea batatas cysteine protease (SPCP2) mRNA, complete cds
          Length = 1195

 Score =  101 bits (51), Expect = 2e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||| ||||||||||||||||||  |||| |||||| |||||||||| |||||||| |
Sbjct: 1038 gaccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttga 979

                               
Query: 342  tgatccagtatggtttctc 360
            |||||||||||||||||||
Sbjct: 978  tgatccagtatggtttctc 960
to top
>gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence
          Length = 1131

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gagaccatggaatcgacaccgcacttgtttttgacatgtggacccctgcagatcttgtag 301
           ||||||||||||||||| |||||||||||    || |  | ||||||||| |||||||||
Sbjct: 796 gagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctgcatatcttgtag 737

                                                             
Query: 302 tacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
           || ||| |||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 736 tatccgttctccccccagttctcgccccacgagttcttgatgatccagta 687
to top
>emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase
          Length = 693

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gagaccatggaatcgacaccgcacttgtttttgacatgtggacccctgcagatcttgtag 301
           ||||||||||||||||| |||||||||||    || |  | ||||||||| |||||||||
Sbjct: 404 gagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctgcatatcttgtag 345

                                                             
Query: 302 tacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
           || ||| |||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 344 tatccgttctccccccagttctcgccccacgagttcttgatgatccagta 295
to top
>gb|AY104312.1| Zea mays PCO074362 mRNA sequence
          Length = 2610

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                        
Query: 242  gagaccatggaatcgacaccgcacttgtttttgacatgtggacccctgcagatcttgtag 301
            ||||||||||||||||| |||||||||||    || |  | ||||||||| |||||||||
Sbjct: 1166 gagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctgcatatcttgtag 1107

                                                              
Query: 302  tacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
            || ||| |||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 1106 tatccgttctccccccagttctcgccccacgagttcttgatgatccagta 1057
to top
>dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP, complete cds
          Length = 1311

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                        
Query: 242  gagaccatggaatcgacaccgcacttgtttttgacatgtggacccctgcagatcttgtag 301
            ||||||||||||||||| |||||||||||    || |  | ||||||||| |||||||||
Sbjct: 1105 gagaccatggaatcgacgccgcacttgttgcgaacgttggaacccctgcatatcttgtag 1046

                                                              
Query: 302  tacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
            || ||| |||| ||||||||||||||||| |||||||| |||||||||||
Sbjct: 1045 tatccgttctccccccagttctcgccccacgagttcttgatgatccagta 996
to top
>gb|AF138266.1|AF138266 Ipomoea batatas papain-like cysteine proteinase isoform III
            (IBPCPIII) mRNA, complete cds
          Length = 1144

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||| ||||||||||||||||||  |||| |||||| |||||||||| |||||||| |
Sbjct: 1048 gaccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttga 989

                            
Query: 342  tgatccagtatggttt 357
            ||||||||||||||||
Sbjct: 988  tgatccagtatggttt 973
to top
>gb|AF138265.1|AF138265 Ipomoea batatas papain-like cysteine proteinase isoform II (IBPCPII)
            mRNA, complete cds
          Length = 1143

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||| ||||||||||||||||||  |||| |||||| |||||||||| |||||||| |
Sbjct: 1048 gaccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttga 989

                            
Query: 342  tgatccagtatggttt 357
            ||||||||||||||||
Sbjct: 988  tgatccagtatggttt 973
to top
>gb|AF138264.1|AF138264 Ipomoea batatas papain-like cysteine proteinase isoform I (IBPCPI)
            mRNA, complete cds
          Length = 1149

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||| ||||||||||||||||||  |||| |||||| |||||||||| |||||||| |
Sbjct: 1054 gaccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttga 995

                            
Query: 342  tgatccagtatggttt 357
            ||||||||||||||||
Sbjct: 994  tgatccagtatggttt 979
to top
>gb|AF216785.1|AF216785 Ipomoea batatas papain-like cysteine proteinase isoform III (PCPIII)
            gene, complete cds
          Length = 1473

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||| ||||||||||||||||||  |||| |||||| |||||||||| |||||||| |
Sbjct: 1377 gaccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttga 1318

                            
Query: 342  tgatccagtatggttt 357
            ||||||||||||||||
Sbjct: 1317 tgatccagtatggttt 1302
to top
>gb|AF216784.1|AF216784 Ipomoea batatas papain-like cysteine proteinase isoform II (PCPII)
            gene, complete cds
          Length = 1483

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||| ||||||||||||||||||  |||| |||||| |||||||||| |||||||| |
Sbjct: 1388 gaccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttga 1329

                            
Query: 342  tgatccagtatggttt 357
            ||||||||||||||||
Sbjct: 1328 tgatccagtatggttt 1313
to top
>gb|AF216783.1|AF216783 Ipomoea batatas papain-like cysteine proteinase isoform I (PCPI)
            gene, complete cds
          Length = 1474

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||| ||||||||||||||||||  |||| |||||| |||||||||| |||||||| |
Sbjct: 1379 gaccccggcagatcttgtagtacccattctctccccagctctcgccccacgagttcttga 1320

                            
Query: 342  tgatccagtatggttt 357
            ||||||||||||||||
Sbjct: 1319 tgatccagtatggttt 1304
to top
>gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS3) mRNA, complete
            cds
          Length = 1286

