ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet65c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 107 1e-20
2emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 96 5e-17
3gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 94 2e-16
4gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 92 8e-16
5gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 92 8e-16
6gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 90 3e-15
7ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 88 1e-14
8ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 88 1e-14
9emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 88 1e-14
10gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 88 1e-14
11dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
12dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
13dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
14dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
15dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
16emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 88 1e-14
17dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
18dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
19dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
20dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
21dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
22dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
23emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 86 5e-14
24emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 86 5e-14
25gb|AY109324.1| Zea mays CL187_1 mRNA sequence 86 5e-14
26dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
27dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
28dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
29emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 80 3e-12
30dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
31dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
32dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
33dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
34dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 3e-12
35dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 80 3e-12
36gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 78 1e-11
37ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 76 5e-11
38ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 76 5e-11
39ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 76 5e-11
40ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 76 5e-11
41gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 76 5e-11
42gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 76 5e-11
43gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 76 5e-11
44gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 76 5e-11
45gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 76 5e-11
46gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 76 5e-11
47gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 76 5e-11
48gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 76 5e-11
49gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 76 5e-11
50gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 76 5e-11
51gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 76 5e-11
52gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 76 5e-11
53gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 76 5e-11
54gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 76 5e-11
55emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 76 5e-11
56emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 76 5e-11
57emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 76 5e-11
58emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 76 5e-11
59dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 76 5e-11
60gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 76 5e-11
61emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 76 5e-11
62gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 76 5e-11
63emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 74 2e-10
64gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 72 7e-10
65emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 72 7e-10
66gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 70 3e-09
67emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 70 3e-09
68gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 70 3e-09
69gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 70 3e-09
70ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 68 1e-08
71ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 68 1e-08
72ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 68 1e-08
73gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 68 1e-08
74gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 68 1e-08
75gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 68 1e-08
76gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 68 1e-08
77gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 68 1e-08
78gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 68 1e-08
79gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 68 1e-08
80gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 68 1e-08
81gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 68 1e-08
82gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 68 1e-08
83gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 68 1e-08
84gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 68 1e-08
85gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 68 1e-08
86gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 68 1e-08
87gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 68 1e-08
88gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 68 1e-08
89emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 68 1e-08
90emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 68 1e-08
91gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 68 1e-08
92gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 68 1e-08
93gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 68 1e-08
94emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 68 1e-08
95emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 68 1e-08
96emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 68 1e-08
97gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 68 1e-08
98gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 66 4e-08
99emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 66 4e-08
100gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 66 4e-08
101emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 66 4e-08
102emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 66 4e-08
103emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 66 4e-08
104emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 66 4e-08
105emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 66 4e-08
106gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 66 4e-08
107gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 66 4e-08
108emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 64 2e-07
109gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 64 2e-07
110gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 64 2e-07
111gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 62 7e-07
112emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 62 7e-07
113gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 62 7e-07
114gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 62 7e-07
115gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 60 3e-06
116gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 60 3e-06
117dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 60 3e-06
118emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 60 3e-06
119emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 60 3e-06
120emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 60 3e-06
121dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
122dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
123gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 60 3e-06
124gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 60 3e-06
125dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 60 3e-06
126dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 58 1e-05
127emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 56 4e-05
128emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 56 4e-05
129emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 56 4e-05
130gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 56 4e-05
131gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 56 4e-05
132gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 56 4e-05
133emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 54 2e-04
134emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 54 2e-04
135gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 52 7e-04
136gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 52 7e-04
137emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 52 7e-04
138gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 52 7e-04
139ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 50 0.003
140gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 50 0.003
141gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 50 0.003
142gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 50 0.003
143gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 50 0.003
144gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 50 0.003
145emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 50 0.003
146gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 50 0.003
147dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 50 0.003
148emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 50 0.003
149emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 50 0.003
150emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 50 0.003
151emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 50 0.003
152gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 50 0.003
153gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 50 0.003
154dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 50 0.003
155dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 50 0.003
156emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 48 0.010
157gb|AY112240.1| Zea mays CL187_6 mRNA sequence 48 0.010
158gb|AY104614.1| Zea mays PCO084486 mRNA sequence 48 0.010
159gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 48 0.010
160gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 48 0.010
161gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-... 48 0.010
162dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 48 0.010
163dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 48 0.010
164ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.040
165ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.040
166ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.040
167ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.040
168ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.040
169ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.040
170ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.040
171ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 46 0.040
172dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.040
173gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 46 0.040
174dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.040
175dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
176dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
177dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
178emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 46 0.040
179dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
180dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
181dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
182dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
183dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
184dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
185dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.040
186gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 46 0.040
187gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 46 0.040
188emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 46 0.040
189gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 46 0.040
190gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 46 0.040
191dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 46 0.040
192dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 44 0.16
193emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 44 0.16
194gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 44 0.16
195gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 44 0.16
196emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 44 0.16
197dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 44 0.16
198emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 42 0.63
199gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 42 0.63
200gb|AC003977.1|HUAC003977 Homo sapiens Chromosome 16 BAC clone CI... 40 2.5
201gb|AC012172.7| Homo sapiens chromosome 16 clone RP11-148F12, com... 40 2.5
202gb|AC138305.2| Homo sapiens chromosome 16 clone RP11-2K6, comple... 40 2.5
203emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 40 2.5
204dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 40 2.5
205gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 40 2.5
206gb|AC127692.4| Mus musculus BAC clone RP23-49P3 from chromosome ... 38 9.8
207gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 38 9.8
208dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 38 9.8
209gb|AC010534.7|AC010534 Homo sapiens chromosome 16 clone RP11-259... 38 9.8
210gb|AC092337.3| Homo sapiens chromosome 16 clone RP11-21L1, compl... 38 9.8
211emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 38 9.8
212emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA 38 9.8
213emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 38 9.8
214emb|CR376843.11| Zebrafish DNA sequence from clone CH211-284N15 ... 38 9.8
215emb|BX640589.8| Zebrafish DNA sequence from clone CH211-222H13 i... 38 9.8
216gb|AF126284.1|AF126284 Aura virus polyprotein 1 and polyprotein ... 38 9.8
217dbj|AP004410.1| Lamprogrammus niger mitochondrial DNA, complete ... 38 9.8
218gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 38 9.8
219gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 38 9.8
220gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 38 9.8

