Clone Information

BLAST Search Result

Clone Name	rbaet64f11
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	ref\|NM_191387.1\| Oryza sativa (japonica cultivar-group), predic...	54	4e-04
2	dbj\|AB110205.1\| Oryza sativa (japonica cultivar-group) mRNA for ...	54	4e-04
3	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	54	4e-04
4	dbj\|AP003371.5\| Oryza sativa (japonica cultivar-group) genomic D...	54	4e-04
5	dbj\|AP003377.3\| Oryza sativa (japonica cultivar-group) genomic D...	54	4e-04
6	ref\|XM_640022.1\| Dictyostelium discoideum hypothetical protein (...	50	0.006
7	ref\|NM_172512.1\| Mus musculus GA repeat binding protein, beta 2 ...	50	0.006
8	gb\|AC158220.4\| Mus musculus chromosome 7, clone RP23-278M8, comp...	50	0.006
9	gb\|AC115680.3\| Dictyostelium discoideum chromosome 2 map 4915084...	50	0.006
10	ref\|XM_721979.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	50	0.006
11	gb\|AC083801.20\| Homo sapiens 3 BAC RP11-646E18 (Roswell Park Can...	50	0.006
12	dbj\|AK141382.1\| Mus musculus 7 days embryo whole body cDNA, RIKE...	50	0.006
13	dbj\|AK137604.1\| Mus musculus adult male bone cDNA, RIKEN full-le...	50	0.006
14	dbj\|AK163329.1\| Mus musculus 2 cells egg cDNA, RIKEN full-length...	50	0.006
15	dbj\|AK036692.1\| Mus musculus adult male bone cDNA, RIKEN full-le...	50	0.006
16	gb\|AC084272.41\| Mus musculus strain C57BL/6J clone rp23-11g21 ma...	50	0.006
17	gb\|AC148986.5\| Mus musculus BAC clone RP23-89A16 from chromosome...	50	0.006
18	dbj\|AK030849.1\| Mus musculus adult male thymus cDNA, RIKEN full-...	50	0.006
19	gb\|AC068609.3\| Mus musculus strain C57BL6/J chromosome 5 clone R...	50	0.006
20	gb\|AC141883.4\| Mus musculus BAC clone RP24-128P19 from 7, comple...	50	0.006
21	gb\|AC140190.3\| Mus musculus BAC clone RP24-372P19 from 3, comple...	50	0.006
22	emb\|AL935127.9\| Mouse DNA sequence from clone RP23-431O5 on chro...	50	0.006
23	ref\|XM_640896.1\| Dictyostelium discoideum hypothetical protein (...	48	0.022
24	ref\|XM_634994.1\| Dictyostelium discoideum hypothetical protein (...	48	0.022
25	gb\|AC113005.10\| Mus musculus chromosome 3, clone RP23-299B23, co...	48	0.022
26	gb\|AC161496.6\| Mus musculus chromosome 3, clone RP23-119A9, comp...	48	0.022
27	ref\|XM_866375.1\| PREDICTED: Bos taurus similar to p21-activated ...	48	0.022
28	ref\|XM_878292.1\| PREDICTED: Bos taurus similar to p21-activated ...	48	0.022
29	ref\|XM_614322.2\| PREDICTED: Bos taurus similar to p21-activated ...	48	0.022
30	ref\|XM_453769.1\| Kluyveromyces lactis NRRL Y-1140, KLLA0D16093g ...	48	0.022
31	gb\|AC090437.62\| Mus musculus strain C57BL/6J clone rp23-11f20 ma...	48	0.022
32	ref\|XM_846255.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
33	ref\|XM_858440.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
34	ref\|XM_858402.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
35	ref\|XM_858383.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
36	ref\|XM_858358.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
37	ref\|XM_858334.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
38	ref\|XM_549187.2\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
39	ref\|XM_858293.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
40	ref\|XM_858267.1\| PREDICTED: Canis familiaris similar to Serine/t...	48	0.022
41	gb\|AC124458.5\| Mus musculus BAC clone RP24-136E11 from chromosom...	48	0.022
42	ref\|XM_816625.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	48	0.022
43	ref\|XM_645556.1\| Entamoeba histolytica HM-1:IMSS hypothetical pr...	48	0.022
44	ref\|XM_722376.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	48	0.022
45	ref\|XM_670165.1\| Plasmodium berghei strain ANKA hypothetical pro...	48	0.022
46	gb\|AC110236.8\| Mus musculus chromosome 15, clone RP23-104L4, com...	48	0.022
47	ref\|XM_787432.1\| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.022
48	emb\|CR382124.1\| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	48	0.022
49	emb\|AL163763.1\|ATF18O21 Arabidopsis thaliana DNA chromosome 3, B...	48	0.022
50	emb\|AL157735.2\|ATT6D9 Arabidopsis thaliana DNA chromosome 3, BAC...	48	0.022
51	emb\|AL138657.1\|ATF9K21 Arabidopsis thaliana DNA chromosome 3, BA...	48	0.022
52	emb\|BX548069.7\| Zebrafish DNA sequence from clone CH211-238G23 i...	48	0.022
53	ref\|XM_689761.1\| PREDICTED: Danio rerio similar to B-cell CLL/ly...	48	0.022
54	gb\|AC151521.2\| Medicago truncatula chromosome 7 BAC clone mte1-4...	48	0.022
55	ref\|XM_627325.1\| Cryptosporidium parvum Iowa II hypothetical pro...	48	0.022
56	gb\|AE016814.1\| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	48	0.022
57	gb\|AC132660.7\| Homo sapiens 3 BAC RP11-482K2 (Roswell Park Cance...	48	0.022
58	emb\|BX005290.10\| Zebrafish DNA sequence from clone CH211-127M10 ...	48	0.022
59	ref\|NM_207963.1\| Eremothecium gossypii AAR069Wp (AAR069W), mRNA	48	0.022
60	gb\|AC112948.12\| Mus musculus chromosome 8, clone RP23-299I18, co...	48	0.022
61	emb\|AL954867.12\| Zebrafish DNA sequence from clone DKEY-1G17 in ...	48	0.022
62	emb\|AL589876.11\| Mouse DNA sequence from clone RP23-117O11 on ch...	48	0.022
63	gb\|AC110510.6\| Mus musculus chromosome 1, clone RP24-503F14, com...	46	0.086
64	ref\|NM_115728.3\| Arabidopsis thaliana structural constituent of ...	46	0.086
65	ref\|NM_118270.1\| Arabidopsis thaliana unknown protein AT4G21500 ...	46	0.086
66	ref\|XM_630095.1\| Dictyostelium discoideum hypothetical protein (...	46	0.086
67	gb\|AY023640.1\| Oryza sativa microsatellite MRG5965 containing (T...	46	0.086
68	gb\|AC121149.12\| Mus musculus chromosome 3, clone RP24-383A4, com...	46	0.086
69	gb\|AC102874.7\| Mus musculus chromosome 1, clone RP24-500O1, comp...	46	0.086
70	ref\|XM_462373.1\| Debaryomyces hansenii CBS767 hypothetical prote...	46	0.086
71	gb\|AC151805.20\| Medicago truncatula clone mth2-59n17, complete s...	46	0.086
72	gb\|AC121785.3\| Mus musculus BAC clone RP23-382K4 from chromosome...	46	0.086
73	gb\|AC170084.13\| Medicago truncatula clone mth2-156k10, complete ...	46	0.086
74	gb\|BT012181.1\| Arabidopsis thaliana At4g21500 gene, complete cds	46	0.086
75	gb\|AC165415.5\| Mus musculus chromosome 15, clone RP23-17G19, com...	46	0.086
76	ref\|XM_985228.1\| PREDICTED: Mus musculus HECT, C2 and WW domain ...	46	0.086
77	ref\|XM_985267.1\| PREDICTED: Mus musculus HECT, C2 and WW domain ...	46	0.086
78	ref\|XM_919112.2\| PREDICTED: Mus musculus HECT, C2 and WW domain ...	46	0.086
79	ref\|XM_919097.2\| PREDICTED: Mus musculus HECT, C2 and WW domain ...	46	0.086
80	ref\|XM_897876.2\| PREDICTED: Mus musculus HECT, C2 and WW domain ...	46	0.086
81	ref\|XM_897863.2\| PREDICTED: Mus musculus HECT, C2 and WW domain ...	46	0.086
82	emb\|CR847978.17\| Zebrafish DNA sequence from clone CH211-209D14 ...	46	0.086
83	gb\|AC125782.2\| Oryza sativa (japonica cultivar-group) chromosome...	46	0.086
84	ref\|XM_723174.1\| Plasmodium yoelii yoelii str. 17XNL latency ass...	46	0.086
85	ref\|XM_786624.1\| PREDICTED: Strongylocentrotus purpuratus simila...	46	0.086
86	emb\|AL031943.11\|HS223B1 Human DNA sequence from clone RP1-223B1 ...	46	0.086
87	gb\|AC145349.1\| Oryza sativa (japonica cultivar-group) chromosome...	46	0.086
88	gb\|AY224392.1\| Human adenovirus type 2 strain KNIH Ad 01/2 hexon...	46	0.086
89	gb\|AY224391.1\| Human adenovirus type 2 strain KNIH Ad 00/3 hexon...	46	0.086
90	gb\|AY070404.1\| Arabidopsis thaliana unknown protein (At3g58660) ...	46	0.086
91	emb\|CR382139.1\| Debaryomyces hansenii chromosome G of strain CBS...	46	0.086
92	emb\|AL353032.1\|ATT20N10 Arabidopsis thaliana DNA chromosome 3, B...	46	0.086
93	emb\|AL163652.1\|ATT28J14 Arabidopsis thaliana DNA chromosome 5, B...	46	0.086
94	emb\|AL161555.2\|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, ...	46	0.086
95	emb\|AL022603.1\|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BA...	46	0.086
96	emb\|AJ293905.1\|HAD293905 Human adenovirus type 2 hexon gene, iso...	46	0.086
97	emb\|AJ293904.1\|HAD293904 Human adenovirus type 2 hexon gene, iso...	46	0.086
98	emb\|AJ293902.1\|HAD293902 Human adenovirus type 2 hexon gene, iso...	46	0.086