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||| ||  |||| |||||| |||| ||||| ||||||||||||
Sbjct: 1007 cccctgcagatcttgtagtaaccattctccccccaggtctcaccccacgagttctttatg 948

                                                                       
Query: 344  atccagtatggtttctccttgaagcggagcggtgcgtaaccagctgatccatagccaac 402
            |||||||| || |||||||| | ||| |  || || || ||||| ||||||||||||||
Sbjct: 947  atccagtacggcttctccttcaggcgtattggcgcatagccagcagatccatagccaac 889
to top
>emb|X03971.1|CPCPROR Carica papaya mRNA 3'region for cysteine proteinase (pLBPc13)
          Length = 444

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
           ||||||||||||||||||| || ||| |||| |||||||| || |||||||| |||||||
Sbjct: 226 gacccctgcagatcttgtaatatccgttctctccccagttttctccccatgaattcttta 167

                                                                  
Query: 342 tgatccagtatggtttctccttgaagcggagcggtgcgtaaccagctgatccata 396
           ||| ||||||||| |||||||| |  ||||  || ||||| |||||||| |||||
Sbjct: 166 tgacccagtatggcttctccttcagtcggatgggcgcgtagccagctgaaccata 112
to top
>gb|AF462226.1| Narcissus pseudonarcissus putative cysteine proteinase mRNA,
           partial cds
          Length = 631

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 282 gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
           ||||| |||||||||||||||| ||  |||| ||||| ||||||||||| |||||||| |
Sbjct: 343 gacccttgcagatcttgtagtaacccttctcaccccaattctcgccccacgagttcttga 284

                                         
Query: 342 tgatccagtatggtttctccttgaagcgga 371
           ||||||||||||| || |||||||| ||||
Sbjct: 283 tgatccagtatggcttttccttgaatcgga 254
to top
>ref|XM_507484.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1523

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1090 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1031

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1030 atccagta 1023
to top
>ref|XM_507483.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1480

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1092 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1033

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1032 atccagta 1025
to top
>ref|XM_465566.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1386

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1093 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1034

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1033 atccagta 1026
to top
>ref|XM_507482.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1504

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1094 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1035

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1034 atccagta 1027
to top
>ref|XM_506801.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1371_D04.6 mRNA
          Length = 1486

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1098 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1039

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1038 atccagta 1031
to top
>dbj|AK061947.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-E05, full
            insert sequence
          Length = 1504

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1094 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1035

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1034 atccagta 1027
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                            
Query: 284      cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
                |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 15994598 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 15994539

                        
Query: 344      atccagta 351
                ||||||||
Sbjct: 15994538 atccagta 15994531
to top
>dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1371_D04
          Length = 105468

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                         
Query: 284   cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
             |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 25533 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 25474

                     
Query: 344   atccagta 351
             ||||||||
Sbjct: 25473 atccagta 25466
to top
>dbj|AK099269.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020I09, full
            insert sequence
          Length = 1385

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1092 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1033

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1032 atccagta 1025
to top
>dbj|AK098908.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F17, full
            insert sequence
          Length = 1480

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1092 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1033

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1032 atccagta 1025
to top
>dbj|AK071907.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013063O07, full
            insert sequence
          Length = 1486

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||||||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1098 cccctgcagatcttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1039

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1038 atccagta 1031
to top
>gb|AF007215.1|AF007215 Lavatera thuringiaca stress-induced cysteine proteinase (LtCyp1)
           mRNA, partial cds
          Length = 824

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
           |||| |||||||||||||| || |||  ||| ||||||||  | |||||||| |||||||
Sbjct: 463 gacctctgcagatcttgtaatatccgtcctctccccagtttgctccccatgaattcttta 404

                                                                       
Query: 342 tgatccagtatggtttctccttgaagcggagcggtgcgtaaccagctgatccatagccaa 401
           |||||||| | || || ||||| ||||||| ||||||||||||||| | |||||| || |
Sbjct: 403 tgatccagaaaggcttttccttaaagcggaccggtgcgtaaccagcagctccatacccta 344

               
Query: 402 ccag 405
           ||||
Sbjct: 343 ccag 340
to top
>dbj|AK119670.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-149-H07, full
            insert sequence
          Length = 1523

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            |||||||||| ||||||||||||   ||| ||||||||||||||||| |||||||| |||
Sbjct: 1090 cccctgcagaccttgtagtacccatgctctccccagttctcgccccaggagttcttgatg 1031

                    
Query: 344  atccagta 351
            ||||||||
Sbjct: 1030 atccagta 1023
to top
>gb|AY662991.1| Petunia x hybrida cysteine proteinase (CP5) mRNA, partial cds
          Length = 643

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 290 cagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatccag 349
           ||||||||||| || || || || ||||| ||||| |||||||||||||| |||||||||
Sbjct: 503 cagatcttgtaatatccactttctccccatttctctccccatgagttcttgatgatccag 444

                      
Query: 350 tatggtttctc 360
           |||||||||||
Sbjct: 443 tatggtttctc 433
to top
>gb|BT014429.1| Lycopersicon esculentum clone 133747F, mRNA sequence
          Length = 1246