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  107 bits (54), Expect = 1e-20
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                       
Query: 126 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||
Sbjct: 867 agcttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 808

             
Query: 186 gg 187
           ||
Sbjct: 807 gg 806



 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 5    agtcttttgcattcaaccctcgtactttacatca 38
            |||||||||||||||||| |||||||||||||||
Sbjct: 1005 agtcttttgcattcaaccttcgtactttacatca 972



 Score = 40.1 bits (20), Expect = 2.5
 Identities = 42/49 (85%), Gaps = 4/49 (8%)
 Strand = Plus / Minus

                                                            
Query: 62  gcacacttcatcgcgtacgt----acgtgcactgtcggtttctagacac 106
           |||||||| |||||||||||    |||||||| ||||||||| ||||||
Sbjct: 926 gcacacttgatcgcgtacgtacgcacgtgcacggtcggtttccagacac 878



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||||||||||||||||||  ||||||| |||||||||||||||||||||||  
Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 748 ggtggtcg 741



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 62/67 (92%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779

                  
Query: 191 ggtggtc 197
           |||||||
Sbjct: 778 ggtggtc 772



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                       
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcaggg 192
           |||||||| || |||||||||||||||||||| |||||||||||||||||||||||  ||
Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagg 808

                 
Query: 193 tggtcg 198
           ||||||
Sbjct: 807 tggtcg 802



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 55/58 (94%)
 Strand = Plus / Minus