99	emb\|AJ293901.1\|HAD293901 Human adenovirus type 2 hexon gene, iso...	46	0.086
100	emb\|AJ278924.1\|HAD278924 Human adenovirus type 2 hexon gene, iso...	46	0.086
101	gb\|AC163614.4\| Mus musculus BAC clone RP23-102K8 from chromosome...	46	0.086
102	gb\|DQ115418.1\| Human adenovirus type 2 hexon protein gene, parti...	46	0.086
103	gb\|AC098719.3\| Mus musculus clone RP23-2M3, complete sequence	46	0.086
104	gb\|AC164078.4\| Mus musculus chromosome 3, clone RP23-123C15, com...	46	0.086
105	gb\|AC020616.7\| Mus musculus strain C57BL/6J clone RP23-3A24, com...	46	0.086
106	dbj\|AK221511.1\| Arabidopsis thaliana mRNA for hypothetical prote...	46	0.086
107	ref\|NM_182000.1\| Caenorhabditis elegans Y18D10A.1 (Y18D10A.1) mR...	46	0.086
108	dbj\|AK029861.1\| Mus musculus adult male testis cDNA, RIKEN full-...	46	0.086
109	ref\|XM_623936.1\| PREDICTED: Apis mellifera similar to heat shock...	46	0.086
110	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.086
111	gb\|AF322857.1\|AF322857 Danio rerio transcription factor Stat3 (s...	46	0.086
112	gb\|AC084683.1\|CBRG47P01 Caenorhabditis briggsae cosmid G47P01, c...	46	0.086
113	gb\|AF542120.1\| Human adenovirus type 2 strain KNIH Ad00/4 hexon ...	46	0.086
114	gb\|AF542118.1\| Human adenovirus type 2 strain KNIH Ad00/1 hexon ...	46	0.086
115	dbj\|AK172932.1\| Mus musculus mRNA for mKIAA0322 protein	46	0.086
116	dbj\|AB083710.1\| Mus musculus NEDL1 mRNA for HECT type E3 ubiquit...	46	0.086
117	gb\|AC154511.2\| Mus musculus BAC clone RP24-69N19 from 13, comple...	46	0.086
118	emb\|AL672063.36\| Mouse DNA sequence from clone RP23-65A22 on chr...	46	0.086
119	gb\|AC137126.13\| Mus musculus chromosome 15, clone RP24-250I9, co...	46	0.086
120	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	46	0.086
121	emb\|AL034393.1\|CEY18D10A Caenorhabditis elegans YAC Y18D10A, com...	46	0.086
122	emb\|AL163912.1\|ATT2I1 Arabidopsis thaliana DNA chromosome 5, BAC...	46	0.086
123	gb\|AC149588.4\| Mus musculus BAC clone RP23-366I10 from 15, compl...	46	0.086
124	dbj\|AP006658.1\| Lotus japonicus genomic DNA, chromosome 4, clone...	46	0.086
125	dbj\|AP006113.1\| Lotus japonicus genomic DNA, chromosome 4, clone...	46	0.086
126	dbj\|AP004896.1\| Lotus japonicus genomic DNA, chromosome 5, clone...	46	0.086
127	gb\|J01917.1\|ADRCG Adenovirus type 2, complete genome	46	0.086
128	emb\|AL929421.7\| Mouse DNA sequence from clone RP23-284N23 on chr...	46	0.086
129	ref\|NM_117893.3\| Arabidopsis thaliana unknown protein AT4G17840 ...	44	0.34
130	ref\|NM_100126.3\| Arabidopsis thaliana unknown protein AT1G02450 ...	44	0.34
131	ref\|NM_126630.1\| Arabidopsis thaliana AtGRF6 (GROWTH-REGULATING ...	44	0.34
132	gb\|AC121304.7\| Mus musculus chromosome 3, clone RP24-63C3, compl...	44	0.34
133	gb\|AC119269.9\| Mus musculus chromosome 5, clone RP24-324B22, com...	44	0.34
134	ref\|XM_641401.1\| Dictyostelium discoideum hypothetical protein (...	44	0.34
135	gb\|AY440873.1\| Armigeres subalbatus ASAP ID: 42423 unknown mRNA ...	44	0.34
136	gb\|AC116895.12\| Mus musculus chromosome 8, clone RP24-531C8, com...	44	0.34
137	gb\|AC114512.5\| Rattus norvegicus 5 BAC CH230-5N9 (Children's Hos...	44	0.34
138	gb\|AC121292.9\| Mus musculus chromosome 1, clone RP23-172B15, com...	44	0.34
139	gb\|AC131725.2\| Mus musculus BAC clone RP23-129H16 from chromosom...	44	0.34
140	ref\|XM_705388.1\| Candida albicans SC5314 hypothetical protein (C...	44	0.34
141	gb\|AC102554.7\| Mus musculus chromosome 9, clone RP23-159E10, com...	44	0.34
142	gb\|AC060781.8\| Mus musculus chromosome 19, clone RP23-196A19, co...	44	0.34
143	gb\|AC162887.5\| Mus musculus chromosome 19, clone RP23-414O6, com...	44	0.34
144	gb\|AC124374.5\| Mus musculus BAC clone RP24-567K8 from chromosome...	44	0.34
145	ref\|XM_448393.1\| Candida glabrata CBS138, CAGL0K03861g partial mRNA	44	0.34
146	ref\|XM_810077.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	44	0.34
147	gb\|AC126032.4\| Mus musculus BAC clone RP24-94B12 from chromosome...	44	0.34
148	gb\|AC131676.2\| Mus musculus BAC clone RP23-330L3 from chromosome...	44	0.34
149	gb\|AC122317.4\| Mus musculus BAC clone RP23-304C21 from 12, compl...	44	0.34
150	ref\|XM_721334.1\| Plasmodium yoelii yoelii str. 17XNL RNA 3'-term...	44	0.34
151	ref\|XM_725280.1\| Plasmodium yoelii yoelii str. 17XNL protein kin...	44	0.34
152	ref\|XM_536202.2\| PREDICTED: Canis familiaris similar to adaptor-...	44	0.34
153	ref\|XM_855529.1\| PREDICTED: Canis familiaris similar to adaptor-...	44	0.34
154	ref\|XM_740949.1\| Plasmodium chabaudi chabaudi minichromosome mai...	44	0.34
155	ref\|XM_662188.1\| Cryptosporidium hominis TU502 hypothetical prot...	44	0.34
156	gb\|AC160124.3\| Mus musculus BAC clone RP23-297P22 from chromosom...	44	0.34
157	emb\|AL589684.7\| Human DNA sequence from clone RP11-437J19 on chr...	44	0.34
158	gb\|AC073939.6\| Mus musculus strain C57BL/6J chromosome 12 clone ...	44	0.34
159	gb\|AC158590.3\| Mus musculus chromosome 5, clone RP24-388K6, comp...	44	0.34
160	emb\|CR380957.1\| Candida glabrata strain CBS138 chromosome K comp...	44	0.34
161	emb\|AL161547.2\|ATCHRIV47 Arabidopsis thaliana DNA chromosome 4, ...	44	0.34
162	emb\|AL021889.2\|ATT6K21 Arabidopsis thaliana DNA chromosome 4, BA...	44	0.34
163	gb\|AC160633.3\| Mus musculus chromosome 8, clone RP23-407P24, com...	44	0.34
164	gb\|AC159886.2\| Mus musculus BAC clone RP24-397P9 from chromosome...	44	0.34
165	gb\|AY125572.1\| Arabidopsis thaliana At2g06200/F5K7.4 mRNA, compl...	44	0.34
166	gb\|AC093318.52\| Mus musculus strain C57BL/6J clone rp23-252h7 ma...	44	0.34
167	gb\|AC006413.4\| Arabidopsis thaliana chromosome 2 clone F5K7 map ...	44	0.34
168	gb\|AC092295.2\| Homo sapiens chromosome 19 clone CTD-2630F21, com...	44	0.34
169	gb\|AC087098.8\| Genomic sequence for Mus musculus, clone RP23-206...	44	0.34
170	gb\|AY060586.1\| Arabidopsis thaliana At2g06200/F5K7.4 mRNA, compl...	44	0.34
171	gb\|AC154596.2\| Mus musculus BAC clone RP23-354C17 from chromosom...	44	0.34
172	gb\|DQ066852.1\| Strongylocentrotus purpuratus clone A22 extracell...	44	0.34
173	gb\|AC160090.4\| Mus musculus 6 BAC RP23-322E20 (Roswell Park Canc...	44	0.34
174	gb\|AC154004.7\| Mus musculus 6 BAC RP24-169F24 (Roswell Park Canc...	44	0.34
175	gb\|AC153935.2\| Mus musculus 10 BAC RP24-273A2 (Roswell Park Canc...	44	0.34
176	gb\|AC158607.7\| Mus musculus 10 BAC RP23-183G4 (Roswell Park Canc...	44	0.34
177	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.34
178	emb\|BX828322.1\|CNS0A3W2 Arabidopsis thaliana Full-length cDNA Co...	44	0.34
179	emb\|BX827730.1\|CNS0A3VA Arabidopsis thaliana Full-length cDNA Co...	44	0.34
180	emb\|BX827424.1\|CNS0A3NZ Arabidopsis thaliana Full-length cDNA Co...	44	0.34
181	gb\|BT003662.1\| Arabidopsis thaliana At1g02450 mRNA, complete cds	44	0.34
182	gb\|AC022521.4\|AC022521 Arabidopsis thaliana chromosome I BAC T14...	44	0.34
183	ref\|XM_216034.3\| PREDICTED: Rattus norvegicus CDKN1A interacting...	44	0.34
184	gb\|AC064879.3\|AC064879 Arabidopsis thaliana chromosome I BAC T6A...	44	0.34
185	gb\|AC009756.9\|AC009756 Homo sapiens, clone RP11-45P2, complete s...	44	0.34
186	gb\|AC134587.3\| Mus musculus BAC clone RP23-306P12 from chromosom...	44	0.34
187	emb\|AL845323.18\| Mouse DNA sequence from clone RP23-304D11 on ch...	44	0.34
188	dbj\|AK119149.1\| Arabidopsis thaliana At1g02450 mRNA for unknown ...	44	0.34
189	emb\|AJ250184.1\|ATH250184 Arabidopsis thaliana mRNA for NIMIN-1 p...	44	0.34
190	gb\|AC140381.3\| Mus musculus BAC clone RP23-176M4 from 10, comple...	44	0.34
191	tpe\|BN000872.1\| TPA: TPA_exp: Mus musculus immunoglobulin heavy ...	44	0.34
192	gb\|AC007759.1\|AC007759 Homo sapiens chromosome 19, cosmid R27714...	44	0.34
193	gb\|AC122205.6\| Mus musculus BAC clone RP23-76C13 from chromosome...	44	0.34
194	gb\|AC120412.12\| Mus musculus chromosome 5, clone RP24-447P14, co...	44	0.34
195	gb\|AC102602.9\| Mus musculus chromosome 9, clone RP23-381L11, com...	44	0.34
196	gb\|AC163348.5\| Mus musculus BAC clone RP23-230L2 from chromosome...	44	0.34
197	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.34
198	emb\|AL731744.6\|CNS08C7T Oryza sativa chromosome 12, . BAC OSJNBa...	44	0.34