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                        
Query: 287  ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
            |||||||| |||||||| || || || ||||| ||||| |||||||||||||| ||||||
Sbjct: 1059 ctgcagattttgtagtatccactttctccccatttctctccccatgagttcttgatgatc 1000

                          
Query: 347  cagtatggtttctc 360
            ||||| ||||||||
Sbjct: 999  cagtacggtttctc 986
to top
>dbj|AB161375.1| Aster tripolium CysP mRNA for cysteine protease, complete cds
          Length = 1191

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 314  ccccagttctcgccccatgagttctttatgatccagtatggtttctccttgaa 366
            ||||||| ||| |||||||||||||| |||||||||||||| |||||||||||
Sbjct: 1005 ccccagtcctctccccatgagttcttgatgatccagtatggcttctccttgaa 953
to top
>gb|AY800120.1| Populus tomentosa cysteine proteinase (CP) mRNA, complete cds
          Length = 1143

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            ||||||||||||| |||||| | ||  |||| |||||| | || |||||||||||||| |
Sbjct: 1060 gacccctgcagattttgtagaatccattctctccccagctttctccccatgagttcttga 1001

                                  
Query: 342  tgatccagtatggtttctcctt 363
            | ||||||||||| ||||||||
Sbjct: 1000 taatccagtatggcttctcctt 979
to top
>emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp41)
          Length = 1376

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||| ||||||||||||||||| ||  || | ||||||||||| ||||| |||||||| |
Sbjct: 1036 gacctctgcagatcttgtagtatccattccctccccagttctccccccacgagttcttga 977

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 976  tgatccagta 967
to top
>dbj|AP006110.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT39G11, TM0195b,
             complete sequence
          Length = 52245

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                         
Query: 287   ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
             |||||||||||||| || ||  |||| |||||| |||| |||||||| ||||||||||||
Sbjct: 25944 ctgcagatcttgtaatatccattctctccccaggtctccccccatgaattctttatgatc 26003

                  
Query: 347   cagta 351
             |||||
Sbjct: 26004 cagta 26008
to top
>gb|AF082181.1|AF082181 Solanum melongena cysteine proteinase precursor, mRNA, complete cds
          Length = 1426

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            ||||||||||||||||||| || |||   || ||||||||||| ||||| || ||||| |
Sbjct: 1048 gacccctgcagatcttgtaataaccgtgttctccccagttctctccccaagaattcttga 989

                                    
Query: 342  tgatccagtatggtttctccttga 365
            |||||||||| || || |||||||
Sbjct: 988  tgatccagtaaggcttttccttga 965
to top
>gb|AY373974.1| Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds
          Length = 1309

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 284  cccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatg 343
            ||||||||||||||||| || ||   ||| |||||||| || ||||| || ||||| |||
Sbjct: 1062 cccctgcagatcttgtaatatccttcctctccccagttttctccccaagaattcttgatg 1003

                                   
Query: 344  atccagtatggtttctccttgaa 366
            ||||||||||| || ||||||||
Sbjct: 1002 atccagtatggcttgtccttgaa 980
to top
>dbj|AB090880.1| Aster tripolium mRNA for thiol protease, complete cds
          Length = 910

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                       
Query: 282 gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
           |||| ||||| ||||||||||| ||   ||| ||||||| |   ||||||||||||||||
Sbjct: 645 gaccactgcaaatcttgtagtatccatcctctccccagtccggtccccatgagttcttta 586

                                                                       
Query: 342 tgatccagtatggtttctccttgaagcggagcggtgcgtaaccagctgatccatagccaa 401
           ||||||| ||||| |||||||| |  | |   ||||| ||||| ||||||||||| ||||
Sbjct: 585 tgatccaatatggcttctcctttagtctgctaggtgcataaccggctgatccatacccaa 526

              
Query: 402 cca 404
           |||
Sbjct: 525 cca 523
to top
>emb|Z13964.1|NTCYP8 N.tabacum mRNA for pre-pro-cysteine proteinase
          Length = 1330

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||||||| |||||||| || ||   ||| ||||||||||| |||||||| ||||| |
Sbjct: 1048 gacccctgcaaatcttgtaatatccatgctctccccagttctctccccatgaattcttga 989

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 988  tgatccagta 979
to top
>emb|Z13959.1|NTCYP7 N.tabacum mRNA for pre-pro-cysteine proteinase
          Length = 1304

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||||||| |||||||| || ||   ||| ||||||||||| |||||||| ||||| |
Sbjct: 1027 gacccctgcaaatcttgtaatatccatgctctccccagttctctccccatgaattcttga 968

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 967  tgatccagta 958
to top
>dbj|AB038598.1| Vigna mungo mRNA for cysteine protease, complete cds
          Length = 1424

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||| ||||||||||||||||| ||  |||| |||||| |||| ||||| || ||||| |
Sbjct: 1039 gacctctgcagatcttgtagtatccattctctccccagctctccccccacgaattcttaa 980

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 979  tgatccagta 970
to top
>emb|AJ496571.2|HVU496571 Hordeum vulgare partial mRNA for putative cysteine proteinase (sf42
           gene)
          Length = 397

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 76/89 (85%), Gaps = 2/89 (2%)
 Strand = Plus / Minus