                                                                      
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||||||||| || |||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggc 1136



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 128 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 187
           ||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||
Sbjct: 811 cttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 752

            
Query: 188 c 188
           |
Sbjct: 751 c 751



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 736 ggtggtcg 729



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 724 ggtggtcg 717



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186

                    
Query: 191  ggtggtcg 198
            ||||||||
Sbjct: 1185 ggtggtcg 1178



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                         
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
             |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937

                     
Query: 191   ggtggtcg 198
             ||||||||
Sbjct: 13938 ggtggtcg 13945



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                            
Query: 131      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
                |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074

                        
Query: 191      ggtggtcg 198
                ||||||||
Sbjct: 30025073 ggtggtcg 30025066



 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                            
Query: 131      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
                |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268

                        
Query: 191      ggtggtcg 198
                ||||||||
Sbjct: 23604267 ggtggtcg 23604260



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                         
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
             |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064

                     
Query: 191   ggtggtcg 198
             ||||||||
Sbjct: 21063 ggtggtcg 21056



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                         
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
             |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967

                     
Query: 191   ggtggtcg 198
             ||||||||
Sbjct: 66966 ggtggtcg 66959



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 795 ggtggtcg 788



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 794 ggtggtcg 787



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225

                    
Query: 191  ggtggtcg 198
            ||||||||
Sbjct: 1224 ggtggtcg 1217



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 817 ggtggtcg 810



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 817 ggtggtcg 810



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 819 ggtggtcg 812



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 324 ggtggtcg 317



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 802 ggtggtcg 795



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||  
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 819 ggtggtcg 812



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                       
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 189
            |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||||
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggca 1750



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                      
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 189
           |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||||
Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggca 802



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                       
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 189
            |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||||
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggca 1750



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                            
Query: 131      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
                |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721

                        
Query: 191      ggtggtcg 198
                ||||||||
Sbjct: 10793720 ggtggtcg 10793713



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                         
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
             |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444

                     
Query: 191   ggtggtcg 198
             ||||||||
Sbjct: 17443 ggtggtcg 17436



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                          
Query: 131    acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
              |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339

                      
Query: 191    ggtggtcg 198
              ||||||||
Sbjct: 130338 ggtggtcg 130331



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 129 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||||||| || |||||||||||||||||||| || |||||||| |||||||||||
Sbjct: 975 ttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggc 916



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 788 ggtggtcg 781



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 793 ggtggtcg 786



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 795 ggtggtcg 788



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 793 ggtggtcg 786



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 793 ggtggtcg 786



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||||  
Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 774 ggtggtcg 767



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||||||||||| || ||||||||||| ||||| ||| 
Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaa 767

                  
Query: 191 ggtggtc 197
           |||||||
Sbjct: 766 ggtggtc 760



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                      
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                      
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 752



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||||| |||||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggc 413



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                       
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
             |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 93262



 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
             |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 96055



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                       
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
             |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 80940



 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
             |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 78147



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 110



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 771



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 88  actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 145



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 145 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           |||||||||||||||||||| |||||||||||||||||||| ||  ||||||||
Sbjct: 693 aagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcg 640



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 129 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||| || || ||||||||||||||| ||||||| |||||||||||||| ||||||||
Sbjct: 851 ttactttccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792

                 
Query: 189 agggtg 194
           | ||||
Sbjct: 791 aaggtg 786



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                      
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||| ||||| || |||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 1039



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                      
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||||||||| || |||||||||||||||||||| |||||||||  ||||||||||||
Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggc 1475



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                     
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 187
            |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||
Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcgg 2663



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| || |||||||||||| ||||||| |||||||||||||| ||||| ||| 
Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaa 789

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 788 ggtggtcg 781



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                        
Query: 126  agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
            |||||| |||||||| || |||||||||||| ||||||| |||||||||||||| |||||
Sbjct: 1683 agcttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtc 1624



