ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet65f07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 101 bits (51), Expect = 2e-18 Identities = 72/79 (91%) Strand = Plus / Minus Query: 375 cttacttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 ||||||||||||| || ||||||||||| |||||||||||||||||||||||||| || | Sbjct: 811 cttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 752 Query: 435 tgatatggtcagcgaggtt 453 ||| |||||||||||||| Sbjct: 751 cgatgtggtcagcgaggtt 733 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 303 ttcttgtaatttacatgatggtagtaca 330 |||||||||||||||| ||| ||||||| Sbjct: 889 ttcttgtaatttacatcatgatagtaca 862
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 85.7 bits (43), Expect = 1e-13 Identities = 70/79 (88%) Strand = Plus / Minus Query: 375 cttacttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| |||||||| |||||||| |||||||||||||| || |||||||||||||| || | Sbjct: 820 cttatttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcgg 761 Query: 435 tgatatggtcagcgaggtt 453 ||| |||||||||||||| Sbjct: 760 cgatgtggtcagcgaggtt 742
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 83.8 bits (42), Expect = 5e-13 Identities = 63/70 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| ||||||||||||||||| |||||||||||||||||||| ||||||| | Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgactggatcagcca 782 Query: 438 tatggtcagc 447 ||||||||| Sbjct: 781 aatggtcagc 772
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 77.8 bits (39), Expect = 3e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 375 cttacttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||||||||||||||||||||| || ||||| || |||||||||||||| Sbjct: 865 cttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggg 811
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 77.8 bits (39), Expect = 3e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 375 cttacttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| |||||||| |||||||||||||| | |||||||| ||||||||||| || |||| Sbjct: 1681 cttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcag 1622 Query: 435 tgatatggtcagcgaggtt 453 ||| |||||||||||||| Sbjct: 1621 cgatgtggtcagcgaggtt 1603
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| || |||||||||||||| ||||| ||||||||||||||||| Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggg 419
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 389 acgaagttggtggcaaatgcccatgcattgttgttgacgggatc 432 ||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacgggatc 618
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| |||||||||||||| || |||||||| ||||||||||| ||||||| | Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 571 Query: 438 tatggtcagcgaggtt 453 |||||| |||||||| Sbjct: 570 aatggtcggcgaggtt 555
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||| |||||||| ||||| || |||||||||||||| ||||||| Sbjct: 215 actttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtcagtga 156 Query: 438 tatggtcagcgaggtt 453 ||||||| || ||||| Sbjct: 155 tatggtcggcaaggtt 140
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 ||||||||||||| |||||||||||| | |||||||| |||||||||||||| Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggg 757
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1042 Score = 67.9 bits (34), Expect = 3e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| ||||||||||| ||||| ||||||||||||||||| || ||||||| | Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgttgttaactggatcagcca 815 Query: 438 tatggtcagc 447 ||||||||| Sbjct: 814 aatggtcagc 805
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 376 ttacttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||||| |||||||||||||| || ||||| ||||||||||| ||||| Sbjct: 975 ttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggg 922
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| |||||||||||||| || |||||||| ||||||||||| ||||||| Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcag 2318
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 743
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 96047 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 93253
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 78155 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 80949
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 811
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 463
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 805
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| |||||||||||||| || |||||||| ||||||||||| ||||||| Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcag 2319
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 1043
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| ||||||||||| || || |||||||||||||||||||| ||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcag 743
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||||||||| |||||||||||||| || ||||| |||||||||||||| Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgac 778
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 745
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||||||||| |||||||||||||| | ||||| || |||||||||||||| || | | Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749 Query: 438 tatggtcagcgaggtt 453 | |||||||||||||| Sbjct: 1748 tgtggtcagcgaggtt 1733
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 13929
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 30025082 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 23604276
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 21072
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||||||||| |||||||||||||| | ||||| || |||||||||||||| || |||| Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtga 2660 Query: 438 tatggtcagcgaggtt 453 ||||| |||||||| Sbjct: 2659 ggtggtcggcgaggtt 2644