                                                                       
Query: 236 accgtggagaccatggaatcgacaccgcacttgtttttgacatgtgga-cccctgcagat 294
           ||||||||||||||||| ||||| |||||||||||    || | |||| |||||||||||
Sbjct: 88  accgtggagaccatggagtcgacgccgcacttgttgcgcacgt-tggagcccctgcagat 30

                                        
Query: 295 cttgtagtacccgctctcgccccagttct 323
           ||||||||||||  | || ||||||||||
Sbjct: 29  cttgtagtaccccttgtccccccagttct 1
to top
>gb|U71380.1|GMU71380 Glycine max thiol protease isoform A mRNA, partial cds
          Length = 1221

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 309 tctcgccccagttctcgccccatgagttctttatgatccagtatggttt 357
           |||| |||||| ||||||||||||| ||||| ||||||||||| |||||
Sbjct: 862 tctctccccagctctcgccccatgaattcttaatgatccagtaaggttt 814
to top
>gb|U71379.1|GMU71379 Glycine max thiol protease isoform B mRNA, partial cds
          Length = 1073

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 309 tctcgccccagttctcgccccatgagttctttatgatccagtatggttt 357
           |||| |||||| ||||||||||||| ||||| ||||||||||| |||||
Sbjct: 869 tctctccccagctctcgccccatgaattcttaatgatccagtaaggttt 821
to top
>ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDRATION 19);
            cysteine-type peptidase AT4G39090 (RD19) mRNA, complete
            cds
          Length = 2514

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 321  tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
            |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 1156 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 1097

                                    
Query: 381  aaccagctgatccatagccaacca 404
            |||| || | ||||||||||||||
Sbjct: 1096 aacctgccgctccatagccaacca 1073
to top
>ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, complete cds
          Length = 4147

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                        
Query: 321  tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
            |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 3731 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 3790

                                    
Query: 381  aaccagctgatccatagccaacca 404
            |||| || | ||||||||||||||
Sbjct: 3791 aacctgccgctccatagccaacca 3814
to top
>gb|AY919605.1| Theileria orientalis cysteine protease 1 gene, complete cds
          Length = 1431

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 309  tctcgccccagttctcgccccatgagttctttatgatccagtat 352
            |||| ||||||||||| |||||||||||||| |||| |||||||
Sbjct: 1258 tctctccccagttctctccccatgagttcttgatgacccagtat 1215
to top
>gb|AY662989.1| Petunia x hybrida cysteine proteinase (CP3) mRNA, partial cds
          Length = 1041

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
           ||||||||||||||||||| || ||   ||| |||||| |||| ||||| || ||||| |
Sbjct: 705 gacccctgcagatcttgtaatatccttgctctccccagctctctccccaagaattcttga 646

                                   
Query: 342 tgatccagtatggtttctccttga 365
           |||||||||| || || |||||||
Sbjct: 645 tgatccagtaaggcttttccttga 622
to top
>gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cysteine proteinase RD19A
            (At4g39090) mRNA, complete cds
          Length = 1138

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 321  tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
            |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 1000 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 941

                                    
Query: 381  aaccagctgatccatagccaacca 404
            |||| || | ||||||||||||||
Sbjct: 940  aacctgccgctccatagccaacca 917
to top
>gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase RD19A (At4g39090)
            mRNA, complete cds
          Length = 1249

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 321  tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
            |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 1009 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 950

                                    
Query: 381  aaccagctgatccatagccaacca 404
            |||| || | ||||||||||||||
Sbjct: 949  aacctgccgctccatagccaacca 926
to top
>emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 90
          Length = 198987

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                          
Query: 321    tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
              |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 130088 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 130147

                                      
Query: 381    aaccagctgatccatagccaacca 404
              |||| || | ||||||||||||||
Sbjct: 130148 aacctgccgctccatagccaacca 130171
to top
>emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, BAC clone F19H22 (ESSA project)
          Length = 100469

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                         
Query: 321   tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
             |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 92078 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 92137

                                     
Query: 381   aaccagctgatccatagccaacca 404
             |||| || | ||||||||||||||
Sbjct: 92138 aacctgccgctccatagccaacca 92161
to top
>dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible cysteine proteinase
           RD19A precursor, complete cds, clone: RAFL22-25-O05
          Length = 399

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
           |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 165 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 106

                                   
Query: 381 aaccagctgatccatagccaacca 404
           |||| || | ||||||||||||||
Sbjct: 105 aacctgccgctccatagccaacca 82
to top
>emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1179

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
           |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 994 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 935

                                   
Query: 381 aaccagctgatccatagccaacca 404
           |||| || | ||||||||||||||
Sbjct: 934 aacctgccgctccatagccaacca 911
to top
>emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZD12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1186

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
           |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 996 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 937

                                   
Query: 381 aaccagctgatccatagccaacca 404
           |||| || | ||||||||||||||
Sbjct: 936 aacctgccgctccatagccaacca 913
to top
>gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete sequence
          Length = 1461

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 321  tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
            |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 1156 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 1097

                                    
Query: 381  aaccagctgatccatagccaacca 404
            |||| || | ||||||||||||||
Sbjct: 1096 aacctgccgctccatagccaacca 1073
to top
>dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol protease, partial cds
          Length = 3255

