>gb|AC007131.4| Homo sapiens BAC clone RP11-179A20 from 2, complete sequence
          Length = 160087

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     aaaccgatcactctggttt 26
             |||||||||||||||||||
Sbjct: 69178 aaaccgatcactctggttt 69160

>gb|AY152826.1| Felis catus clone BAC 102h1 major histocompatiblity complex extended
             and classical class II region, partial sequence
          Length = 132445

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 14    atcactctggttttatactaaa 35
             ||||||||||||||||| ||||
Sbjct: 31181 atcactctggttttatagtaaa 31202

>gb|AC090515.2| Homo sapiens chromosome 15 clone RP11-30K9 map 15q21.3, complete
             sequence
          Length = 181597

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    actctggttttatactaa 34
             ||||||||||||||||||
Sbjct: 36148 actctggttttatactaa 36131

>gb|AC091046.2|AC091046 Homo sapiens chromosome 15 clone RP11-123C21 map 15q21.3, complete
              sequence
          Length = 186846

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 17     actctggttttatactaa 34
              ||||||||||||||||||
Sbjct: 179150 actctggttttatactaa 179133

>ref|NM_074552.1| Caenorhabditis elegans Serpentine Receptor, class BC (class B-like)
           family member (srbc-50) (srbc-50) mRNA, complete cds
          Length = 858

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   aaaaaataaaccgatcactctg 22
           ||||||| ||||||||||||||
Sbjct: 348 aaaaaatgaaccgatcactctg 327

>gb|AC008045.5|AC008045 Homo sapiens chromosome 14q31 clone CTD-2552H2 containing neurexin III
             gene, partial cds, complete sequence
          Length = 188078

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     aaaaaataaaccgatcac 18
             ||||||||||||||||||
Sbjct: 60012 aaaaaataaaccgatcac 59995

>emb|Z93383.1|CEF54B8 Caenorhabditis elegans Cosmid F54B8, complete sequence
          Length = 28829

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     aaaaaataaaccgatcactctg 22
             ||||||| ||||||||||||||
Sbjct: 14056 aaaaaatgaaccgatcactctg 14077

>gb|AC132286.3| Mus musculus BAC clone RP24-299C19 from 1, complete sequence
          Length = 192877

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 15     tcactctggttttatactaaat 36
              |||||||||||||||| |||||
Sbjct: 142888 tcactctggttttatattaaat 142909

>emb|AL137818.4|CNS01DWP Human chromosome 14 DNA sequence BAC R-102C24 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 179714

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 14    atcactctggttttatac 31
             ||||||||||||||||||
Sbjct: 53292 atcactctggttttatac 53309

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 17      actctggttttatactaa 34
               ||||||||||||||||||
Sbjct: 2817852 actctggttttatactaa 2817869


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 422,755
Number of Sequences: 3902068
Number of extensions: 422755
Number of successful extensions: 122180
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 122148
Number of HSP's gapped (non-prelim): 32
length of query: 36
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 16
effective length of database: 17,155,003,908
effective search space: 274480062528
effective search space used: 274480062528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)