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||| | |||||||||||||||||||| || |||| | Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtcagaaa 754 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 753 gatggtcagcaaggtt 738
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||||||||| |||||||||||||| | ||||| || |||||||||||||| || | | Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 801 Query: 438 tatggtcagcgaggtt 453 | |||||||||||||| Sbjct: 800 tgtggtcagcgaggtt 785
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 826
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 826
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 828
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 811
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | |||||||| |||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggg 828
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 63.9 bits (32), Expect = 4e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||||||||| |||||||||||||| | ||||| || |||||||||||||| || | | Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749 Query: 438 tatggtcagcgaggtt 453 | |||||||||||||| Sbjct: 1748 tgtggtcagcgaggtt 1733
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| || ||||| || |||||||||||||| Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggg 1142
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 376 ttacttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||||| ||||| || |||||||||||| | ||||||||||||||||| || ||||||| Sbjct: 824 ttactttccggggacaaagttggtggcataggcccatgcattgttgttcactggatcag 766
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 60.0 bits (30), Expect = 7e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 383 ccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatc 432 ||||| || ||||| |||||||| |||||||||||||||||||| ||||| Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatc 742
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 60.0 bits (30), Expect = 7e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||| |||||||||||||| || ||||| || |||||||||||||| Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggg 818
>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial sequence; nuclear gene for chloroplast product Length = 255 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||||||||||||||||||| | ||||| ||||||||| | || ||||||| Sbjct: 183 acttcccgggcacgaagttggtggcataagcccaggcattgttggtaacaggatcag 127
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||||||||| |||||||||||||| | ||||| |||||||||||||| Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgac 773
>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein Length = 686 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| || |||||||||||| | ||||||||||||||||| || ||||||| Sbjct: 580 actttccggggacaaagttggtggcataggcccatgcattgttgtttactggatcag 524
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 809 aatggtcagcaaggtt 794
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 733
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 701 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 700 aatggtcagcaaggtt 685
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 1194
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| || |||| | Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtcagcaa 792 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 791 gatggtcagcaaggtt 776
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 795 aatggtcagcaaggtt 780
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 795 aatggtcagcaaggtt 780
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 742 aatggtcagcaaggtt 727
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 794 aatggtcagcaaggtt 779
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 742 aatggtcagcaaggtt 727
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 789 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 788 aatggtcagcaaggtt 773
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 794 aatggtcagcaaggtt 779
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 10793729
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 19835 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 19834 aatggtcagcaaggtt 19819 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||| || || |||||||| ||||||||||| ||||| | | Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 22481 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 22480 aatggtcagcaaggtt 22465 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 16172 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 16173 aatggtcagcaaggtt 16188
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 809 aatggtcagcaaggtt 794
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 376 ttacttgccgggcacgaagttggtggcaaatgcccatgcattgttgtt 423 |||||| ||||| ||||||||||| ||||| ||||| ||||||||||| Sbjct: 807 ttactttccggggacgaagttggtcgcaaaagcccaagcattgttgtt 760
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 17452
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 66975
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 130347
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 804
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 803
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 1233
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||||| || ||||||||||| ||||| | | Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 888 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 887 aatggtcagcaaggtt 872
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 797
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 802
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 804
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggg 333
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 802
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 802