199	gb\|AC140250.3\| Mus musculus BAC clone RP24-288J3 from 1, complet...	44	0.34
200	emb\|CT025674.13\| Mouse DNA sequence from clone RP24-364I17 on ch...	44	0.34
201	gb\|AC134598.3\| Mus musculus BAC clone RP23-175C23 from 8, comple...	44	0.34
202	gb\|AC134249.4\| Mus musculus BAC clone RP23-359K17 from 12, compl...	44	0.34
203	emb\|CT030654.8\| Mouse DNA sequence from clone RP23-332G16 on chr...	44	0.34
204	gb\|AC167020.3\| Mus musculus BAC clone RP23-201I6 from chromosome...	44	0.34
205	gb\|AC153936.3\| Mus musculus 10 BAC RP24-114G19 (Roswell Park Can...	44	0.34
206	emb\|AL671520.6\| Mouse DNA sequence from clone RP23-99G21 on chro...	44	0.34
207	gb\|AC118475.44\| Mus musculus chromosome 13, clone RP23-359G8, co...	44	0.34
208	gb\|AC110244.10\| Mus musculus chromosome 5, clone RP23-247E10, co...	42	1.4
209	gb\|AC130283.8\| Mus musculus chromosome 15, clone RP23-136E18, co...	42	1.4
210	gb\|AC132899.11\| Mus musculus chromosome 15, clone RP24-367P22, c...	42	1.4
211	gb\|BC108726.1\| Homo sapiens cDNA clone MGC:131940 IMAGE:5194296,...	42	1.4
212	ref\|NM_129199.1\| Arabidopsis thaliana unknown protein AT2G36420 ...	42	1.4
213	ref\|NM_128900.2\| Arabidopsis thaliana unknown protein AT2G33400 ...	42	1.4
214	ref\|NM_103511.3\| Arabidopsis thaliana SEU (SEUSS); transcription...	42	1.4
215	ref\|NM_115653.1\| Arabidopsis thaliana nucleic acid binding AT3G5...	42	1.4
216	gb\|AC140431.4\| Mus musculus BAC clone RP24-172K3 from chromosome...	42	1.4
217	gb\|AC161810.10\| Mus musculus chromosome 3, clone RP24-363L5, com...	42	1.4
218	gb\|AY953294.1\| Sparus aurata skeletal troponin T mRNA, complete cds	42	1.4
219	gb\|AC137127.11\| Mus musculus chromosome 9, clone RP24-264F17, co...	42	1.4
220	gb\|AC116375.11\| Mus musculus chromosome 5, clone RP24-197K18, co...	42	1.4
221	ref\|XM_511457.1\| PREDICTED: Pan troglodytes similar to Dopamine-...	42	1.4
222	gb\|AC131975.28\| Mus musculus chromosome 17, clone RP24-146B4, co...	42	1.4
223	ref\|XM_631827.1\| Dictyostelium discoideum hypothetical protein (...	42	1.4
224	gb\|AC161194.14\| Mus musculus chromosome 15, clone RP23-345C13, c...	42	1.4
225	gb\|AC115006.12\| Mus musculus chromosome 8, clone RP24-184D21, co...	42	1.4
226	gb\|AY773858.1\| Arabidopsis thaliana clone pENTR221-At2g33400 hyp...	42	1.4
227	gb\|AC123713.13\| Mus musculus chromosome 7, clone RP23-391D20, co...	42	1.4
228	ref\|XM_642353.1\| Dictyostelium discoideum SMAD/FHA domain-contai...	42	1.4
229	ref\|XM_641540.1\| Dictyostelium discoideum putative GATA-binding ...	42	1.4
230	gb\|AC123060.4\| Mus musculus chromosome 6 clone RP23-214M22, comp...	42	1.4
231	gb\|AC135720.8\| Mus musculus chromosome 15, clone RP24-298F20, co...	42	1.4
232	ref\|XM_638676.1\| Dictyostelium discoideum hypothetical protein (...	42	1.4
233	ref\|XM_630974.1\| Dictyostelium discoideum hypothetical protein (...	42	1.4
234	ref\|XM_630226.1\| Dictyostelium discoideum hypothetical protein (...	42	1.4
235	gb\|AC159309.2\| Mus musculus BAC clone RP23-157H14 from chromosom...	42	1.4
236	gb\|AC165247.2\| Mus musculus BAC clone RP24-213G21 from chromosom...	42	1.4
237	gb\|AC162799.4\| Mus musculus BAC clone RP24-392E13 from chromosom...	42	1.4
238	gb\|AC166097.5\| Mus musculus BAC clone RP24-447P10 from chromosom...	42	1.4
239	gb\|AC165236.5\| Mus musculus chromosome 5, clone RP23-348C18, com...	42	1.4
240	ref\|XM_510635.1\| PREDICTED: Pan troglodytes similar to KIAA0596 ...	42	1.4
241	gb\|BC059793.1\| Danio rerio v-myc myelocytomatosis viral related ...	42	1.4
242	gb\|BC067586.1\| Danio rerio v-myc myelocytomatosis viral related ...	42	1.4
243	ref\|XM_524732.1\| PREDICTED: Pan troglodytes similar to mesoderm ...	42	1.4
244	ref\|NM_015884.1\| Homo sapiens membrane-bound transcription facto...	42	1.4
245	gb\|AC166646.4\| Mus musculus chromosome 3, clone RP24-400P18, com...	42	1.4
246	gb\|AC109149.15\| Mus musculus chromosome 19, clone RP24-178F17, c...	42	1.4
247	gb\|AC111130.17\| Mus musculus chromosome 5, clone RP23-339G19, co...	42	1.4
248	gb\|AC153607.15\| Mus musculus 6 BAC RP23-100I21 (Roswell Park Can...	42	1.4
249	gb\|DP000013.1\| Otolemur garnettii target 1 genomic scaffold	42	1.4
250	gb\|AC115868.12\| Mus musculus chromosome 7, clone RP24-329F21, co...	42	1.4
251	gb\|AC113469.9\| Mus musculus chromosome 8, clone RP23-261B5, comp...	42	1.4
252	gb\|AF106329.1\| Escherichia coli plasmid F putative methyltransfe...	42	1.4
253	ref\|NM_212614.1\| Danio rerio v-myc myelocytomatosis viral relate...	42	1.4
254	gb\|AC157991.5\| Mus musculus chromosome 18, clone RP23-335B10, co...	42	1.4
255	gb\|AF155607.1\| Polistes dominulus microsatellite Pdom117 sequence	42	1.4
256	gb\|CP000079.1\| Leishmania major strain Friedlin chromosome 27, c...	42	1.4
257	gb\|AE017346.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	1.4
258	gb\|AE017343.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	1.4
259	gb\|AC135957.3\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.4
260	gb\|AC138210.10\| Mus musculus chromosome 1, clone RP23-346B12, co...	42	1.4
261	gb\|AC109268.10\| Mus musculus chromosome 1, clone RP23-305F24, co...	42	1.4
262	gb\|AC118592.7\| Mus musculus chromosome 7, clone RP24-463B5, comp...	42	1.4
263	gb\|AC102124.16\| Mus musculus chromosome 18, clone RP23-188D1, co...	42	1.4
264	gb\|AC101391.15\| Mus musculus chromosome 5, clone RP23-119E13, co...	42	1.4
265	gb\|AC117721.8\| Mus musculus chromosome 1, clone RP24-196D2, comp...	42	1.4
266	gb\|AF235097.2\| Homo sapiens chromosome X multiple clones map p11...	42	1.4
267	gb\|AC165090.3\| Mus musculus BAC clone RP23-95H4 from chromosome ...	42	1.4
268	gb\|AC164430.3\| Mus musculus BAC clone RP23-441D9 from chromosome...	42	1.4
269	gb\|AC151967.6\| Mus musculus BAC clone RP24-235L23 from chromosom...	42	1.4
270	gb\|AC144519.4\| Mus musculus BAC clone RP24-325A1 from chromosome...	42	1.4
271	gb\|AC167171.2\| Mus musculus BAC clone RP23-409H8 from chromosome...	42	1.4
272	gb\|AC164700.3\| Mus musculus BAC clone RP24-548M16 from chromosom...	42	1.4
273	gb\|AC161229.10\| Mus musculus chromosome 7, clone RP24-88J19, com...	42	1.4
274	gb\|AC123708.17\| Mus musculus chromosome 9, clone RP23-366E1, com...	42	1.4
275	gb\|AY522332.4\| Agrotis segetum granulovirus, complete genome	42	1.4
276	gb\|U50066.1\| Caenorhabditis elegans cosmid T14A8, complete sequence	42	1.4
277	gb\|AC115718.14\| Mus musculus chromosome 8, clone RP23-247P3, com...	42	1.4
278	gb\|AC123658.9\| Mus musculus chromosome 15, clone RP23-192C13, co...	42	1.4
279	gb\|AC119197.9\| Mus musculus chromosome 8, clone RP24-180H20, com...	42	1.4
280	gb\|AC117784.13\| Mus musculus chromosome 15, clone RP24-545F24, c...	42	1.4
281	gb\|AC131989.8\| Mus musculus chromosome 14, clone RP24-186N15, co...	42	1.4
282	ref\|XM_417634.1\| PREDICTED: Gallus gallus similar to zinc finger...	42	1.4
283	gb\|AC161409.11\| Mus musculus chromosome 7, clone RP23-292B24, co...	42	1.4
284	gb\|AC124614.11\| Mus musculus chromosome 10, clone RP24-417L12, c...	42	1.4
285	gb\|AC117826.10\| Mus musculus chromosome 1, clone RP24-81K19, com...	42	1.4
286	gb\|AC100986.9\| Mus musculus chromosome 3, clone RP23-77E5, compl...	42	1.4
287	ref\|XM_603144.2\| PREDICTED: Bos taurus similar to a disintegrin ...	42	1.4
288	gb\|AC115784.9\| Mus musculus chromosome 15, clone RP23-170J10, co...	42	1.4
289	gb\|AC111135.10\| Mus musculus chromosome 9, clone RP23-349N4, com...	42	1.4
290	gb\|AC132352.3\| Mus musculus BAC clone RP24-97D9 from chromosome ...	42	1.4
291	gb\|AC139755.3\| Mus musculus BAC clone RP24-96N20 from chromosome...	42	1.4
292	gb\|AC091463.9\| Mus musculus chromosome 16, clone RP23-301D7, com...	42	1.4
293	gb\|AC119615.7\| Rattus norvegicus 10 NOVECTOR CH230-502G21 (Child...	42	1.4
294	gb\|BC072638.1\| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cD...	42	1.4
295	ref\|NM_005183.2\| Homo sapiens calcium channel, voltage-dependent...	42	1.4
296	ref\|XM_954184.1\| Neurospora crassa OR74A hypothetical protein (N...	42	1.4
297	gb\|AC139211.13\| Mus musculus chromosome 6, clone RP23-302O24, co...	42	1.4
298	ref\|XM_327215.1\| Neurospora crassa OR74A hypothetical protein (N...	42	1.4
