ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet65h06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 204 bits (103), Expect = 1e-49 Identities = 205/240 (85%), Gaps = 17/240 (7%) Strand = Plus / Minus Query: 65 gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 117 ||||||||||||||||||||||| || ||||||||||||||||| |||||| || Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873 Query: 118 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 177 |||||||| ||||||||||| |||||||||||||||| ||||| ||||||| Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823 Query: 178 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcncacat 237 || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| ||||| Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763 Query: 238 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||| ||||| ||||| |||| ||||||||||||||||||||||||||| ||||||||||| Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 163 bits (82), Expect = 4e-37 Identities = 99/105 (94%) Strand = Plus / Minus Query: 194 gcttagtagtcgttgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtag 253 |||||||||||||||| |||||||| |||||||| ||| ||||||||||||||||||||| Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741 Query: 254 acgatgccggcgaggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||||||||||||||||||||||| |||||||||||| Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtag 696
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 143 bits (72), Expect = 4e-31 Identities = 95/103 (92%) Strand = Plus / Minus Query: 196 ttagtagtcgttgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagac 255 |||||||||||||| |||||||| | |||||| ||| |||||||||| |||||||||||| Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742 Query: 256 gatgccggcgaggccaccgccgatgagcggcccggcccagtag 298 || ||||||||||||||||||||||||||| |||||||||||| Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtag 699
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 143 bits (72), Expect = 4e-31 Identities = 98/107 (91%) Strand = Plus / Minus Query: 192 tggcttagtagtcgttgctggcgacgggggtgtggttgtcncacatgtacaggtaccggt 251 |||||||||||||||||| |||||||| | |||||| ||| |||||||| ||||| |||| Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747 Query: 252 agacgatgccggcgaggccaccgccgatgagcggcccggcccagtag 298 |||||| ||||||||||||||||||||||||||| |||||||||||| Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtag 700
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtag 13251034
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 12875 ggccgccgccgacgagggggccgacccagtag 12844
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 168253 ggccgccgccgacgagggggccgacccagtag 168222
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 765 ggccgccgccgacgagggggccgacccagtag 734
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtag 736
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtag 736
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtag 737
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtag 735
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtag 737
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 81.8 bits (41), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtag 735
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 73.8 bits (37), Expect = 3e-10 Identities = 78/92 (84%) Strand = Plus / Minus Query: 207 tgctggcgacgggggtgtggttgtcncacatgtacaggtaccggtagacgatgccggcga 266 ||||||| ||||||| ||||| | | |||||||| | ||| |||||||||| |||||||| Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646 Query: 267 ggccaccgccgatgagcggcccggcccagtag 298 |||| ||||||| ||| || ||| |||||||| Sbjct: 645 ggccgccgccgacgagggggccgacccagtag 614
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 56.0 bits (28), Expect = 7e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 56.0 bits (28), Expect = 7e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgag 667
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Plus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgag 2544815
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgag 125279
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Plus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgag 2544925
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagtag 298 |||||||| ||| ||||| || |||||||||||||| ||| |||||||| Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtag 715
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgag 745
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgag 754
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgag 756
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgag 280
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgag 282 ||||| || |||||||||||||||||||||||| Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgag 752
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 48.1 bits (24), Expect = 0.016 Identities = 42/48 (87%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 48.1 bits (24), Expect = 0.016 Identities = 42/48 (87%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 48.1 bits (24), Expect = 0.016 Identities = 42/48 (87%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 48.1 bits (24), Expect = 0.016 Identities = 42/48 (87%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 46.1 bits (23), Expect = 0.063 Identities = 35/39 (89%) Strand = Plus / Minus Query: 260 ccggcgaggccaccgccgatgagcggcccggcccagtag 298 ||||||||||| |||||||| ||||| ||| |||||||| Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtag 645