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||| |||||||| ||||| ||||||||||| ||||| |||| | Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 128 Query: 438 tatggtcagcgaggtt 453 |||||||||||||| Sbjct: 127 ggtggtcagcgaggtt 112
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| || ||||||||||| | |||||||| |||||||||||||| Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggg 787
>gb|M64619.1|PEACAB66 Pea cab gene, complete cds Length = 1666 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 383 ccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 ||||| || |||||||||||| ||| |||||||||||||||||| Sbjct: 1512 ccgggaacaaagttggtggcatatgaccatgcattgttgttgac 1469
>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll a/b-binding protein (polypeptide 15) complex precursor, complete coding sequence Length = 1993 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 383 ccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 ||||| || |||||||||||| ||| |||||||||||||||||| Sbjct: 1813 ccgggaacaaagttggtggcatatgaccatgcattgttgttgac 1770
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 |||||||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggg 783
>gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end Length = 1919 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 392 aagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 ||||| |||||| ||||||||||||||||||| || ||||||| Sbjct: 569 aagtttgtggcatatgcccatgcattgttgttcactggatcag 527
>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb1 mRNA, complete cds Length = 801 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgtt 423 |||| ||||| || |||||||||||| ||| ||||||||||||||| Sbjct: 799 actttccgggaacaaagttggtggcatatgaccatgcattgttgtt 754
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||| |||||||||||||| |||||||||| |||||| Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807
>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding protein Length = 2236 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgtt 423 |||| ||||| || |||||||||||| ||| ||||||||||||||| Sbjct: 2115 actttccgggaacaaagttggtggcatatgaccatgcattgttgtt 2070
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 2535
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 2535
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 803
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 761
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 803
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 748
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 799
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 119
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 780
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 783
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 88 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 136
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Minus Query: 390 cgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 ||||||||||||| || ||||| || |||||||||||||| |||| Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcag 651
>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, complete cds; nuclear gene for chloroplast product Length = 941 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| || ||||| |||||| ||||||| |||||||||||||| Sbjct: 848 actttccggggacaaagtttgtggcatatgcccaagcattgttgttgac 800
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 50.1 bits (25), Expect = 0.006 Identities = 49/57 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||| ||||| || ||||| |||||||| ||||| ||||||||||| ||||| |||| Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcag 973
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| || ||||| || ||||||||||| Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgac 1048
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| ||||||||||| || || |||||||| ||||||||||| Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgttgttgac 325
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| ||||||||||||||| | ||||| || ||||||||||| Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgac 992
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| || |||||||||||| | |||||||| ||||||||||| Sbjct: 850 actttccgggaacaaagttggtggcataggcccatgcgttgttgttgac 802
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 748 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| || ||||| |||||| ||||||| |||||||||||||| Sbjct: 621 actttccgggaacaaagtttgtggcatatgcccaagcattgttgttgac 573
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| || |||||||||||| | ||||| |||||||||||||| Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgac 942
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 808 aatggtcagcaaggtt 793
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||| || || |||||||| ||||||||||| ||||| | | Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 795 aatggtcagcaaggtt 780
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 48.1 bits (24), Expect = 0.025 Identities = 39/44 (88%) Strand = Plus / Plus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||||| |||||||||||||| ||||||| || |||||| Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttg 79017
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.025 Identities = 39/44 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||||| |||||||||||||| ||||||| || |||||| Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttg 21808799
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 743 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 742 aatggtcagcaaggtt 727
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 808 aatggtcagcaaggtt 793
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||| || || |||||||| ||||||||||| ||||| | | Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 743 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 742 aatggtcagcaaggtt 727
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||| || || |||||||| ||||||||||| ||||| | | Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 795 aatggtcagcaaggtt 780