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 321  tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagcggtgcgt 380
            |||| ||||| |||||||| ||||||||||| || ||||||||||| |    ||| ||||
Sbjct: 2927 tctctccccacgagttcttgatgatccagtaaggcttctccttgaacctagccggagcgt 2868

                                    
Query: 381  aaccagctgatccatagccaacca 404
            |||| || | ||||||||||||||
Sbjct: 2867 aacctgccgctccatagccaacca 2844
to top
>dbj|AB159780.1| Theileria orientalis ToCP 1 mRNA for cysteine protease 1, complete
            cds
          Length = 1547

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 309  tctcgccccagttctcgccccatgagttctttatgatccagtat 352
            |||| ||||||||||| |||||||||||||| |||| |||||||
Sbjct: 1316 tctctccccagttctctccccatgagttcttgatgacccagtat 1273
to top
>gb|AY110841.1| Zea mays CL908_1 mRNA sequence
          Length = 916

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 309 tctcgccccagttctcgccccatgagttctttatgatccagtat 352
           |||||||||| ||||||||||| |||||||| | ||||||||||
Sbjct: 636 tctcgccccacttctcgccccacgagttcttgacgatccagtat 593
to top
>gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRNA, partial cds
          Length = 171

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 309 tctcgccccagttctcgccccatgagttctttatgatccagtat 352
           |||||||||| ||||||||||| |||||||| | ||||||||||
Sbjct: 111 tctcgccccacttctcgccccacgagttcttgacgatccagtat 68
to top
>gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0026D03 map near S2137, complete sequence
          Length = 115141

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                
Query: 301   gtacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
             |||||| ||||||||||| | ||||||||| |||||||| | |||||||||
Sbjct: 34086 gtaccctctctcgccccaatcctcgccccacgagttcttgacgatccagta 34036
to top
>emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease
          Length = 1440

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 301  gtacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
            |||||| ||||||||||| | ||||||||| |||||||| | |||||||||
Sbjct: 1098 gtaccctctctcgccccaatcctcgccccacgagttcttgacgatccagta 1048
to top
>emb|AJ606072.1| Gossypium hirsutum mRNA for putative papain-like cysteine proteinase
            (paC1 gene), strain Xuzhou 142
          Length = 1317

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 93/115 (80%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||||||||||| | ||  ||||  |||| |||||||| || |||||||| ||||| |
Sbjct: 1090 gacccctgcagatcctataaaacccattctctccccagttttcaccccatgaattcttga 1031

                                                                   
Query: 342  tgatccagtatggtttctccttgaagcggagcggtgcgtaaccagctgatccata 396
            | |||||||| ||||| ||||| | ||| |  || || ||||||||||| |||||
Sbjct: 1030 taatccagtacggtttatccttcatgcgaactggagcataaccagctgaaccata 976
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                  
Query: 301     gtacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
               |||||| ||||||||||| | ||||||||| |||||||| | |||||||||
Sbjct: 8298314 gtaccctctctcgccccaatcctcgccccacgagttcttgacgatccagta 8298364
to top
>dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099K03, full
            insert sequence
          Length = 1511

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 301  gtacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
            |||||| ||||||||||| | ||||||||| |||||||| | |||||||||
Sbjct: 1104 gtaccctctctcgccccaatcctcgccccacgagttcttgacgatccagta 1054
to top
>dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene for cysteine
            endopeptidase, complete cds
          Length = 3836

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 301  gtacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
            |||||| ||||||||||| | ||||||||| |||||||| | |||||||||
Sbjct: 2620 gtaccctctctcgccccaatcctcgccccacgagttcttgacgatccagta 2570
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                  
Query: 301     gtacccgctctcgccccagttctcgccccatgagttctttatgatccagta 351
               |||||| ||||||||||| | ||||||||| |||||||| | |||||||||
Sbjct: 8369077 gtaccctctctcgccccaatcctcgccccacgagttcttgacgatccagta 8369127
to top
>emb|AJ245868.1|MSA245868 Medicago sativa mRNA for cysteine protease, partial (cyp15a gene)
          Length = 890

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 314 ccccagttctcgccccatgagttctttatgatccagta 351
           ||||| |||| ||||||||| |||||||||||||||||
Sbjct: 542 ccccaattctggccccatgaattctttatgatccagta 505
to top
>emb|AJ009878.1|CAR9878 Cicer arietinum mRNA for cysteine proteinase
          Length = 1377

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||| |||||||||||||| || ||   ||| ||||| ||||  |||||||| |||||||
Sbjct: 1027 gacctctgcagatcttgtaatatccttcctcaccccaattctgtccccatgaattcttta 968

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 967  tgatccagta 958
to top
>gb|DQ084023.1| Nicotiana benthamiana cysteine proteinase glycinain type mRNA,
            partial cds
          Length = 1086

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||| |||||||||||||| || ||   ||| ||||||||||| ||||| || ||||| |
Sbjct: 1047 gacctctgcagatcttgtaatatccatgctcaccccagttctctccccaagaattcttga 988

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 987  tgatccagta 978
to top
>gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete sequence
          Length = 125077

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                         
Query: 287   ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
             ||||| ||||||||||| ||| |||| |||||| |||| ||||| ||||| || | ||||
Sbjct: 81680 ctgcaaatcttgtagtatccgttctctccccaggtctcaccccacgagtttttaacgatc 81739