299	gb\|AC091295.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	42	1.4
300	gb\|AC158556.9\| Mus musculus chromosome 15, clone RP23-140F20, co...	42	1.4
301	ref\|XM_718348.1\| Candida albicans SC5314 subtilisin-like proprot...	42	1.4
302	ref\|XM_718159.1\| Candida albicans SC5314 subtilisin-like proprot...	42	1.4
303	gb\|AC146235.2\| Pan troglodytes BAC clone CH251-212L1 from Y, com...	42	1.4
304	gb\|AC147345.2\| Pan troglodytes BAC clone CH251-8K7 from Y, compl...	42	1.4
305	gb\|AC147020.2\| Mus musculus BAC clone RP23-267A11 from chromosom...	42	1.4
306	gb\|AC142146.3\| Mus musculus BAC clone RP24-74D8 from chromosome ...	42	1.4
307	gb\|AC135240.2\| Mus musculus BAC clone RP24-63O24 from chromosome...	42	1.4
308	gb\|AC132602.2\| Mus musculus BAC clone RP23-477C13 from chromosom...	42	1.4
309	gb\|AC136019.3\| Mus musculus BAC clone RP24-404D22 from chromosom...	42	1.4
310	gb\|AC130713.4\| Mus musculus BAC clone RP23-316K10 from chromosom...	42	1.4
311	gb\|AC186184.1\| Pan troglodytes chromosome UNKNOWN clone CH251-13...	42	1.4
312	gb\|DQ387433.1\| Lytechinus variegatus Endo16 (Endo16) mRNA, compl...	42	1.4
313	gb\|AC161206.10\| Mus musculus chromosome 15, clone RP24-299A13, c...	42	1.4
314	ref\|NM_145025.2\| Homo sapiens chromosome 6 open reading frame 19...	42	1.4
315	ref\|NM_014994.1\| Homo sapiens mitogen activated protein kinase b...	42	1.4
316	gb\|AC132844.7\| Mus musculus chromosome 17, clone RP24-481P13, co...	42	1.4
317	gb\|AC133459.9\| Mus musculus chromosome 12, clone RP23-383O15, co...	42	1.4
318	gb\|AC137583.7\| Mus musculus chromosome 13, clone RP23-140F24, co...	42	1.4
319	gb\|BT012640.1\| Arabidopsis thaliana At3g57910 mRNA, complete cds	42	1.4
320	gb\|AC109170.10\| Mus musculus chromosome 8, clone RP23-87B3, comp...	42	1.4
321	emb\|AJ249803.1\|GHE249803 Gallid herpesvirus 1 UL52 gene, UL51 ge...	42	1.4
322	gb\|AC107834.13\| Mus musculus chromosome 1, clone RP23-251L12, co...	42	1.4
323	gb\|AC101559.20\| Mus musculus chromosome 5, clone RP23-194K16, co...	42	1.4
324	gb\|AC158608.10\| Mus musculus 10 BAC RP24-405N1 (Roswell Park Can...	42	1.4
325	gb\|AC111029.8\| Mus musculus chromosome 3, clone RP23-235E15, com...	42	1.4
326	gb\|AC160540.7\| Mus musculus chromosome 7, clone RP23-44O19, comp...	42	1.4
327	gb\|AC162872.9\| Mus musculus chromosome 3, clone RP24-346J6, comp...	42	1.4
328	gb\|AC165348.3\| Mus musculus BAC clone RP23-300C11 from chromosom...	42	1.4
329	gb\|BC036465.2\| Homo sapiens membrane-bound transcription factor ...	42	1.4
330	gb\|BC012905.1\| Homo sapiens membrane-bound transcription factor ...	42	1.4
331	gb\|AC163616.3\| Mus musculus BAC clone RP23-114P22 from chromosom...	42	1.4
332	gb\|AC165965.3\| Mus musculus BAC clone RP23-307L24 from chromosom...	42	1.4
333	gb\|AC122535.3\| Mus musculus BAC clone RP24-539K4 from chromosome...	42	1.4
334	ref\|XM_992125.1\| PREDICTED: Mus musculus similar to olfactory re...	42	1.4
335	ref\|XM_001001853.1\| PREDICTED: Mus musculus hypothetical protein...	42	1.4
336	gb\|AC139940.5\| Mus musculus chromosome 15, clone RP23-468K16, co...	42	1.4
337	ref\|XR_002169.1\| PREDICTED: Mus musculus hypothetical protein LO...	42	1.4
338	gb\|AC124168.3\| Mus musculus BAC clone RP23-143G9 from chromosome...	42	1.4
339	gb\|AC127248.3\| Mus musculus BAC clone RP24-442E2 from chromosome...	42	1.4
340	gb\|AC125043.4\| Mus musculus BAC clone RP23-342M4 from chromosome...	42	1.4
341	gb\|AC140233.3\| Mus musculus BAC clone RP23-282N19 from chromosom...	42	1.4
342	gb\|DQ483777.1\| Gymnogyps californianus clone 200F microsatellite...	42	1.4
343	gb\|DQ484017.1\| Gymnogyps californianus clone 183G microsatellite...	42	1.4
344	emb\|CT025636.2\| Pan troglodytes chromosome X clone RP43-029M22 m...	42	1.4
345	ref\|XM_858086.1\| PREDICTED: Canis familiaris similar to protein ...	42	1.4
346	ref\|XM_858069.1\| PREDICTED: Canis familiaris similar to protein ...	42	1.4
347	ref\|XM_858048.1\| PREDICTED: Canis familiaris similar to protein ...	42	1.4
348	ref\|XM_533762.2\| PREDICTED: Canis familiaris similar to protein ...	42	1.4
349	emb\|CT030458.1\| Xenopus tropicalis finished cDNA, clone TGas123g24	42	1.4
350	emb\|CT010581.10\| Mouse DNA sequence from clone RP23-104J14 on ch...	42	1.4
351	ref\|XM_569461.1\| Cryptococcus neoformans var. neoformans JEC21 t...	42	1.4
352	gb\|AY144106.1\| Arabidopsis thaliana hypothetical protein (At2g33...	42	1.4
353	ref\|XM_571602.1\| Cryptococcus neoformans var. neoformans JEC21 h...	42	1.4
354	gb\|AC125110.4\| Mus musculus BAC clone RP24-235E14 from chromosom...	42	1.4
355	gb\|AC126932.4\| Mus musculus BAC clone RP24-80G20 from chromosome...	42	1.4
356	gb\|AC124472.4\| Mus musculus BAC clone RP24-83E15 from chromosome...	42	1.4
357	gb\|AC123794.4\| Mus musculus BAC clone RP24-315P14 from chromosom...	42	1.4
358	gb\|AC126042.3\| Mus musculus BAC clone RP24-303J10 from chromosom...	42	1.4
359	gb\|AC122015.3\| Mus musculus BAC clone RP24-358M18 from chromosom...	42	1.4
360	gb\|AC122010.3\| Mus musculus BAC clone RP24-349I15 from chromosom...	42	1.4
361	gb\|AC132094.3\| Mus musculus BAC clone RP24-376B20 from chromosom...	42	1.4
362	gb\|AC124367.4\| Mus musculus BAC clone RP24-545D20 from chromosom...	42	1.4
363	gb\|AC122199.4\| Mus musculus BAC clone RP23-57C9 from chromosome ...	42	1.4
364	gb\|AC127349.3\| Mus musculus BAC clone RP23-62M5 from chromosome ...	42	1.4
365	gb\|AC130821.3\| Mus musculus BAC clone RP23-205K12 from chromosom...	42	1.4
366	gb\|AC123876.5\| Mus musculus BAC clone RP23-270P19 from chromosom...	42	1.4
367	ref\|XM_802350.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.4
368	ref\|XM_803664.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.4
369	ref\|XM_804623.1\| Trypanosoma cruzi strain CL Brener protein kina...	42	1.4
370	gb\|AC109247.14\| Mus musculus chromosome 9, clone RP23-462C14, co...	42	1.4
371	ref\|XM_805865.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.4
372	ref\|XM_806018.1\| Trypanosoma cruzi strain CL Brener protein kina...	42	1.4
373	ref\|XM_807249.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.4
374	gb\|AC110212.12\| Mus musculus chromosome 19, clone RP23-183H23, c...	42	1.4
375	ref\|XM_810097.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.4
376	gb\|AC121941.3\| Mus musculus BAC clone RP24-209I3 from chromosome...	42	1.4
377	ref\|XM_810409.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.4
378	gb\|AC124391.3\| Mus musculus BAC clone RP24-439L13 from chromosom...	42	1.4
379	ref\|XM_816286.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.4
380	gb\|AC121971.3\| Mus musculus BAC clone RP24-275H22 from chromosom...	42	1.4
381	gb\|BC060623.1\| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cD...	42	1.4
382	gb\|AC124487.3\| Mus musculus BAC clone RP23-452B18 from chromosom...	42	1.4
383	gb\|AC125352.4\| Mus musculus BAC clone RP23-451M13 from chromosom...	42	1.4
384	gb\|AC127282.3\| Mus musculus BAC clone RP23-318O24 from chromosom...	42	1.4
385	gb\|AC121889.3\| Mus musculus BAC clone RP24-146D9 from chromosome...	42	1.4
386	gb\|AC125049.3\| Mus musculus BAC clone RP23-367C15 from chromosom...	42	1.4
387	gb\|AC131751.2\| Mus musculus BAC clone RP23-19P8 from 10, complet...	42	1.4
388	gb\|AC124582.4\| Mus musculus BAC clone RP23-120A15 from 6, comple...	42	1.4
389	gb\|AC115291.7\| Mus musculus BAC clone RP23-65P2 from 15, complet...	42	1.4
390	gb\|AC122864.3\| Mus musculus BAC clone RP23-142M19 from 6, comple...	42	1.4
391	gb\|AC124178.3\| Mus musculus BAC clone RP23-193J15 from 18, compl...	42	1.4
392	gb\|AC122268.5\| Mus musculus BAC clone RP23-216B15 from 14, compl...	42	1.4
393	gb\|AC116323.6\| Mus musculus BAC clone RP23-281F3 from 8, complet...	42	1.4
394	gb\|AC122879.3\| Mus musculus BAC clone RP23-76C10 from 1, complet...	42	1.4
395	gb\|AC110508.8\| Mus musculus chromosome 3, clone RP23-382L1, comp...	42	1.4
396	gb\|AC104920.10\| Mus musculus chromosome 10, clone RP23-360H23, c...	42	1.4
397	gb\|AC123043.2\| Mus musculus BAC clone RP24-547G7 from 13, comple...	42	1.4
398	gb\|AC107794.13\| Mus musculus chromosome 6, clone RP23-473P21, co...	42	1.4