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 808 aatggtcagcaaggtt 793
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 808 aatggtcagcaaggtt 793
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 808 aatggtcagcaaggtt 793
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.025 Identities = 39/44 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||||| |||||||||||||| ||||||| || |||||| Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttg 21801828
>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZE02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 307 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 113 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 112 aatggtcagcaaggtt 97
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 778 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 777 aatggtcagcaaggtt 762
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 689 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 688 aatggtcagcaaggtt 673
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 389 acgaagttggtggcaaatgcccatgcattgtt 420 ||||||||||||||||| ||||| |||||||| Sbjct: 860 acgaagttggtggcaaaggcccaggcattgtt 829
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| | | Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 960 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 959 aatggtcagcaaggtt 944
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 48.1 bits (24), Expect = 0.025 Identities = 63/76 (82%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||| || || |||||||| ||||||||||| ||||| | | Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 949 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 948 aatggtcagcaaggtt 933
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 48.1 bits (24), Expect = 0.025 Identities = 39/44 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||||| |||||||||||||| ||||||| || |||||| Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttg 798
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 48.1 bits (24), Expect = 0.025 Identities = 39/44 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||||| |||||||||||||| ||||||| || |||||| Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttg 373
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 48.1 bits (24), Expect = 0.025 Identities = 39/44 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||||| |||||||||||||| ||||||| || |||||| Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttg 787
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 48.1 bits (24), Expect = 0.025 Identities = 39/44 (88%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||||| |||||||||||||| || ||||| || |||||| Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttg 1489
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 46.1 bits (23), Expect = 0.099 Identities = 47/55 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatc 432 |||| ||||| || ||||||||||| || |||||||| |||||||| || ||||| Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatc 576
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 46.1 bits (23), Expect = 0.099 Identities = 47/55 (85%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||||||| |||||||||||||| | ||||| || |||||||| ||||| |||| Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcag 806
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 46.1 bits (23), Expect = 0.099 Identities = 41/47 (87%) Strand = Plus / Minus Query: 383 ccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 ||||| |||||||||||||| | ||||| ||||||||||| ||||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggg 846
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 46.1 bits (23), Expect = 0.099 Identities = 47/55 (85%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcag 434 |||||||| |||||||||||||| | ||||| || |||||||| ||||| |||| Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcag 815
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 46.1 bits (23), Expect = 0.099 Identities = 41/47 (87%) Strand = Plus / Minus Query: 383 ccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 ||||| |||||||||||||| | ||||| || |||||||||||||| Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggg 343
>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding protein (ABC) mRNA, complete cds; nuclear gene for chloroplast product Length = 993 Score = 44.1 bits (22), Expect = 0.39 Identities = 52/62 (83%) Strand = Plus / Minus Query: 392 aagttggtggcaaatgcccatgcattgttgttgacgggatcagtgatatggtcagcgagg 451 ||||| |||||| | ||||| ||||||||||| || ||||||| | ||||||||| ||| Sbjct: 788 aagtttgtggcataagcccaagcattgttgtttacaggatcagccaaatggtcagccagg 729 Query: 452 tt 453 || Sbjct: 728 tt 727
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 44.1 bits (22), Expect = 0.39 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||| ||||||||||||||| | ||||| || |||||| Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttg 843
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 44.1 bits (22), Expect = 0.39 Identities = 40/46 (86%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgtt 423 |||| ||||| |||||||||||||| || ||||| || |||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgtt 783
>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein (Lhcb-Pp2) mRNA, complete cds Length = 955 Score = 44.1 bits (22), Expect = 0.39 Identities = 28/30 (93%) Strand = Plus / Minus Query: 392 aagttggtggcaaatgcccatgcattgttg 421 |||||||||||| | ||||||||||||||| Sbjct: 782 aagttggtggcataagcccatgcattgttg 753
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein Length = 963 Score = 44.1 bits (22), Expect = 0.39 Identities = 40/46 (86%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgtt 423 |||| ||||| || ||||| |||||||| ||||| ||||||||||| Sbjct: 835 actttccgggaacaaagttagtggcaaaggcccaggcattgttgtt 790