                              
Query: 347   cagtatggtttctcctt 363
             || || || ||||||||
Sbjct: 81740 caatacggcttctcctt 81756
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 311      tcgccccagttctcgccccatgagttctttatgatccagta 351
                |||||||||||||  ||||| |||||||| |||||||||||
Sbjct: 22050540 tcgccccagttcttcccccacgagttcttgatgatccagta 22050580
to top
>gb|AF454959.1| Brassica oleracea senescence-associated cysteine protease (CP4) mRNA,
            complete cds
          Length = 1253

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 72/85 (84%), Gaps = 2/85 (2%)
 Strand = Plus / Minus

                                                                        
Query: 321  tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagc-ggtgcg 379
            |||| ||||| |||||||| || |||||||| || ||||||||||| |  ||| || |||
Sbjct: 1019 tctctccccacgagttcttaataatccagtaaggcttctccttgaa-cctagcaggagcg 961

                                     
Query: 380  taaccagctgatccatagccaacca 404
            |||||||| |||||||| |||||||
Sbjct: 960  taaccagcagatccataaccaacca 936
to top
>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0635G10
          Length = 146728

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 311   tcgccccagttctcgccccatgagttctttatgatccagta 351
             |||||||||||||  ||||| |||||||| |||||||||||
Sbjct: 92604 tcgccccagttcttcccccacgagttcttgatgatccagta 92644
to top
>dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-D05, full
           insert sequence
          Length = 904

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 311 tcgccccagttctcgccccatgagttctttatgatccagta 351
           |||||||||||||  ||||| |||||||| |||||||||||
Sbjct: 617 tcgccccagttcttcccccacgagttcttgatgatccagta 577
to top
>gb|U68221.1|BNU68221 Brassica napus cysteine protease (LSC790) mRNA, partial cds
          Length = 255

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 72/85 (84%), Gaps = 2/85 (2%)
 Strand = Plus / Minus

                                                                       
Query: 321 tctcgccccatgagttctttatgatccagtatggtttctccttgaagcggagc-ggtgcg 379
           |||| ||||| |||||||| || |||||||| || ||||||||||| |  ||| || |||
Sbjct: 187 tctctccccacgagttcttaataatccagtaaggcttctccttgaa-cctagcaggagcg 129

                                    
Query: 380 taaccagctgatccatagccaacca 404
           |||||||| |||||||| |||||||
Sbjct: 128 taaccagcagatccataaccaacca 104
to top
>gb|AY919606.1| Theileria orientalis cysteine protease 3 gene, complete cds
          Length = 1431

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 309  tctcgccccagttctcgccccatgagttctttatgatccagtat 352
            |||| ||||||||||| ||||| |||||||| |||| |||||||
Sbjct: 1258 tctctccccagttctcaccccaagagttcttgatgacccagtat 1215
to top
>gb|AY912450.1| Theileria orientalis tocp1 variant tocp5 gene, partial cds
          Length = 1428

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 309  tctcgccccagttctcgccccatgagttctttatgatccagtat 352
            |||| ||||||||||| ||||| |||||||| |||| |||||||
Sbjct: 1258 tctctccccagttctcaccccaagagttcttgatgacccagtat 1215
to top
>gb|AY912448.1| Theileria orientalis tocp1 variant tocp3 mRNA, complete cds
          Length = 1559

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 309  tctcgccccagttctcgccccatgagttctttatgatccagtat 352
            |||| ||||||||||| ||||| |||||||| |||| |||||||
Sbjct: 1325 tctctccccagttctcaccccaagagttcttgatgacccagtat 1282
to top
>emb|Z32795.1|GMCYSEND G.max (Fiskeby V) mRNA for cysteine endopeptidase
          Length = 1441

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 314  ccccagttctcgccccatgagttctttatgatccagtatggttt 357
            ||||| ||||| ||||| || ||||| |||||||||||||||||
Sbjct: 1070 ccccatttctccccccacgaattcttgatgatccagtatggttt 1027
to top
>gb|AF167986.1|AF167986 Glycine max putative cysteine proteinase GmPM33 (GmPM33) mRNA,
            complete cds
          Length = 1407

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 314  ccccagttctcgccccatgagttctttatgatccagtatggttt 357
            ||||| ||||| ||||| || ||||| |||||||||||||||||
Sbjct: 1005 ccccatttctccccccacgaattcttgatgatccagtatggttt 962
to top
>gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protease mRNA, partial
           cds
          Length = 1005

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 309 tctcgccccagttctcgccccatgagttctt 339
           |||||||||||||||| ||||| ||||||||
Sbjct: 925 tctcgccccagttctcaccccacgagttctt 895
to top
>gb|DQ344624.1| Triticum aestivum vacuolar ATP synthase subunit E (VATE) mRNA,
            complete cds
          Length = 1970

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 236  accgtggagaccatggaatcgacaccgcacttgtt 270
            ||||||||||||||||| ||||| || ||||||||
Sbjct: 1918 accgtggagaccatggagtcgacgccacacttgtt 1952
to top
>gb|AF139913.1|AF139913 Trypanosoma congolense cysteine protease gene, partial cds
          Length = 1321

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 325 gccccatgagttctttatgatccagtatggt 355
           ||||||||||||||| || ||||||||||||
Sbjct: 930 gccccatgagttcttgataatccagtatggt 900
to top
>gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, complete cds
          Length = 1597

