>gb|AC157087.2| Mus musculus BAC clone RP23-287O24 from chromosome 9, complete sequence
          Length = 226149

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 89     cagcacagcaagcaattttt 108
              ||||||||||||||||||||
Sbjct: 143130 cagcacagcaagcaattttt 143149

>ref|XM_633088.1| Dictyostelium discoideum hypothetical protein (DDB0186624), partial
           mRNA
          Length = 3117

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 24  tttcattttcattttgggta 43
           ||||||||||||||||||||
Sbjct: 352 tttcattttcattttgggta 333

>gb|CY010825.1| Influenza A virus (A/New York/638/1995(H1N1)) segment 3, complete
            sequence
          Length = 2207

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|AC183680.3| Pan troglodytes BAC clone CH251-425K14 from chromosome 9, complete
              sequence
          Length = 163619

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     catttcattttcattttggg 41
              ||||||||||||||||||||
Sbjct: 142841 catttcattttcattttggg 142822

>emb|CR853281.6| Zebrafish DNA sequence from clone DKEYP-108B5 in linkage group 7,
             complete sequence
          Length = 77894

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    atttcattttcattttgggt 42
             ||||||||||||||||||||
Sbjct: 49686 atttcattttcattttgggt 49705

>emb|CR388383.9| Zebrafish DNA sequence from clone CH211-179P9 in linkage group 16,
             complete sequence
          Length = 145770

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 272   gttgccaggatacaaggccc 291
             ||||||||||||||||||||
Sbjct: 84630 gttgccaggatacaaggccc 84649

>gb|AY849786.1| Influenza A virus (A/chicken/TX/167280-4/02(H5N3)) polymerase protein
            (PA) gene, complete cds
          Length = 2151

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1735 tcccccatttcattttgattttgg 1712

>gb|CY010745.1| Influenza A virus (A/New York/644/1995(H1N1)) segment 3, complete
            sequence
          Length = 2206

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>emb|AL031275.1|HS10C16 Human DNA sequence from clone RP1-10C16 on chromosome 1q24.1-24.3
             Contains two novel genes and a CpG island, complete
             sequence
          Length = 109821

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    catttcattttcattttggg 41
             ||||||||||||||||||||
Sbjct: 14572 catttcattttcattttggg 14591

>gb|CY010545.1| Influenza A virus (A/New York/627/1995(H1N1)) segment 3, complete
            sequence
          Length = 2207

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|CY010537.1| Influenza A virus (A/New York/621/1995(H1N1)) segment 3, complete
            sequence
          Length = 2206

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|CY010529.1| Influenza A virus (A/New York/620/1995(H1N1)) segment 3, complete
            sequence
          Length = 2205

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|CY010513.1| Influenza A virus (A/New York/615/1995(H1N1)) segment 3, complete
            sequence
          Length = 2206

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|CY010505.1| Influenza A virus (A/New York/607/1995(H1N1)) segment 3, complete
            sequence
          Length = 2206

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|CY010497.1| Influenza A virus (A/New York/605/1995(H1N1)) segment 3, complete
            sequence
          Length = 2206

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|CY010489.1| Influenza A virus (A/New York/604/1995(H1N1)) segment 3, complete
            sequence
          Length = 2206

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1748 tcccccatttcattttaattttgg 1725

>gb|CY000454.2| Influenza A virus (A/New York/146/2000(H1N1)) segment 3, complete
            sequence
          Length = 2229

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1755 tcccccatttcattttaattttgg 1732

>gb|AF398864.1| Influenza A virus (A/Charlottesville/28/95(H1N1)) PA (PA) gene,
            complete cds
          Length = 2219

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1757 tcccccatttcattttaattttgg 1734

>gb|AF398863.1| Influenza A virus (A/Charlottesville/31/95(H1N1)) delNA-31 PA (PA)
            gene, complete cds
          Length = 2213

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1754 tcccccatttcattttaattttgg 1731

>gb|AF398862.1| Influenza A virus (A/Charlottesville/31/95(H1N1)) PA (PA) gene,
            complete cds
          Length = 2198

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1735 tcccccatttcattttaattttgg 1712

>gb|CY008153.1| Influenza A virus (A/New York/307/2001(H1N1)) segment 3, complete
            sequence
          Length = 2183

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1747 tcccccatttcattttaattttgg 1724

>gb|AF258519.1|AF258519 Influenza A virus (A/Hong Kong/427/98(H1N1)) PA gene, complete cds
          Length = 2202

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1754 tcccccatttcattttaattttgg 1731

>gb|CY005893.1| Influenza A virus (A/pheasant/MN/917/1980(H7N3)) segment 3, complete
            sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY005871.1| Influenza A virus (A/pigeon/MN/1407/1981(H1N1)) segment 3, complete
            sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY004479.1| Influenza A virus (A/pintail duck/ALB/219/1977(H1N1)) segment 3,
            complete sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY004304.1| Influenza A virus (A/mallard duck/ALB/31/1976(H3N8)) segment 3,
            complete sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY004183.1| Influenza A virus (A/blue-winged teal/ALB/685/1982(H6N4)) segment 3,
            complete sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY004030.1| Influenza A virus (A/mallard duck/ALB/290/1978(H6N2)) segment 3,
            complete sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY004023.1| Influenza A virus (A/mallard duck/ALB/280/1978(H6N2)) segment 3,
            complete sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY004009.1| Influenza A virus (A/blue-winged teal/ALB/368/1978(H6N8)) segment 3,
            complete sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|CY004004.1| Influenza A virus (A/mallard duck/ALB/250/1978(H6N2)) segment 3,
            complete sequence
          Length = 2233

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1759 tcccccatttcattttgattttgg 1736

>gb|AF156451.1|AF156451 Influenza A virus (A/Quail/Hong Kong/AF157/92(H9N2)) segment 3
            polymerase (PA) gene, partial cds
          Length = 2148

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1735 tcccccatttcattttaattttgg 1712

>gb|AF156457.1|AF156457 Influenza A virus (A/Turkey/California/189/66(H9N2)) segment 3
            polymerase (PA) gene, partial cds
          Length = 2140

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 17   tcccccatttcattttcattttgg 40
            |||||||||||||||| |||||||
Sbjct: 1735 tcccccatttcattttgattttgg 1712

>emb|CT573422.5| Mouse DNA sequence from clone RP24-76M8 on chromosome 9, complete
             sequence
          Length = 193236

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 89    cagcacagcaagcaattttt 108
             ||||||||||||||||||||
Sbjct: 87433 cagcacagcaagcaattttt 87452

>emb|AL671977.8| Mouse DNA sequence from clone RP23-171A16 on chromosome X, complete
              sequence
          Length = 193108

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     ccatttcattttcattttgg 40
              ||||||||||||||||||||
Sbjct: 177634 ccatttcattttcattttgg 177653


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,825,050
Number of Sequences: 3902068
Number of extensions: 2825050
Number of successful extensions: 66666
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66617
Number of HSP's gapped (non-prelim): 49
length of query: 302
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 280
effective length of database: 17,147,199,772
effective search space: 4801215936160
effective search space used: 4801215936160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)