399	gb\|AC098723.3\| Mus musculus BAC clone RP23-3D10 from 7, complete...	42	1.4
400	gb\|AC138642.10\| Mus musculus chromosome 3, clone RP23-21O7, comp...	42	1.4
401	gb\|AC110882.13\| Mus musculus chromosome 18, clone RP23-287A10, c...	42	1.4
402	ref\|XM_760691.1\| Theileria parva strain Muguga chromosome 1 hypo...	42	1.4
403	ref\|XM_719274.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	42	1.4
404	ref\|XM_719825.1\| Plasmodium yoelii yoelii str. 17XNL hypothetica...	42	1.4
405	ref\|XM_738448.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	1.4
406	gb\|AC027269.5\| Homo sapiens BAC clone RP11-100C21 from 7, comple...	42	1.4
407	gb\|AC004015.1\| Homo sapiens BAC clone CTA-333F24 from 7, complet...	42	1.4
408	ref\|XM_731232.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	1.4
409	gb\|AY321284.1\| Echinococcus granulosus clone EgCerv-8 antigen B ...	42	1.4
410	ref\|XM_732656.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	1.4
411	ref\|XM_733967.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	1.4
412	ref\|XM_735356.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	1.4
413	gb\|AC113276.9\| Mus musculus chromosome 5, clone RP23-383E21, com...	42	1.4
414	ref\|XM_737002.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	1.4
415	gb\|AC115768.9\| Mus musculus chromosome 19, clone RP23-107E10, co...	42	1.4
416	ref\|XM_669806.1\| Plasmodium berghei strain ANKA Casein kinase II...	42	1.4
417	gb\|AC101527.12\| Mus musculus chromosome 15, clone RP23-191D20, c...	42	1.4
418	gb\|AC122734.6\| Mus musculus chromosome 10, clone RP24-108E17, co...	42	1.4
419	gb\|AC120540.6\| Mus musculus chromosome 12, clone RP23-460P20, co...	42	1.4
420	gb\|AC164570.3\| Mus musculus BAC clone CH25-194I22 from chromosom...	42	1.4
421	gb\|AC131116.3\| Mus musculus BAC clone RP24-344M21 from chromosom...	42	1.4
422	gb\|AC102637.7\| Mus musculus chromosome 6, clone RP23-216B9, comp...	42	1.4
423	gb\|AC137677.24\| Mus musculus chromosome 1, clone RP23-257D12, co...	42	1.4
424	gb\|AC141922.19\| Medicago truncatula clone mth2-9n11, complete se...	42	1.4
425	gb\|AC143341.8\| Medicago truncatula clone mth2-7a11, complete seq...	42	1.4
426	gb\|AC144931.29\| Medicago truncatula clone mth2-22b18, complete s...	42	1.4
427	gb\|AC102934.11\| Mus musculus chromosome 3, clone RP24-209C11, co...	42	1.4
428	gb\|AC116794.11\| Mus musculus chromosome 5, clone RP24-312A3, com...	42	1.4
429	gb\|AY861288.1\| Cottus gobio microsatellite LCE275 sequence	42	1.4
430	gb\|AC108554.8\| Rattus norvegicus 7 BAC CH230-81L13 (Children's H...	42	1.4
431	gb\|AC126071.5\| Rattus norvegicus 10 BAC CH230-209B21 (Children's...	42	1.4
432	gb\|AC087871.9\| Genomic sequence for Mus musculus, clone RP23-334...	42	1.4
433	emb\|Z82253.1\|HSU151E3 Human DNA sequence from clone LL0XNC01-151...	42	1.4
434	emb\|AL356093.20\| Human DNA sequence from clone RP11-382K22 on ch...	42	1.4
435	emb\|AL356414.11\| Human DNA sequence from clone RP11-352D3 on chr...	42	1.4
436	emb\|AL353135.32\| Human DNA sequence from clone RP11-63L7 on chro...	42	1.4
437	emb\|AL162377.10\| Human DNA sequence from clone RP11-327P2 on chr...	42	1.4
438	emb\|AL161730.9\| Human DNA sequence from clone RP11-441I5 on chro...	42	1.4
439	emb\|AL139216.14\| Human DNA sequence from clone RP5-1017J17 on ch...	42	1.4
440	emb\|AL157936.12\| Human DNA sequence from clone RP11-279I21 on ch...	42	1.4
441	emb\|AL139421.12\| Human DNA sequence from clone RP4-717I23 on chr...	42	1.4
442	emb\|AL157895.8\| Human DNA sequence from clone RP11-354E11 on chr...	42	1.4
443	emb\|AL139184.8\| Human DNA sequence from clone RP11-71C5 on chrom...	42	1.4
444	gb\|AC158960.4\| Mus musculus chromosome 1, clone RP23-315O2, comp...	42	1.4
445	emb\|AL121788.17\|HSDJ70A9 Human DNA sequence from clone RP1-70A9 ...	42	1.4
446	ref\|XM_795517.1\| PREDICTED: Strongylocentrotus purpuratus hypoth...	42	1.4
447	emb\|AL078597.11\|HSDJ442I1 Human DNA sequence from clone RP3-442I...	42	1.4
448	gb\|AC157934.3\| Mus musculus chromosome 5, clone RP24-224K15, com...	42	1.4
449	gb\|AC162302.2\| Mus musculus chromosome 15, clone RP23-463E8, com...	42	1.4
450	emb\|AL035419.12\|HS1100H13 Human DNA sequence from clone RP5-1100...	42	1.4
451	emb\|AL023095.1\|HS1059E7 Human DNA sequence from clone RP5-1059E7...	42	1.4
452	emb\|AL021407.1\|HS13D10 Human DNA sequence from clone RP1-13D10 o...	42	1.4
453	gb\|AY074260.1\| Arabidopsis thaliana At2g36420 mRNA sequence	42	1.4
454	ref\|XM_795098.1\| PREDICTED: Strongylocentrotus purpuratus hypoth...	42	1.4
455	emb\|X68650.1\|OCRYARA O.cuniculus mRNA for ryanodine receptor	42	1.4
456	ref\|XM_781838.1\| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.4
457	emb\|X17093.1\|HSHLAF Human HLA-F gene for human leukocyte antigen F	42	1.4
458	gb\|AF515448.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
459	gb\|AF515447.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
460	gb\|AF515446.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
461	gb\|AY124194.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
462	gb\|AY124193.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
463	gb\|AY124192.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
464	gb\|AY124191.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
465	gb\|AY124190.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
466	gb\|AY124189.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
467	gb\|AY124188.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
468	gb\|AY124187.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
469	gb\|AY124186.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
470	gb\|AC163090.5\| Mus musculus chromosome 8, clone RP23-457I3, comp...	42	1.4
471	emb\|CR548612.1\| Paramecium tetraurelia macronuclear largest chro...	42	1.4
472	gb\|AC151985.2\| Mus musculus BAC clone RP23-381C14 from chromosom...	42	1.4
473	gb\|AC160559.5\| Mus musculus BAC clone RP24-404N24 from chromosom...	42	1.4
474	gb\|AC095787.7\| Rattus norvegicus 14 BAC CH230-9M3 (Children's Ho...	42	1.4
475	emb\|BX883051.1\| Rattus norvegicus chromosome 20, major histocomp...	42	1.4
476	gb\|BC036660.1\| Homo sapiens mitogen activated protein kinase bin...	42	1.4
477	gb\|AC158763.6\| Mus musculus chromosome 18, clone RP23-343L17, co...	42	1.4
478	gb\|AC164614.3\| Mus musculus BAC clone RP23-337L12 from chromosom...	42	1.4
479	gb\|BC022031.2\| Homo sapiens chromosome 6 open reading frame 199,...	42	1.4
480	emb\|AL591070.19\| Mouse DNA sequence from clone RP23-185A18 on ch...	42	1.4
481	emb\|AL391069.11\| Human DNA sequence from clone RP11-126K1 on chr...	42	1.4
482	emb\|AL162873.1\|ATF8F6 Arabidopsis thaliana DNA chromosome 5, BAC...	42	1.4
483	emb\|AL132977.1\|ATT10K17 Arabidopsis thaliana DNA chromosome 3, B...	42	1.4
484	emb\|AJ783860.1\| Ovis aries partial mRNA for hypothetical protein...	42	1.4
485	gb\|AC025669.19\| Mus musculus chromosome 14, clone RP23-5O16, com...	42	1.4
486	emb\|AJ224874.1\|HSAJ4874 Homo sapiens mRNA for L-type calcium cha...	42	1.4
487	emb\|AJ006216.1\|HSA6216 Homo sapiens CACNA1F gene, exons 1 to 48	42	1.4
488	gb\|AC159330.9\| Mus musculus 10 BAC RP23-91L18 (Roswell Park Canc...	42	1.4
489	emb\|CR759790.7\| Human DNA sequence from clone DAMC-335E20 on chr...	42	1.4
490	emb\|AL645571.18\| Mouse DNA sequence from clone RP23-39H1 on chro...	42	1.4
491	emb\|AL645566.15\| Mouse DNA sequence from clone RP23-398M13 on ch...	42	1.4
492	emb\|AL603708.13\| Mouse DNA sequence from clone RP23-381C21 on ch...	42	1.4
493	emb\|AL954821.10\| Mouse DNA sequence from clone RP23-415G6 on chr...	42	1.4
494	emb\|AL663051.15\| Mouse DNA sequence from clone RP23-450J13 on ch...	42	1.4
495	emb\|AL662858.15\| Mouse DNA sequence from clone RP23-166O21 on ch...	42	1.4
496	emb\|AL672030.10\| Mouse DNA sequence from clone RP23-199E12 on ch...	42	1.4
497	emb\|AL928822.6\| Mouse DNA sequence from clone RP23-419O21 on chr...	42	1.4
498	gb\|BC017423.1\| Homo sapiens mesoderm induction early response 1 ...	42	1.4
499	gb\|AC009771.22\| Homo sapiens 12 BAC RP11-321E21 (Roswell Park Ca...	42	1.4
500	emb\|AL691481.15\| Mouse DNA sequence from clone RP23-173C3 on chr...	42	1.4