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| ||||| |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 215 actttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtc 161



 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                   
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
            |||| ||||| |||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 8573 actttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtc 8627



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 189
           |||| ||||| || |||||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggca 770



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| ||| 
Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 128

                  
Query: 191 ggtggtc 197
           |||||||
Sbjct: 127 ggtggtc 121



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 189
           |||| ||||| ||||||||||||||  ||||||| |||||||||||||| |||||||||
Sbjct: 850 actttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggca 792



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || |||||
Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 585



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 757



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || |||||
Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 745



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || |||||
Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 791



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 127



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 792



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 703



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
             |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || |||||
Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 22483



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                       
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
             |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 19837



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                           
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
             |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 16158



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                          
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
            |||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 974



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || |||||
Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 951



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 890



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtgg 195
           ||||| |||||||| |||||||| ||||| ||||||||||| |||||||| ||| |||||
Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggtgg 732

             
Query: 196 tc 197
           ||
Sbjct: 731 tc 730



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||||||||||||||| ||||||||||||||
Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 582



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
            |||| ||||| || |||||||||||||||||||| ||||||||||||||
Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2326



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||||||| || |||||||||||| ||||||| ||||||||||| ||||||||
Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 808



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 814 ttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
            |||| ||||| || |||||||||||||||||||| ||||||||||||||
Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2327



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 128 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 187
           |||| |||||||| || ||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 820 cttatttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcgg 761

            
Query: 188 c 188
           |
Sbjct: 760 c 760



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           ||||| || ||||||||||||||| ||||||| |||||||||||||| |||||
Sbjct: 834 ttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtc 782



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||||||| || |||||||||||| ||||||| ||||||||||| ||||||||
Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 817



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           ||||| || |||||||||||| | ||||| |||||||||||||||||||||||
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggc 337



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 126 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| |||| ||||| |||||||| ||||| |||||||| ||||||||||| || |||||
Sbjct: 842 agctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783

                        
Query: 186 ggcagggtggtcg 198
            ||| ||||||||
Sbjct: 782 agcaaggtggtcg 770



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| ||| 
Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 970

                
Query: 191  ggtg 194
            ||||
Sbjct: 969  ggtg 966



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||||||||| || |||||||||||| ||||||| || ||||||||||| ||||| ||| 
Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaa 762

               
Query: 191 ggtg 194
           ||||
Sbjct: 761 ggtg 758



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||| ||||| |||||||| ||||||||||| || ||||||||| 
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaa 290

                   
Query: 191 ggtggtcg 198
            |||||||
Sbjct: 289 tgtggtcg 282



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| ||||| |||||||||||||| || ||||| |||||||||||||| |||||
Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtc 797



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| ||||| || |||||||| ||||||||||| |||||||||||||| |||||
Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtgg 195
           |||||||| ||||||||||| | |  |||||||||||||||||| |||||||||  ||||
Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtgg 935

              
Query: 196 tcg 198
           |||
Sbjct: 934 tcg 932



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| ||||||||||||||  ||||||| || ||||||||||| ||||| ||| 
Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaa 931

                  
Query: 191 ggtggtc 197
           |||||||
Sbjct: 930 ggtggtc 924



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                       
Query: 131   acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
             |||||||||| || |||||||||||| | ||||| |||||||||  ||||||||||||
Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 79031



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                          
Query: 131      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
                |||||||||| || |||||||||||| | ||||| |||||||||  ||||||||||||
Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 21808785



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                          
Query: 131      acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
                |||||||||| || |||||||||||| | ||||| |||||||||  ||||||||||||
Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 21801814



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 52/58 (89%), Gaps = 1/58 (1%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||
Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcggc 783



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||| ||||| || |||||||||||| ||||||| |||||||||| ||| ||||||||
Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggc 781



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 129  ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||||| ||||| |||||||| |||||  ||||||| ||||||||||| |||||||| ||
Sbjct: 1305 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagc 1246