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 314  ccccagttctcgccccatgagttctt 339
            ||||||||||| ||||||||||||||
Sbjct: 1018 ccccagttctcaccccatgagttctt 993
to top
>emb|Z48736.1|LECYP3GN L.esculentum cyp-3 gene for pre-pro-cysteine proteinase
          Length = 1388

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 326 ccccatgagttctttatgatccagta 351
           ||||||||||||||||||| ||||||
Sbjct: 993 ccccatgagttctttatgagccagta 968
to top
>emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene for cysteine proteinase b
          Length = 522

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 310 ctcgccccagttctcgccccatgagttctt 339
           ||||||||||||||| ||||| ||||||||
Sbjct: 522 ctcgccccagttctcaccccacgagttctt 493
to top
>emb|AJ242994.1|NTA242994 Nicotiana tabacum mRNA for putative preprocysteine proteinase
          Length = 1431

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||||||| |||||||| || ||   ||| |||||||| || ||||| || ||||| |
Sbjct: 1101 gacccctgcaaatcttgtaatatccatgctctccccagttttctccccaagaattcttga 1042

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 1041 tgatccagta 1032
to top
>gb|AY017414.1| Nicotiana tabacum CPR2-like cysteine proteinase gene, complete cds
          Length = 2107

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 282  gacccctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttcttta 341
            |||||||||| |||||||| || ||   ||| |||||||| || ||||| || ||||| |
Sbjct: 2023 gacccctgcaaatcttgtaatatccatgctctccccagttttctccccaagaattcttga 1964

                      
Query: 342  tgatccagta 351
            ||||||||||
Sbjct: 1963 tgatccagta 1954
to top
>gb|L38514.1|TRBRANGB Trypanosoma rangeli (clone 3) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1898

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 314 ccccagttctcgccccatgagttctttatgatccagta 351
           ||||||| | ||||||| |||||||| |||||||||||
Sbjct: 149 ccccagtccgcgccccacgagttcttgatgatccagta 112
to top
>gb|L38513.1|TRBRANGA Trypanosoma rangeli (clone 2) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1905

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 314 ccccagttctcgccccatgagttctttatgatccagta 351
           ||||||| | ||||||| |||||||| |||||||||||
Sbjct: 149 ccccagtccgcgccccacgagttcttgatgatccagta 112
to top
>gb|L38512.1|TRBRANG Trypanosoma rangeli (clone 1) rangelipain gene, 3' end of cds and
           5' end of cds
          Length = 1902

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 314 ccccagttctcgccccatgagttctttatgatccagta 351
           ||||||| | ||||||| |||||||| |||||||||||
Sbjct: 149 ccccagtccgcgccccacgagttcttgatgatccagta 112
to top
>ref|XM_630282.1| Dictyostelium discoideum hypothetical protein (DDB0219654), partial
           mRNA
          Length = 1059

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 326 ccccatgagttctttatgatccagtatgg 354
           ||||||||||| || ||||||||||||||
Sbjct: 956 ccccatgagtttttaatgatccagtatgg 928
to top
>gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence
          Length = 1354

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 326  ccccatgagttctttatgatccagtatgg 354
            ||||| ||||||||||||||||| |||||
Sbjct: 1071 ccccacgagttctttatgatccaatatgg 1043
to top
>emb|AL357139.11| Human DNA sequence from clone RP11-793L10 on chromosome 6 Contains a
             pseudogene similar to part of heterogeneous nuclear
             ribonucleoprotein D (37 kD AU-rich element RNA binding
             protein 1) (HNRPD) (P37 AUF1 AUF1A hnRNP D0), complete
             sequence
          Length = 128422

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 56    aaaataccttacagcaatcaa 76
             |||||||||||||||||||||
Sbjct: 19044 aaaataccttacagcaatcaa 19064
to top
>emb|Z30338.1|VSCYSPROT V.sativa mRNA for cysteine proteinase
          Length = 1371

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 287  ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
            |||||||||||||| || ||   ||| ||||| ||||  ||||| |||||||| ||||||
Sbjct: 1064 ctgcagatcttgtaatatccctgctctccccaattctgcccccaagagttcttaatgatc 1005

                 
Query: 347  cagta 351
            |||||
Sbjct: 1004 cagta 1000
to top
>emb|X54358.1|PSCC15A P.sativum mRNA of cDNA clone 15a
          Length = 1453

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 287  ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
            |||||||||||||| || ||   ||| ||||| ||||  ||||| |||||||| ||||||
Sbjct: 1066 ctgcagatcttgtaatatccctgctctccccaattctgcccccaggagttcttaatgatc 1007

                 
Query: 347  cagta 351
            |||||
Sbjct: 1006 cagta 1002
to top
>gb|AY161277.1| Vicia faba pre-pro cysteine proteinase gene, complete cds
          Length = 3822

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 287  ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
            ||||||||||||||||| ||   ||| ||||| ||||  ||||| |||||||| | ||||
Sbjct: 3423 ctgcagatcttgtagtatccctgctctccccaattctgcccccaagagttcttaacgatc 3364