>ref|NM_191387.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2964

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 337  atgagaaaacgccacaacttcttcgctgacgaagntctctcttcttcctcttcttcatct 396
            ||||| |||||||||| |||||||||||| || | | ||||||| || || |||||||||
Sbjct: 2957 atgaggaaacgccacagcttcttcgctgaagatgttttctcttcctcttcctcttcatct 2898

              
Query: 397  tc 398
            ||
Sbjct: 2897 tc 2896

to top

>dbj|AB110205.1| Oryza sativa (japonica cultivar-group) mRNA for hypothetical protein,
            complete cds, clone: pBSK-OsNMCP1bEN31
          Length = 2986

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 337  atgagaaaacgccacaacttcttcgctgacgaagntctctcttcttcctcttcttcatct 396
            ||||| |||||||||| |||||||||||| || | | ||||||| || || |||||||||
Sbjct: 2968 atgaggaaacgccacagcttcttcgctgaagatgttttctcttcctcttcctcttcatct 2909

              
Query: 397  tc 398
            ||
Sbjct: 2908 tc 2907

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                            
Query: 337      atgagaaaacgccacaacttcttcgctgacgaagntctctcttcttcctcttcttcatct 396
                ||||| |||||||||| |||||||||||| || | | ||||||| || || |||||||||
Sbjct: 32321438 atgaggaaacgccacagcttcttcgctgaagatgttttctcttcctcttcctcttcatct 32321497

                  
Query: 397      tc 398
                ||
Sbjct: 32321498 tc 32321499



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 270      agaggcaactgtcagcctacagtcagctct 299
                ||||| ||||||||||||||||| ||||||
Sbjct: 32321369 agaggtaactgtcagcctacagttagctct 32321398



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 372      tctctcttcttcctcttcttcatcttct 399
                |||||||||||| |||||||| ||||||
Sbjct: 27779170 tctctcttcttcttcttcttcttcttct 27779143

to top

>dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
           BAC clone:B1143G03
          Length = 137770

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 337 atgagaaaacgccacaacttcttcgctgacgaagntctctcttcttcctcttcttcatct 396
           ||||| |||||||||| |||||||||||| || | | ||||||| || || |||||||||
Sbjct: 935 atgaggaaacgccacagcttcttcgctgaagatgttttctcttcctcttcctcttcatct 994

             
Query: 397 tc 398
           ||
Sbjct: 995 tc 996



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 270 agaggcaactgtcagcctacagtcagctct 299
           ||||| ||||||||||||||||| ||||||
Sbjct: 866 agaggtaactgtcagcctacagttagctct 895

to top

>dbj|AP003377.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0053G03
          Length = 101901

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 337   atgagaaaacgccacaacttcttcgctgacgaagntctctcttcttcctcttcttcatct 396
             ||||| |||||||||| |||||||||||| || | | ||||||| || || |||||||||
Sbjct: 53723 atgaggaaacgccacagcttcttcgctgaagatgttttctcttcctcttcctcttcatct 53782

               
Query: 397   tc 398
             ||
Sbjct: 53783 tc 53784



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 270   agaggcaactgtcagcctacagtcagctct 299
             ||||| ||||||||||||||||| ||||||
Sbjct: 53654 agaggtaactgtcagcctacagttagctct 53683

to top

>ref|XM_640022.1| Dictyostelium discoideum hypothetical protein (DDB0168851), partial
           mRNA
          Length = 3381

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 375 ctcttcttcctcttcttcatcttct 399
           |||||||||||||||||||||||||
Sbjct: 288 ctcttcttcctcttcttcatcttct 312

to top

>ref|NM_172512.1| Mus musculus GA repeat binding protein, beta 2 (Gabpb2), mRNA
          Length = 2675

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 374  tctcttcttcctcttcttcatcttc 398
            |||||||||||||||||||||||||
Sbjct: 1087 tctcttcttcctcttcttcatcttc 1063

to top

>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence
          Length = 189304

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 42033 ctcttcttcctcttcttcatcttct 42009



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 41925 ctcttcttcctcttcttcatcttct 41901



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 41817 ctcttcttcctcttcttcatcttct 41793



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 42043 tctcttcttcctcttcttcctcttct 42018



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 42007 tctcctcttcctcttcttcatcttct 41982



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 41899 tctcctcttcctcttcttcatcttct 41874



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 41791 tctcctcttcctcttcttcatcttct 41766

to top

>gb|AC115680.3| Dictyostelium discoideum chromosome 2 map 4915084-5005461 strain AX4,
             complete sequence
          Length = 90373

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 53916 ctcttcttcctcttcttcatcttct 53940

to top

>ref|XM_721979.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06422)
            partial mRNA
          Length = 7950

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||||||||||
Sbjct: 1239 ctcttcttcctcttcttcatcttct 1215



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            |||||||||||||| |||||||||
Sbjct: 1307 tcttcttcctcttcatcatcttct 1284



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            |||||||| |||||||||||||||
Sbjct: 1283 tcttcttcttcttcttcatcttct 1260

to top

>gb|AC083801.20| Homo sapiens 3 BAC RP11-646E18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 159621

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 374   tctcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||||
Sbjct: 69481 tctcttcttcctcttcttcatcttc 69457

to top

>dbj|AK141382.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430045E08 product:Weakly similar
            to transcription factor GABP beta 2-1 chain, full insert
            sequence
          Length = 3178

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 374  tctcttcttcctcttcttcatcttc 398
            |||||||||||||||||||||||||
Sbjct: 1389 tctcttcttcctcttcttcatcttc 1365

to top

>dbj|AK137604.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
            library, clone:9830165K14 product:hypothetical protein,
            full insert sequence
          Length = 4133

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 374  tctcttcttcctcttcttcatcttc 398
            |||||||||||||||||||||||||
Sbjct: 2684 tctcttcttcctcttcttcatcttc 2660

to top

>dbj|AK163329.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020014M22 product:GA binding protein beta-2-1
           chain (GABP-beta-2-1 subunit) (GABPB2-1) homolog [Mus
           musculus], full insert sequence
          Length = 2590

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 374 tctcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||||
Sbjct: 254 tctcttcttcctcttcttcatcttc 230

to top

>dbj|AK036692.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
            library, clone:9830163M18 product:weakly similar to
            transcription factor GABP beta 2-1 chain [Mus musculus],
            full insert sequence
          Length = 3214

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 374  tctcttcttcctcttcttcatcttc 398
            |||||||||||||||||||||||||
Sbjct: 1899 tctcttcttcctcttcttcatcttc 1875

to top

>gb|AC084272.41| Mus musculus strain C57BL/6J clone rp23-11g21 map 3, complete sequence
          Length = 206230

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 374    tctcttcttcctcttcttcatcttc 398
              |||||||||||||||||||||||||
Sbjct: 190901 tctcttcttcctcttcttcatcttc 190925

to top

>gb|AC148986.5| Mus musculus BAC clone RP23-89A16 from chromosome 7, complete sequence
          Length = 243039

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 12919 ctcttcttcctcttcttcatcttct 12943



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 12811 ctcttcttcctcttcttcatcttct 12835



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 12703 ctcttcttcctcttcttcatcttct 12727



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 12945 tctcctcttcctcttcttcatcttct 12970



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 12837 tctcctcttcctcttcttcatcttct 12862



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 12729 tctcctcttcctcttcttcatcttct 12754



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 12693 tctcttcttcctcttcttcctcttct 12718

to top

>dbj|AK030849.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
            library, clone:5830427M07 product:transcription factor
            GABP beta 2-1 chain homolog [Mus musculus], full insert
            sequence
          Length = 2675

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 374  tctcttcttcctcttcttcatcttc 398
            |||||||||||||||||||||||||
Sbjct: 1087 tctcttcttcctcttcttcatcttc 1063

to top

>gb|AC068609.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-98L5, complete
             sequence
          Length = 192263

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 95352 ctcttcttcctcttcttcatcttct 95328



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 95415 ctcttcttcctcttcttcctcttct 95391



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 95406 ctcttcttcctcttcttcctcttct 95382



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 95397 ctcttcttcctcttcttcctcttct 95373



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 95388 ctcttcttcctcttcttcctcttct 95364



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 95379 ctcttcttcctcttcttcctcttct 95355



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 95370 ctcttcttcctcttcttcctcttct 95346



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 95361 ctcttcttcctcttcttcctcttct 95337



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 95423 tcttcttcctcttcttcctcttct 95400

to top

>gb|AC141883.4| Mus musculus BAC clone RP24-128P19 from 7, complete sequence
          Length = 189828

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 65443 ctcttcttcctcttcttcatcttct 65467



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 65335 ctcttcttcctcttcttcatcttct 65359



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 65227 ctcttcttcctcttcttcatcttct 65251



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 65469 tctcctcttcctcttcttcatcttct 65494



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 65361 tctcctcttcctcttcttcatcttct 65386



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 65253 tctcctcttcctcttcttcatcttct 65278



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 65217 tctcttcttcctcttcttcctcttct 65242

to top

>gb|AC140190.3| Mus musculus BAC clone RP24-372P19 from 3, complete sequence
          Length = 205702

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 374   tctcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||||
Sbjct: 75652 tctcttcttcctcttcttcatcttc 75676

to top

>emb|AL935127.9| Mouse DNA sequence from clone RP23-431O5 on chromosome 2, complete
             sequence
          Length = 98852

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||||||||
Sbjct: 48012 ctcttcttcctcttcttcatcttct 48036

to top

>ref|XM_640896.1| Dictyostelium discoideum hypothetical protein (DDB0190281), partial
            mRNA
          Length = 6666