                  
Query: 189  agggtg 194
            | ||||
Sbjct: 1245 aaggtg 1240



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||||| || |||||||||||| | ||||| |||||||||  ||||||||||||
Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 784



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||||| || |||||||||||| | ||||| |||||||||  ||||||||||||
Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 359



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||||| || |||||||||||| | ||||| |||||||||  ||||||||||||
Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 773



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||||| ||||| ||||||||| | ||||| |||||||||  ||||||||||||
Sbjct: 837 acttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggc 780



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 129  ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||||| ||||| |||||||| |||||  ||||||| ||||||||||| |||||||| ||
Sbjct: 2708 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcagc 2649

                  
Query: 189  agggtg 194
            | ||||
Sbjct: 2648 aaggtg 2643



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           ||||| || |||||||||||| ||||||| || |||||||| |||||||||||
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggc 840



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||| || |||||||||||  ||||||| ||||||||| | |||||||||||
Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 829



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| ||||||||||||||| ||| ||| || |||||||| || ||||| ||| 
Sbjct: 869 actttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagcaa 810

                   
Query: 191 ggtggtcg 198
           ||||||||
Sbjct: 809 ggtggtcg 802



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 133  ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            |||||||| || |||||||||||  ||||||| ||||||||| | |||||||||||
Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 1907



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 143 caaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtg 194
           ||||||| |||||||||||||| || |||||||| || ||||||||| ||||
Sbjct: 802 caaagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaaggtg 751



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 145 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||||||  ||||||| ||||||||||| |||||||||||
Sbjct: 273 aagttggtggcataggcccaggcgttgttgttaacggggtcggc 230



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||| ||||| |||||||| ||||||||||| || ||||| ||| 
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcagcaa 290

                   
Query: 191 ggtggtcg 198
            |||||||
Sbjct: 289 tgtggtcg 282



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 52/59 (88%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                      
Query: 131 acttgccgggcacaaagttggtggcgaaggccc-acgcgttgttgttgacggggtcggc 188
           |||| ||||| ||||||||||| |||||||||| | |||||||||||||| || |||||
Sbjct: 53  actttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| ||||| ||||||||||||||  ||||||| || ||||||||||| |||||
Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtc 759



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 145 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtg 194
           ||||||||||| || ||||| || |||||||||||||| |||||| ||||
Sbjct: 658 aagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtg 609



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtgg 195
           ||||| |||||||| ||||| |||||||| || ||||||||||| || || ||| |||||
Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatctgcaaggtgg 732

             
Query: 196 tc 197
           ||
Sbjct: 731 tc 730



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 54/62 (87%), Gaps = 1/62 (1%)
 Strand = Plus / Plus

                                                                       
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtgg 195
           ||||| |||||||| |||||||| ||| | ||||||||||| |||||||| ||| |||||
Sbjct: 6   ccggggacaaagtttgtggcgaaagccaa-gcgttgttgttaacggggtctgcaaggtgg 64

             
Query: 196 tc 197
           ||
Sbjct: 65  tc 66



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           ||||| |||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtc 950



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || ||||||||||| |||||||| || |||||||||||
Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 819



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 471



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 136  ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
            ||||| || |||||||||||| ||||||| |||||||||   |||||||||||
Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggc 2965



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 142 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtg 194
           ||||| || ||||| ||||||||||| |||||||| |||||||| ||| ||||
Sbjct: 909 acaaaatttgtggcaaaggcccacgcattgttgttaacggggtcagcaaggtg 857



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
            |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 1051



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           ||||||||| ||||||| || |||||||| |||||||||||
Sbjct: 873 ttggtggcgtaggcccaggcattgttgttcacggggtcggc 833



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
            |||| ||||| || |||||||||||  ||||||| ||||||||||||||
Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgac 992