                 
Query: 347  cagta 351
            |||||
Sbjct: 3363 cagta 3359
to top
>gb|U59465.1|VFU59465 Vicia faba pre-pro-cysteine proteinase (VFCYSPRO) mRNA, complete cds
          Length = 1439

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 287  ctgcagatcttgtagtacccgctctcgccccagttctcgccccatgagttctttatgatc 346
            ||||||||||||||||| ||   ||| ||||| ||||  ||||| |||||||| | ||||
Sbjct: 1040 ctgcagatcttgtagtatccctgctctccccaattctgcccccaagagttcttaacgatc 981

                 
Query: 347  cagta 351
            |||||
Sbjct: 980  cagta 976
to top
>gb|AY713477.2| Cryptobia salmositica cysteine proteinase (CYS) gene, complete cds
          Length = 1419

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 gagttctttatgatccagta 351
           ||||||||||||||||||||
Sbjct: 893 gagttctttatgatccagta 874
to top
>gb|AC138715.3| Mus musculus BAC clone RP23-283E23 from chromosome 15, complete
             sequence
          Length = 164806

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 327   cccatgagttctttatgatc 346
             ||||||||||||||||||||
Sbjct: 92032 cccatgagttctttatgatc 92013
to top
>gb|AC103574.7| Rattus norvegicus 1 BAC CH230-205C19 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 199047

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    ctaccatgttccaagaactg 35
             ||||||||||||||||||||
Sbjct: 54487 ctaccatgttccaagaactg 54468
to top
>emb|Z99955.1|PVZ99955 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp4)
          Length = 1286

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 326  ccccatgagttctttatgatccagtatggttt 357
            ||||| || ||||| |||||||||||||||||
Sbjct: 1019 ccccacgaattcttgatgatccagtatggttt 988
to top
>emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine proteinase
          Length = 5593

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 324  cgccccatgagttctttatgatccagta 351
            ||||||| |||||||| |||||||||||
Sbjct: 4814 cgccccacgagttcttcatgatccagta 4787
to top
>emb|X99936.1|ZMSEE1 Z.mays mRNA for cysteine proteinase, See1
          Length = 1412

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 324  cgccccatgagttctttatgatccagta 351
            |||||||||||||||| |||| ||||||
Sbjct: 1053 cgccccatgagttcttgatgagccagta 1026
to top
>gb|AC025366.11| Homo sapiens chromosome 8, clone RP11-238I10, complete sequence
          Length = 157390

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 38     tagtaagatatacatagtaaaata 61
              |||||||||||| |||||||||||
Sbjct: 110426 tagtaagatatatatagtaaaata 110449
to top
>gb|AY090898.1| Cryptobia salmositica 49 kDa cysteine proteinase Cysp1 mRNA,
           complete cds
          Length = 1287

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 gagttctttatgatccagta 351
           ||||||||||||||||||||
Sbjct: 848 gagttctttatgatccagta 829
to top
>emb|X55436.1|BTINAG B. thuringiensis InA gene for immune inhibitor A
          Length = 2712

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  tgatccagtatggtttctcc 361
            ||||||||||||||||||||
Sbjct: 1821 tgatccagtatggtttctcc 1802
to top
>gb|AY111351.1| Zea mays CL1876_2 mRNA sequence
          Length = 532

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 324 cgccccatgagttctttatgatccagta 351
           |||||||||||||||| |||| ||||||
Sbjct: 154 cgccccatgagttcttgatgagccagta 127
to top
>gb|AY106223.1| Zea mays PCO114759 mRNA sequence
          Length = 1532

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 324  cgccccatgagttctttatgatccagta 351
            |||||||||||||||| |||| ||||||
Sbjct: 1075 cgccccatgagttcttgatgagccagta 1048
to top
>emb|AL606904.12| Mouse DNA sequence from clone RP23-182D20 on chromosome 4, complete
              sequence
          Length = 172024

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 13     ctactaccatgttccaagaactgc 36
              ||||| ||||||||||||||||||
Sbjct: 108235 ctactgccatgttccaagaactgc 108212
to top
>emb|AL583884.20| Mouse DNA sequence from clone RP23-324B16 on chromosome 15, complete
             sequence
          Length = 202342

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   agatcctattccttcttaga 219
             ||||||||||||||||||||
Sbjct: 10541 agatcctattccttcttaga 10560
to top
>gb|L25130.1|TRBACYSPRO Trypanosoma congolense cysteine protease mRNA, complete cds
          Length = 1704

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 328  ccatgagttctttatgatccagtatggt 355
            |||||||||||| || ||||||||||||
Sbjct: 1062 ccatgagttcttgataatccagtatggt 1035
to top
>dbj|D45403.1|MZECYPA Corn mRNA for cysteine proteinase, clone CCP2, complete cds
          Length = 1382

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 324  cgccccatgagttctttatgatccagta 351
            |||||||||||||||| |||| ||||||
Sbjct: 1042 cgccccatgagttcttgatgagccagta 1015


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,158,188
Number of Sequences: 3902068
Number of extensions: 3158188
Number of successful extensions: 52554
Number of sequences better than 10.0: 122
Number of HSP's better than 10.0 without gapping: 120
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 52298
Number of HSP's gapped (non-prelim): 246
length of query: 415
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 393
effective length of database: 17,147,199,772
effective search space: 6738849510396
effective search space used: 6738849510396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top