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 5162 tcttcttcctcttcttcatcttct 5139



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||| ||||||
Sbjct: 5348 tcttcttcctcttcttcttcttct 5325

to top

>ref|XM_634994.1| Dictyostelium discoideum hypothetical protein (DDB0204798), partial
            mRNA
          Length = 3141

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1658 tcttcttcctcttcttcatcttct 1635

to top

>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence
          Length = 218917

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||||||||||
Sbjct: 112924 tcttcttcctcttcttcatcttct 112901



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 145551 tcttcttcctcttcttcttcttct 145574



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||
Sbjct: 112883 ctcttcttcctcttcttcctcttc 112860

to top

>gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, complete sequence
          Length = 203655

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 577 tcttcttcctcttcttcatcttct 600



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 375 ctcttcttcctcttcttcatcttc 398
           |||||||||||||||||| |||||
Sbjct: 618 ctcttcttcctcttcttcctcttc 641

to top

>ref|XM_866375.1| PREDICTED: Bos taurus similar to p21-activated kinase 3, transcript
           variant 2 (LOC534526), mRNA
          Length = 2067

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 503 tcttcttcctcttcttcatcttct 480

to top

>ref|XM_878292.1| PREDICTED: Bos taurus similar to p21-activated kinase 3, transcript
           variant 3 (LOC534526), mRNA
          Length = 2070

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 506 tcttcttcctcttcttcatcttct 483

to top

>ref|XM_614322.2| PREDICTED: Bos taurus similar to p21-activated kinase 3, transcript
           variant 1 (LOC534526), mRNA
          Length = 2061

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 506 tcttcttcctcttcttcatcttct 483

to top

>ref|XM_453769.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16093g predicted mRNA
          Length = 369

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 107 tcttcttcctcttcttcatcttct 84

to top

>gb|AC090437.62| Mus musculus strain C57BL/6J clone rp23-11f20 map 6, complete sequence
          Length = 227127

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              ||||||||||||||||||||||||
Sbjct: 170500 ctcttcttcctcttcttcatcttc 170477



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 375    ctcttcttcctcttcttcatc 395
              |||||||||||||||||||||
Sbjct: 170838 ctcttcttcctcttcttcatc 170818



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 170587 ctcttcttcctcttcttcctcttct 170563

to top

>ref|XM_846255.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 2 (LOC492067), mRNA
          Length = 2613

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1019 tcttcttcctcttcttcatcttct 996

to top

>ref|XM_858440.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 10 (LOC492067), mRNA
          Length = 2676

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1082 tcttcttcctcttcttcatcttct 1059

to top

>ref|XM_858402.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 8 (LOC492067), mRNA
          Length = 2649

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1055 tcttcttcctcttcttcatcttct 1032

to top

>ref|XM_858383.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 7 (LOC492067), mRNA
          Length = 2670

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1076 tcttcttcctcttcttcatcttct 1053

to top

>ref|XM_858358.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
           kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
           (Oligophrenin-3), transcript variant 6 (LOC492067), mRNA
          Length = 2532

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 938 tcttcttcctcttcttcatcttct 915

to top

>ref|XM_858334.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 5 (LOC492067), mRNA
          Length = 2895

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1103 tcttcttcctcttcttcatcttct 1080

to top

>ref|XM_549187.2| PREDICTED: Canis familiaris similar to Serine/threonine-protein
           kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
           (Oligophrenin-3), transcript variant 1 (LOC492067), mRNA
          Length = 2525

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 931 tcttcttcctcttcttcatcttct 908

to top

>ref|XM_858293.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
           kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
           (Oligophrenin-3), transcript variant 4 (LOC492067), mRNA
          Length = 2266

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 974 tcttcttcctcttcttcatcttct 951

to top

>ref|XM_858267.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
           kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
           (Oligophrenin-3), transcript variant 3 (LOC492067), mRNA
          Length = 2568

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 974 tcttcttcctcttcttcatcttct 951

to top

>gb|AC124458.5| Mus musculus BAC clone RP24-136E11 from chromosome 12, complete
             sequence
          Length = 168181

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             ||||||||||||||||||||||||
Sbjct: 14541 ctcttcttcctcttcttcatcttc 14564



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14532 ctcttcttcctcttcttcctcttct 14556



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14523 ctcttcttcctcttcttcctcttct 14547



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14514 ctcttcttcctcttcttcctcttct 14538



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14505 ctcttcttcctcttcttcctcttct 14529



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14496 ctcttcttcctcttcttcctcttct 14520



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14487 ctcttcttcctcttcttcctcttct 14511



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14478 ctcttcttcctcttcttcctcttct 14502



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14469 ctcttcttcctcttcttcctcttct 14493



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14460 ctcttcttcctcttcttcctcttct 14484



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14451 ctcttcttcctcttcttcctcttct 14475



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14442 ctcttcttcctcttcttcctcttct 14466



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 14433 ctcttcttcctcttcttcctcttct 14457

to top

>ref|XM_816625.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053508873.460) partial mRNA
          Length = 1119

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 272 tcttcttcctcttcttcatcttct 249

to top

>ref|XM_645556.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (206.t00010)
           partial mRNA
          Length = 1845

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 110 tcttcttcctcttcttcatcttct 87



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 377 cttcttcctcttcttcatcttct 399
           |||||||||||||||||||||||
Sbjct: 73  cttcttcctcttcttcatcttct 51

to top

>ref|XM_722376.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06751)
           partial mRNA
          Length = 2032

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 441 tcttcttcctcttcttcatcttct 418



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 375 ctcttcttcctcttcttcatcttct 399
           ||||||||| |||||||||||||||
Sbjct: 433 ctcttcttcatcttcttcatcttct 409



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           |||||||| |||||||||||||||
Sbjct: 396 tcttcttcatcttcttcatcttct 373

to top

>ref|XM_670165.1| Plasmodium berghei strain ANKA hypothetical protein (PB000674.00.0)
            partial mRNA
          Length = 2415

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1385 tcttcttcctcttcttcatcttct 1362



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 375  ctcttcttcctcttcttcatcttc 398
            ||||||||| ||||||||||||||
Sbjct: 1377 ctcttcttcatcttcttcatcttc 1354

to top

>gb|AC110236.8| Mus musculus chromosome 15, clone RP23-104L4, complete sequence
          Length = 233499

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             ||||||||||||||||||||||||
Sbjct: 75183 ctcttcttcctcttcttcatcttc 75160



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 374   tctcttcttcctcttcttcatcttc 398
             |||||||||||||||||||| ||||
Sbjct: 75226 tctcttcttcctcttcttcagcttc 75202

to top

>ref|XM_787432.1| PREDICTED: Strongylocentrotus purpuratus similar to CG17604-PA,
           isoform A (LOC587721), mRNA
          Length = 1398

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||||||||||
Sbjct: 938 tcttcttcctcttcttcatcttct 915



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||| ||||||
Sbjct: 920 tcttcttcctcttcttcttcttct 897



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||| ||||||
Sbjct: 740 tcttcttcctcttcttcttcttct 717

to top

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 376     tcttcttcctcttcttcatcttct 399
               ||||||||||||||||||||||||
Sbjct: 1356318 tcttcttcctcttcttcatcttct 1356341



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              |||||||| |||||||||||||||
Sbjct: 447745 tcttcttcttcttcttcatcttct 447722

to top

>emb|AL163763.1|ATF18O21 Arabidopsis thaliana DNA chromosome 3, BAC clone F18O21
          Length = 99492

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 372   tctctcttcttcctcttcttcatcttct 399
             |||||||||||| |||||||||||||||
Sbjct: 22486 tctctcttcttcttcttcttcatcttct 22459

to top

>emb|AL157735.2|ATT6D9 Arabidopsis thaliana DNA chromosome 3, BAC clone T6D9
          Length = 79716

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 372  tctctcttcttcctcttcttcatcttct 399
            |||||||||||| |||||||||||||||
Sbjct: 6982 tctctcttcttcttcttcttcatcttct 7009

to top

>emb|AL138657.1|ATF9K21 Arabidopsis thaliana DNA chromosome 3, BAC clone F9K21
          Length = 110980

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 372   tctctcttcttcctcttcttcatcttct 399
             |||||||||||| |||||||||||||||
Sbjct: 99220 tctctcttcttcttcttcttcatcttct 99247

to top

>emb|BX548069.7| Zebrafish DNA sequence from clone CH211-238G23 in linkage group 18,
              complete sequence
          Length = 142514

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||||||||||
Sbjct: 121399 tcttcttcctcttcttcatcttct 121422

to top

>ref|XM_689761.1| PREDICTED: Danio rerio similar to B-cell CLL/lymphoma 11A isoform 1
            (LOC566491), mRNA
          Length = 2780

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 375  ctcttcttcctcttcttcatcttc 398
            ||||||||||||||||||||||||
Sbjct: 1796 ctcttcttcctcttcttcatcttc 1773

to top

>gb|AC151521.2| Medicago truncatula chromosome 7 BAC clone mte1-49d11, complete sequence
          Length = 111733

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||||||||||
Sbjct: 108218 tcttcttcctcttcttcatcttct 108195

to top

>ref|XM_627325.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd8_4370),
            partial mRNA
          Length = 3003

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||||
Sbjct: 1166 tcttcttcctcttcttcatcttct 1143

to top

>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              ||||||||||||||||||||||||
Sbjct: 461221 ctcttcttcctcttcttcatcttc 461198

to top

>gb|AC132660.7| Homo sapiens 3 BAC RP11-482K2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 64263

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||||||||||
Sbjct: 51771 tcttcttcctcttcttcatcttct 51794

to top

>emb|BX005290.10| Zebrafish DNA sequence from clone CH211-127M10 in linkage group 6,
             complete sequence
          Length = 186793

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             ||||||||||||||||||||||||
Sbjct: 78280 ctcttcttcctcttcttcatcttc 78303

to top

>ref|NM_207963.1| Eremothecium gossypii AAR069Wp (AAR069W), mRNA
          Length = 2307

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 375 ctcttcttcctcttcttcatcttc 398
           ||||||||||||||||||||||||
Sbjct: 441 ctcttcttcctcttcttcatcttc 418

to top

>gb|AC112948.12| Mus musculus chromosome 8, clone RP23-299I18, complete sequence
          Length = 197546

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 372    tctctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||||| ||||||
Sbjct: 137522 tctctcttcttcctcttcttcttcttct 137495

to top

>emb|AL954867.12| Zebrafish DNA sequence from clone DKEY-1G17 in linkage group 6,
             complete sequence
          Length = 222787