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 179
           |||| ||||| || |||||||| ||||||||||| || |||||||||||
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||||||| || |||||||||||| | ||||| |||||||||  |||||||||
Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtc 522



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           ||||| || |||||||||||| ||||||| |||||||||   |||||||||||
Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggc 787



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 187
           |||||||||| || |||||||||||| | | ||| |||||||||  |||||||||||
Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcgg 766



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||| || ||||| |||||| | ||||| |||||||||  ||||||||||||
Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggc 769



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 188
           |||||||| || ||||| |||||| | ||||| |||||||||  ||||||||||||
Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggc 417



to top

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 167 cgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||||||||||||||||  ||||||||
Sbjct: 955 cgttgttgttgacggggtcggcgaggtggtcg 924



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 129 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||||| ||||| ||||||||||||||  ||||||| || ||||||||
Sbjct: 824 ttactttccggggacaaagttggtggcataggcccatgcattgttgtt 777



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||| ||||| || ||||| ||||||||||| || ||||| ||| 
Sbjct: 349 actttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgcaa 290

               
Query: 191 ggtg 194
           ||||
Sbjct: 289 ggtg 286



to top

>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||| ||||| || ||||| ||||||||||| || ||||| ||| 
Sbjct: 349 actttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgcaa 290

               
Query: 191 ggtg 194
           ||||
Sbjct: 289 ggtg 286



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 158  aggcccacgcgttgttgttgacggggtcggcagggtggtc 197
            ||||||| ||||||||||| || ||||||||| |||||||
Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggcaaggtggtc 2186



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||| ||||| |||||||| |||||  ||||||| ||||||||||| || ||||| ||| 
Sbjct: 1872 actttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagcaa 1931

                    
Query: 191  ggtggtcg 198
            | ||||||
Sbjct: 1932 gatggtcg 1939



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 766



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 790



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 790



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 792



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 795



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 795



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 797



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 830



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                   
Query: 148      ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
                ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 22434803



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||| |||||  | ||||| || ||||||||||| ||||| ||| 
Sbjct: 848 actttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtcagcaa 789

                  
Query: 191 ggtggtc 197
           |||||||
Sbjct: 788 ggtggtc 782



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 148   ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
             ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 95870



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 795



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 795



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 795



to top

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||| ||||| |||||||| ||||| || ||||| ||||||||||| || || || ||| 
Sbjct: 1702 actttccgggaacaaagtttgtggcaaaagcccatgcgttgttgttaactggatcagcaa 1643

                   
Query: 191  ggtggtc 197
            |||||||
Sbjct: 1642 ggtggtc 1636



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 766



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 795



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 790



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 790



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 795



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 791



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 148 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||| || |||| |||||||||  ||||||||||||  ||||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcg 797



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 189
           |||| ||||| |||||||| |||||| ||| ||| ||||||||||| || || ||||||
Sbjct: 229 actttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggca 171



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           ||||||||||  ||||||| || ||||||||||| || |||||||| || |||||
Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtc 804



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||||||||| |||  ||| || |||||||| || ||||| ||| 
Sbjct: 851 actttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagcaa 792

                  
Query: 191 ggtggtc 197
           |||||||
Sbjct: 791 ggtggtc 785



to top

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtg 194
           ||||| |||||||| |||||| ||| ||| ||||||||||| || ||||| ||| ||||
Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtctgcaaggtg 286



to top

>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding  protein
           mRNA, partial cds
          Length = 191

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 133 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 187
           |||||||| || ||||| |||||| | ||||| |||||||||  |||||||||||
Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcgg 52



to top

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score = 46.1 bits (23), Expect = 0.040
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| ||||| |||||||| |||||  | ||||| |||||||||||||| |||||
Sbjct: 810 acttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtc 756



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 133  ttgccgggcacaaagttggtggcgaaggcccacgcgttgttg 174
            |||||||| || |||||||||||| | ||||| |||||||||
Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 165 cgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||||||||| |||||||||  |||||||
Sbjct: 760 cgcgttgttgttgacagggtcggcaatgtggtcg 727