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 44.1 bits (22), Expect = 0.39 Identities = 37/42 (88%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||||||| ||||||||||||||| | ||||| || |||||| Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttg 1921
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 44.1 bits (22), Expect = 0.39 Identities = 43/50 (86%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacggg 429 ||||| || ||||||||||||||| | ||||| || |||||||| ||||| Sbjct: 285 ttgccaggtacgaagttggtggcataggcccaggcgttgttgttaacggg 236
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 383 ccgggcacgaagttggtggcaa 404 |||||||||||||||||||||| Sbjct: 994 ccgggcacgaagttggtggcaa 973
>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end Length = 351 Score = 44.1 bits (22), Expect = 0.39 Identities = 40/46 (86%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgtt 423 |||| ||||| || ||||| |||||||||||||| || |||||||| Sbjct: 349 actttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtt 304
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 44.1 bits (22), Expect = 0.39 Identities = 40/46 (86%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgtt 423 |||| ||||| || ||||| |||||| ||||||| ||||||||||| Sbjct: 5161 actttccgggaacaaagttagtggcatatgcccaggcattgttgtt 5116
>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence Length = 183218 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 196 cagtgcacaaatcattgtcta 216 ||||||||||||||||||||| Sbjct: 73251 cagtgcacaaatcattgtcta 73271
>gb|AC117186.3| Mus musculus BAC clone RP23-37O6 from 1, complete sequence Length = 172780 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 101 gacatttggcaagtatttaga 121 ||||||||||||||||||||| Sbjct: 50942 gacatttggcaagtatttaga 50962
>emb|AL592153.6| Human DNA sequence from clone RP11-58K1 on chromosome 9 Contains the 3' end of the C9orf93 gene for chromosome 9 open reading frame 93, complete sequence Length = 160425 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 ttgcaaatttattataacatg 42 ||||||||||||||||||||| Sbjct: 72878 ttgcaaatttattataacatg 72898
>emb|CR847868.9| Zebrafish DNA sequence from clone DKEYP-99G4 in linkage group 8, complete sequence Length = 147399 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 14 gtttattattgcaaatttattataa 38 ||||||||||||||||||| ||||| Sbjct: 81393 gtttattattgcaaatttagtataa 81417
>emb|CR936775.1| Homo sapiens mRNA; cDNA DKFZp686P12113 (from clone DKFZp686P12113) Length = 6792 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 ttgcaaatttattataacatg 42 ||||||||||||||||||||| Sbjct: 6389 ttgcaaatttattataacatg 6409
>emb|BX548158.10| Zebrafish DNA sequence from clone CH211-106G4 in linkage group 8, complete sequence Length = 190936 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 14 gtttattattgcaaatttattataa 38 ||||||||||||||||||| ||||| Sbjct: 32799 gtttattattgcaaatttagtataa 32775
>dbj|AK128581.1| Homo sapiens cDNA FLJ46740 fis, clone TRACH3021335 Length = 4760 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 ttgcaaatttattataacatg 42 ||||||||||||||||||||| Sbjct: 4374 ttgcaaatttattataacatg 4394
>emb|BX640536.6| Zebrafish DNA sequence from clone CH211-191A6 in linkage group 5, complete sequence Length = 137923 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 281 tcaaacaatgattttgcactg 301 ||||||||||||||||||||| Sbjct: 88983 tcaaacaatgattttgcactg 89003
>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein (CipLhcb2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1033 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 389 acgaagttggtggcaaatgcccatgcattgttg 421 ||||||||||||||| | ||||| ||||||||| Sbjct: 841 acgaagttggtggcataagcccaagcattgttg 809
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 42.1 bits (21), Expect = 1.5 Identities = 42/49 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| |||||||||||||| | ||||| || ||||||||||| Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgac 800
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 398 gtggcaaatgcccatgcattgttgttgacgggatcag 434 |||||||| ||||| ||||||||||| ||||| |||| Sbjct: 900 gtggcaaaggcccacgcattgttgttaacggggtcag 864
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 42.1 bits (21), Expect = 1.5 Identities = 54/65 (83%) Strand = Plus / Minus Query: 380 ttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtgata 439 |||||||| |||||||||||||| | ||||| || |||||| |||||| |||| || | Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515 Query: 440 tggtc 444 ||||| Sbjct: 514 tggtc 510
>gb|AC140214.3| Mus musculus BAC clone RP23-479G14 from 1, complete sequence Length = 194229 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 101 gacatttggcaagtatttaga 121 ||||||||||||||||||||| Sbjct: 121108 gacatttggcaagtatttaga 121128
>emb|AL160052.21| Human DNA sequence from clone RP11-531C18 on chromosome 9, complete sequence Length = 149868 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 ttgcaaatttattataacatg 42 ||||||||||||||||||||| Sbjct: 114446 ttgcaaatttattataacatg 114466
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 42.1 bits (21), Expect = 1.5 Identities = 42/49 (85%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgac 426 |||| ||||| || ||||| |||||| | ||||| |||||||||||||| Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgttgttgac 1502
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggc 402 |||||||||| |||||||||||||| Sbjct: 822 acttgccggggacgaagttggtggc 798
>gb|AC163295.2| Mus musculus BAC clone RP23-132K20 from chromosome 14, complete sequence Length = 212576 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 83 aggttattcctattggttgacatt 106 ||||| |||||||||||||||||| Sbjct: 163814 aggttcttcctattggttgacatt 163791
>gb|AC009391.16| Drosophila melanogaster clone BACR21I23, complete sequence Length = 189254 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tttattattgcaaatttatt 34 |||||||||||||||||||| Sbjct: 155254 tttattattgcaaatttatt 155273