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.063 Identities = 23/23 (100%) Strand = Plus / Minus Query: 259 gccggcgaggccaccgccgatga 281 ||||||||||||||||||||||| Sbjct: 505313 gccggcgaggccaccgccgatga 505291 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 gccggcgaggccaccgccga 278 |||||||||||||||||||| Sbjct: 1274146 gccggcgaggccaccgccga 1274165
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 46.1 bits (23), Expect = 0.063 Identities = 35/39 (89%) Strand = Plus / Plus Query: 260 ccggcgaggccaccgccgatgagcggcccggcccagtag 298 ||||||||||| |||||||| ||||| ||| |||||||| Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtag 26627221
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 46.1 bits (23), Expect = 0.063 Identities = 35/39 (89%) Strand = Plus / Plus Query: 260 ccggcgaggccaccgccgatgagcggcccggcccagtag 298 ||||||||||| |||||||| ||||| ||| |||||||| Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtag 169602
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 46.1 bits (23), Expect = 0.063 Identities = 35/39 (89%) Strand = Plus / Plus Query: 260 ccggcgaggccaccgccgatgagcggcccggcccagtag 298 ||||||||||| |||||||| ||||| ||| |||||||| Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtag 61382
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 46.1 bits (23), Expect = 0.063 Identities = 35/39 (89%) Strand = Plus / Minus Query: 260 ccggcgaggccaccgccgatgagcggcccggcccagtag 298 ||||||||||| |||||||| ||||| ||| |||||||| Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtag 718
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 46.1 bits (23), Expect = 0.063 Identities = 35/39 (89%) Strand = Plus / Minus Query: 260 ccggcgaggccaccgccgatgagcggcccggcccagtag 298 ||||||||||| |||||||| ||||| ||| |||||||| Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtag 520
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 46.1 bits (23), Expect = 0.063 Identities = 29/31 (93%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatg 280 ||||| || |||||||||||||||||||||| Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 46.1 bits (23), Expect = 0.063 Identities = 35/39 (89%) Strand = Plus / Minus Query: 260 ccggcgaggccaccgccgatgagcggcccggcccagtag 298 ||||||||||| |||||||| ||||| ||| |||||||| Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtag 250613
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 44.1 bits (22), Expect = 0.25 Identities = 43/50 (86%) Strand = Plus / Minus Query: 248 cggtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 ||||||||||| ||||| ||||| || |||||||| || ||| ||||||| Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagta 726
>gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds Length = 993 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 ccgatgagcggcccggcccagtag 298 |||||||| ||||||||||||||| Sbjct: 724 ccgatgagaggcccggcccagtag 701
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence Length = 121598 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 ggcatcatggaaaccaaaca 170 |||||||||||||||||||| Sbjct: 113843 ggcatcatggaaaccaaaca 113824
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 gccaccgccgatgagcggcc 287 |||||||||||||||||||| Sbjct: 4960396 gccaccgccgatgagcggcc 4960415
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 gccggcgaggccaccgccga 278 |||||||||||||||||||| Sbjct: 4535021 gccggcgaggccaccgccga 4535040
>gb|AE012073.1| Xanthomonas axonopodis pv. citri str. 306, section 451 of 469 of the complete genome Length = 11201 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 gccaccgccgatgagcggcc 287 |||||||||||||||||||| Sbjct: 3079 gccaccgccgatgagcggcc 3098
>gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putative aquaporin TIP3 (TIP3) mRNA, complete cds Length = 1133 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 ccgatgagcggcccggcccagtag 298 |||||||| ||||||||||||||| Sbjct: 744 ccgatgagaggcccggcccagtag 721
>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete sequence Length = 222430 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 tctgaaccaaacaacatgac 91 |||||||||||||||||||| Sbjct: 111593 tctgaaccaaacaacatgac 111574
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 261 cggcgaggccaccgccgatg 280 |||||||||||||||||||| Sbjct: 1656225 cggcgaggccaccgccgatg 1656206
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 40.1 bits (20), Expect = 3.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 250 gtagacgatgccggcgaggccaccgccgatgagcggcccggcccagta 297 |||||||| ||||||||||| || || ||||| |||||| ||||||| Sbjct: 44922 gtagacgagcccggcgaggccgccaccaatgagtggcccgacccagta 44875
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region locus, strain C57BL/6 Length = 2500000 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 tctgaaccaaacaacatgac 91 |||||||||||||||||||| Sbjct: 1893522 tctgaaccaaacaacatgac 1893503 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,268,672 Number of Sequences: 3902068 Number of extensions: 2268672 Number of successful extensions: 40555 Number of sequences better than 10.0: 51 Number of HSP's better than 10.0 without gapping: 51 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 40239 Number of HSP's gapped (non-prelim): 314 length of query: 298 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 276 effective length of database: 17,147,199,772 effective search space: 4732627137072 effective search space used: 4732627137072 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