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtgg 195
           ||||| |||||||| |||||  | | ||| ||||||||||| |||||||| ||| |||||
Sbjct: 791 ccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

             
Query: 196 tc 197
           ||
Sbjct: 731 tc 730



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 136 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtgg 195
           ||||| |||||||| |||||  | | ||| ||||||||||| |||||||| ||| |||||
Sbjct: 791 ccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaaggtgg 732

             
Query: 196 tc 197
           ||
Sbjct: 731 tc 730



to top

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 176
           |||| ||||| ||||||||||||||  ||||||| || ||||||||
Sbjct: 580 actttccggggacaaagttggtggcataggcccatgcattgttgtt 535



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                        
Query: 136  ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtgg 195
            ||||| |||||||| |||||  ||| ||| ||||||||||| || ||||| ||| |||||
Sbjct: 5125 ccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtctgcaaggtgg 5066

              
Query: 196  tc 197
            ||
Sbjct: 5065 tc 5064



 Score = 40.1 bits (20), Expect = 2.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 142  acaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
            |||||||| |||||| ||| ||| ||||||||||| || |||||
Sbjct: 2666 acaaagtttgtggcgtaggaccaggcgttgttgttaactgggtc 2623



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 157 aaggcccacgcgttgttgttgacggggtc 185
           |||||||| ||||||||||| ||||||||
Sbjct: 662 aaggcccaagcgttgttgttaacggggtc 634



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 142 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcagggtggtcg 198
           ||||||||||||||  | ||||| ||||| ||||| || ||||| ||| ||||||||
Sbjct: 874 acaaagttggtggcataagcccaggcgttattgttcaccgggtcagcaaggtggtcg 818



to top

>gb|AC003977.1|HUAC003977 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-542B9, complete
             sequence
          Length = 130491

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     aatgagtcttttgcattcaa 20
             ||||||||||||||||||||
Sbjct: 63242 aatgagtcttttgcattcaa 63223



to top

>gb|AC012172.7| Homo sapiens chromosome 16 clone RP11-148F12, complete sequence
          Length = 136803

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     aatgagtcttttgcattcaa 20
             ||||||||||||||||||||
Sbjct: 13903 aatgagtcttttgcattcaa 13922



to top

>gb|AC138305.2| Homo sapiens chromosome 16 clone RP11-2K6, complete sequence
          Length = 173695

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      aatgagtcttttgcattcaa 20
              ||||||||||||||||||||
Sbjct: 105004 aatgagtcttttgcattcaa 104985



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||| ||||| |||||||| || ||| | | ||| ||||||||||| || ||||||||| 
Sbjct: 1032 actttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggcaa 973

                
Query: 191  ggtg 194
            ||||
Sbjct: 972  ggtg 969



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 142   acaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
             ||||||||||||||  ||||||| || |||||||| || |||||
Sbjct: 65572 acaaagttggtggcataggcccaggcattgttgttaactgggtc 65615



to top

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||| ||||| |||||||| |||||  | ||||| || ||||||||||| ||||| ||| 
Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagcaa 1491

                
Query: 191  ggtg 194
            ||||
Sbjct: 1490 ggtg 1487



to top

>gb|AC127692.4| Mus musculus BAC clone RP23-49P3 from chromosome 5, complete sequence
          Length = 243940

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 3      tgagtcttttgcattcaaccctc 25
              |||||||||||||| ||||||||
Sbjct: 131450 tgagtcttttgcatacaaccctc 131472



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 141     cacaaagttggtggcgaaggccc 163
               |||||| ||||||||||||||||
Sbjct: 1555500 cacaaatttggtggcgaaggccc 1555522



to top

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 141     cacaaagttggtggcgaaggccc 163
               |||||| ||||||||||||||||
Sbjct: 2872862 cacaaatttggtggcgaaggccc 2872840



to top

>gb|AC010534.7|AC010534 Homo sapiens chromosome 16 clone RP11-259E8, complete sequence
          Length = 146385