>gb|AC099468.9| Rattus norvegicus 1 BAC CH230-37P5 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 212177 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 aagcgtttattattgcaaat 29 |||||||||||||||||||| Sbjct: 137185 aagcgtttattattgcaaat 137166
>gb|AC124467.3| Mus musculus BAC clone RP24-163L18 from chromosome 15, complete sequence Length = 169366 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 tattattgcaaatttattat 36 |||||||||||||||||||| Sbjct: 88034 tattattgcaaatttattat 88053
>emb|BX057791.1|CNS09GR7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 aaatttattataacatgcaa 45 |||||||||||||||||||| Sbjct: 758 aaatttattataacatgcaa 739
>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein, complete cds Length = 935 Score = 40.1 bits (20), Expect = 6.1 Identities = 38/44 (86%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttg 421 |||| ||||| || ||||| |||||| | ||||||||||||||| Sbjct: 818 actttccgggtacaaagttagtggcataagcccatgcattgttg 775
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 ttattattgcaaatttatta 35 |||||||||||||||||||| Sbjct: 9347688 ttattattgcaaatttatta 9347707
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 40.1 bits (20), Expect = 6.1 Identities = 63/76 (82%), Gaps = 1/76 (1%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || ||||||||||| || ||||| || ||||||||||| ||||| | | Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcggcca 781 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 780 aatggtcagcaaggtt 765
>gb|AF221066.1|AF221066 Drosophila melanogaster modulo (mod) gene, partial sequence; and kurtz arrestin gene, complete cds Length = 4447 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tttattattgcaaatttatt 34 |||||||||||||||||||| Sbjct: 4023 tttattattgcaaatttatt 4042
>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA Length = 699 Score = 40.1 bits (20), Expect = 6.1 Identities = 62/76 (81%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||| ||| | ||||| ||||||||||| || || |||| | Sbjct: 559 actttccgggtacaaagttggtagcataggcccaagcattgttgttaaccgggtcagcaa 500 Query: 438 tatggtcagcgaggtt 453 ||||||||| ||||| Sbjct: 499 gatggtcagcaaggtt 484
>emb|X12980.1|GMCAB2 Soybean Cab2 gene for minor PSII LHCII chlorophyll a/b binding protein Length = 1354 Score = 40.1 bits (20), Expect = 6.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 395 ttggtggcaaatgcccatgcattgttgttgacgggatcag 434 ||||||||| | ||||| ||||||||||| || ||||||| Sbjct: 1002 ttggtggcataggcccaggcattgttgtttactggatcag 963
>ref|XM_314225.2| Anopheles gambiae str. PEST ENSANGP00000014522 (ENSANGG00000012033), partial mRNA Length = 764 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 aaatttattataacatgcaa 45 |||||||||||||||||||| Sbjct: 699 aaatttattataacatgcaa 680
>ref|XM_306101.2| Anopheles gambiae str. PEST ENSANGP00000015544 (ENSANGG00000013055), mRNA Length = 841 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 aaatttattataacatgcaa 45 |||||||||||||||||||| Sbjct: 776 aaatttattataacatgcaa 757
>gb|AE003780.4| Drosophila melanogaster chromosome 3R, section 118 of 118 of the complete sequence Length = 256818 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tttattattgcaaatttatt 34 |||||||||||||||||||| Sbjct: 222818 tttattattgcaaatttatt 222837
>emb|CT033786.13| Mouse DNA sequence from clone RP24-298F18 on chromosome 14, complete sequence Length = 185421 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 83 aggttattcctattggttgacatt 106 ||||| |||||||||||||||||| Sbjct: 67875 aggttcttcctattggttgacatt 67852
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 ttattattgcaaatttatta 35 |||||||||||||||||||| Sbjct: 9347573 ttattattgcaaatttatta 9347592
>emb|AL731744.6|CNS08C7T Oryza sativa chromosome 12, . BAC OSJNBa0026C14 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 190718 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 ttattattgcaaatttatta 35 |||||||||||||||||||| Sbjct: 91367 ttattattgcaaatttatta 91348
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene, complete cds Length = 2095 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 375 cttacttgccgggcacgaagttggtggc 402 |||| |||||||||||||| |||||||| Sbjct: 1747 cttagttgccgggcacgaacttggtggc 1720
>emb|CR847498.12| Zebrafish DNA sequence from clone DKEY-263P22 in linkage group 14, complete sequence Length = 168227 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 attattgcaaatttattataacat 41 |||||||||||||||||| ||||| Sbjct: 49542 attattgcaaatttattacaacat 49565
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 40.1 bits (20), Expect = 6.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 392 aagttggtggcaaatgcccatgcattgttgtt 423 |||||||||||| | ||||| ||||||||||| Sbjct: 65575 aagttggtggcataggcccaggcattgttgtt 65606
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 40.1 bits (20), Expect = 6.1 Identities = 62/76 (81%) Strand = Plus / Minus Query: 378 acttgccgggcacgaagttggtggcaaatgcccatgcattgttgttgacgggatcagtga 437 |||| ||||| || |||||||||||||| ||| ||||||||||| || || |||| | Sbjct: 851 actttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagcaa 792 Query: 438 tatggtcagcgaggtt 453 |||||||||||||| Sbjct: 791 ggtggtcagcgaggtt 776 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,971,861 Number of Sequences: 3902068 Number of extensions: 3971861 Number of successful extensions: 70348 Number of sequences better than 10.0: 187 Number of HSP's better than 10.0 without gapping: 186 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 69996 Number of HSP's gapped (non-prelim): 352 length of query: 453 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 431 effective length of database: 17,147,199,772 effective search space: 7390443101732 effective search space used: 7390443101732 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