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 100   tagacactagtggggacaa 118
             |||||||||||||||||||
Sbjct: 98867 tagacactagtggggacaa 98885



to top

>gb|AC092337.3| Homo sapiens chromosome 16 clone RP11-21L1, complete sequence
          Length = 175994

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 100    tagacactagtggggacaa 118
              |||||||||||||||||||
Sbjct: 151237 tagacactagtggggacaa 151255



to top

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgtt 173
           |||| ||||| ||||||||||||||| | ||||| || |||||
Sbjct: 962 actttccgggaacaaagttggtggcgtaagcccaggcattgtt 920



to top

>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA
          Length = 699

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 46/55 (83%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| ||||| ||||||||||| ||  ||||||| || |||||||| || |||||
Sbjct: 559 actttccgggtacaaagttggtagcataggcccaagcattgttgttaaccgggtc 505



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 55/67 (82%)
 Strand = Plus / Minus

                                                                       
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
           |||| ||||| |||||||| |||||  | | ||| ||||||||||| || ||||| ||| 
Sbjct: 857 actttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaa 798

                  
Query: 191 ggtggtc 197
           |||||||
Sbjct: 797 ggtggtc 791



to top

>emb|CR376843.11| Zebrafish DNA sequence from clone CH211-284N15 in linkage group 19,
           complete sequence
          Length = 75162

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 29  ctttacatcagggttgtacaaac 51
           ||||||||||||||||| |||||
Sbjct: 496 ctttacatcagggttgtccaaac 474



to top

>emb|BX640589.8| Zebrafish DNA sequence from clone CH211-222H13 in linkage group 19,
             complete sequence
          Length = 99460

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 29    ctttacatcagggttgtacaaac 51
             ||||||||||||||||| |||||
Sbjct: 97956 ctttacatcagggttgtccaaac 97934



to top

>gb|AF126284.1|AF126284 Aura virus polyprotein 1 and polyprotein 2 genes, complete cds
          Length = 11824

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  acgtgcactgtcggtttct 100
           |||||||||||||||||||
Sbjct: 100 acgtgcactgtcggtttct 82



to top

>dbj|AP004410.1| Lamprogrammus niger mitochondrial DNA, complete genome
          Length = 16564

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 20   accctcgtactttacatca 38
            |||||||||||||||||||
Sbjct: 7272 accctcgtactttacatca 7290



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 55/67 (82%)
 Strand = Plus / Minus

                                                                        
Query: 131  acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcag 190
            |||| ||||| |||||||| |||||  | | ||| ||||||||||| || ||||| ||| 
Sbjct: 1777 actttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaa 1718

                   
Query: 191  ggtggtc 197
            |||||||
Sbjct: 1717 ggtggtc 1711



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 49/59 (83%)
 Strand = Plus / Minus

                                                                      
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 189
           |||| ||||| ||||||||||| ||  | | ||| ||||||||||| || |||||||||
Sbjct: 686 actttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggca 628



to top

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 46/55 (83%)
 Strand = Plus / Minus

                                                                  
Query: 131 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 185
           |||| ||||| |||||||| |||||  | ||||| || ||||||||||| |||||
Sbjct: 621 actttccgggaacaaagtttgtggcatatgcccaagcattgttgttgactgggtc 567


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,096,150
Number of Sequences: 3902068
Number of extensions: 1096150
Number of successful extensions: 56535
Number of sequences better than 10.0: 220
Number of HSP's better than 10.0 without gapping: 221
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56058
Number of HSP's gapped (non-prelim): 475
length of query: 198
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 176
effective length of database: 17,147,199,772
effective search space: 3017907159872
effective search space used: 3017907159872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top