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             ||||||||||||||||||||||||
Sbjct: 54547 ctcttcttcctcttcttcatcttc 54524

to top

>emb|AL589876.11| Mouse DNA sequence from clone RP23-117O11 on chromosome 2, complete
              sequence
          Length = 221782

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              ||||||||||||||||||||||||
Sbjct: 110893 ctcttcttcctcttcttcatcttc 110916



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 110806 ctcttcttcctcttcttcctcttct 110830



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 375    ctcttcttcctcttcttcatc 395
              |||||||||||||||||||||
Sbjct: 110555 ctcttcttcctcttcttcatc 110575

to top

>gb|AC110510.6| Mus musculus chromosome 1, clone RP24-503F14, complete sequence
          Length = 198372

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 9904 ctcttcttcctcttcttcatctt 9882



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 9973 ctcttcttcctcttcttcctcttct 9949



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 375  ctcttcttcctcttcttcatcttc 398
            |||||||||||||||||| |||||
Sbjct: 9964 ctcttcttcctcttcttcctcttc 9941

to top

>ref|NM_115728.3| Arabidopsis thaliana structural constituent of ribosome AT3G58660
            mRNA, complete cds
          Length = 1581

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 377  cttcttcctcttcttcatcttct 399
            |||||||||||||||||||||||
Sbjct: 1096 cttcttcctcttcttcatcttct 1074

to top

>ref|NM_118270.1| Arabidopsis thaliana unknown protein AT4G21500 mRNA, complete cds
          Length = 648

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 341 tcttcttcctcttcttcatcttc 319

to top

>ref|XM_630095.1| Dictyostelium discoideum hypothetical protein (DDB0183869), partial
            mRNA
          Length = 1827

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 373  ctctcttcttcctcttcttcatcttct 399
            |||||||||||||||||||| ||||||
Sbjct: 1550 ctctcttcttcctcttcttcctcttct 1524

to top

>gb|AY023640.1| Oryza sativa microsatellite MRG5965 containing (TTC)X11, closest to
           marker G376, genomic sequence
          Length = 233

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 126 tcttcttcctcttcttcatcttc 148

to top

>gb|AC121149.12| Mus musculus chromosome 3, clone RP24-383A4, complete sequence
          Length = 172369

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 63004 tcttcttcctcttcttcatcttc 63026

to top

>gb|AC102874.7| Mus musculus chromosome 1, clone RP24-500O1, complete sequence
          Length = 166507

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 375   ctcttcttcctcttcttcatctt 397
             |||||||||||||||||||||||
Sbjct: 95964 ctcttcttcctcttcttcatctt 95942



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 96033 ctcttcttcctcttcttcctcttct 96009



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 96024 ctcttcttcctcttcttcctcttc 96001

to top

>ref|XM_462373.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G20383g)
            partial mRNA
          Length = 2724

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 376  tcttcttcctcttcttcatcttc 398
            |||||||||||||||||||||||
Sbjct: 1235 tcttcttcctcttcttcatcttc 1213

to top

>gb|AC151805.20| Medicago truncatula clone mth2-59n17, complete sequence
          Length = 143937

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 52527 tcttcttcctcttcttcatcttc 52549

to top

>gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome 3, complete
            sequence
          Length = 197272

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 377  cttcttcctcttcttcatcttct 399
            |||||||||||||||||||||||
Sbjct: 5822 cttcttcctcttcttcatcttct 5844

to top

>gb|AC170084.13| Medicago truncatula clone mth2-156k10, complete sequence
          Length = 143943

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 91414 tcttcttcctcttcttcatcttc 91392

to top

>gb|BT012181.1| Arabidopsis thaliana At4g21500 gene, complete cds
          Length = 648

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 341 tcttcttcctcttcttcatcttc 319

to top

>gb|AC165415.5| Mus musculus chromosome 15, clone RP23-17G19, complete sequence
          Length = 227254

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 373    ctctcttcttcctcttcttcatcttct 399
              |||||||||||||||||||| ||||||
Sbjct: 186493 ctctcttcttcctcttcttcctcttct 186519



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 186549 ctcttcttcctcttcttcttcttct 186573



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 186540 ctcttcttcctcttcttcctcttct 186564



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 186531 ctcttcttcctcttcttcctcttct 186555



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 186522 ctcttcttcctcttcttcctcttct 186546



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 186513 ctcttcttcctcttcttcctcttct 186537



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 186504 ctcttcttcctcttcttcctcttct 186528

to top

>ref|XM_985228.1| PREDICTED: Mus musculus HECT, C2 and WW domain containing E3
            ubiquitin protein ligase 1, transcript variant 4 (Hecw1),
            mRNA
          Length = 9354

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 1903 ctcttcttcctcttcttcatctt 1881

to top

>ref|XM_985267.1| PREDICTED: Mus musculus HECT, C2 and WW domain containing E3
            ubiquitin protein ligase 1, transcript variant 5 (Hecw1),
            mRNA
          Length = 9362

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 1911 ctcttcttcctcttcttcatctt 1889

to top

>ref|XM_919112.2| PREDICTED: Mus musculus HECT, C2 and WW domain containing E3
            ubiquitin protein ligase 1, transcript variant 16
            (Hecw1), mRNA
          Length = 9354

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 1903 ctcttcttcctcttcttcatctt 1881

to top

>ref|XM_919097.2| PREDICTED: Mus musculus HECT, C2 and WW domain containing E3
            ubiquitin protein ligase 1, transcript variant 15
            (Hecw1), mRNA
          Length = 9362

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 1911 ctcttcttcctcttcttcatctt 1889

to top

>ref|XM_897876.2| PREDICTED: Mus musculus HECT, C2 and WW domain containing E3
            ubiquitin protein ligase 1, transcript variant 8 (Hecw1),
            mRNA
          Length = 9354

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 1903 ctcttcttcctcttcttcatctt 1881

to top

>ref|XM_897863.2| PREDICTED: Mus musculus HECT, C2 and WW domain containing E3
            ubiquitin protein ligase 1, transcript variant 7 (Hecw1),
            mRNA
          Length = 9362

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 1911 ctcttcttcctcttcttcatctt 1889

to top

>emb|CR847978.17| Zebrafish DNA sequence from clone CH211-209D14 in linkage group 3,
            complete sequence
          Length = 194437

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 55   acccacaatcaatttgtacataa 77
            |||||||||||||||||||||||
Sbjct: 3745 acccacaatcaatttgtacataa 3723

to top

>gb|AC125782.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0095P22, complete sequence
          Length = 162766

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 49232 tcttcttcctcttcttcatcttc 49254

to top

>ref|XM_723174.1| Plasmodium yoelii yoelii str. 17XNL latency associated antigen
           (PY01017) partial mRNA
          Length = 951

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 590 tcttcttcctcttcttcatcttc 568

to top

>ref|XM_786624.1| PREDICTED: Strongylocentrotus purpuratus similar to 39 kDa
           FK506-binding nuclear protein (Peptidyl-prolyl cis-trans
           isomerase) (PPIase) (Rotamase) (LOC586862), mRNA
          Length = 1524

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 863 tcttcttcctcttcttcatcttc 841

to top

>emb|AL031943.11|HS223B1 Human DNA sequence from clone RP1-223B1 on chromosome 6p24.1-25.3
             Contains the 3' end of a putative novel gene, complete
             sequence
          Length = 126281

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 70530 tcttcttcctcttcttcatcttc 70552



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 70403 ctcttcttcctcttcttcttcttct 70427



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 70395 tcttcttcctcttcttcctcttct 70418

to top

>gb|AC145349.1| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0096I10, complete sequence
          Length = 171946

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 376    tcttcttcctcttcttcatcttc 398
              |||||||||||||||||||||||
Sbjct: 160866 tcttcttcctcttcttcatcttc 160844

to top

>gb|AY224392.1| Human adenovirus type 2 strain KNIH Ad 01/2 hexon gene, complete
           cds
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>gb|AY224391.1| Human adenovirus type 2 strain KNIH Ad 00/3 hexon gene, complete
           cds
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>gb|AY070404.1| Arabidopsis thaliana unknown protein (At3g58660) mRNA, complete cds
          Length = 1597

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 377  cttcttcctcttcttcatcttct 399
            |||||||||||||||||||||||
Sbjct: 1097 cttcttcctcttcttcatcttct 1075

to top

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 376     tcttcttcctcttcttcatcttc 398
               |||||||||||||||||||||||
Sbjct: 1559374 tcttcttcctcttcttcatcttc 1559352



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              |||||||| |||||||||||||||
Sbjct: 742896 tcttcttcatcttcttcatcttct 742919



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              |||||||| |||||||||||||||
Sbjct: 742887 tcttcttcatcttcttcatcttct 742910



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              |||||||| |||||||||||||||
Sbjct: 742878 tcttcttcatcttcttcatcttct 742901



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              |||||||| |||||||||||||||
Sbjct: 742869 tcttcttcatcttcttcatcttct 742892

to top

>emb|AL353032.1|ATT20N10 Arabidopsis thaliana DNA chromosome 3, BAC clone T20N10
          Length = 90273

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 377  cttcttcctcttcttcatcttct 399
            |||||||||||||||||||||||
Sbjct: 2484 cttcttcctcttcttcatcttct 2462

to top

>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA project)
          Length = 104607

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 372   tctctcttcttcctcttcttcatcttc 398
             |||||||||||| ||||||||||||||
Sbjct: 89162 tctctcttcttcttcttcttcatcttc 89188

to top

>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
          Length = 194916

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 59238 tcttcttcctcttcttcatcttc 59260

to top

>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project)
          Length = 95266

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 46230 tcttcttcctcttcttcatcttc 46252

to top

>emb|AJ293905.1|HAD293905 Human adenovirus type 2 hexon gene, isolate 358
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>emb|AJ293904.1|HAD293904 Human adenovirus type 2 hexon gene, isolate 134
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>emb|AJ293902.1|HAD293902 Human adenovirus type 2 hexon gene, isolate 352
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>emb|AJ293901.1|HAD293901 Human adenovirus type 2 hexon gene, isolate Prei
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>emb|AJ278924.1|HAD278924 Human adenovirus type 2 hexon gene, isolate R05
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>gb|AC163614.4| Mus musculus BAC clone RP23-102K8 from chromosome 1, complete sequence
          Length = 201646

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 372    tctctcttcttcctcttcttcatcttc 398
              |||||||||||| ||||||||||||||
Sbjct: 134347 tctctcttcttcttcttcttcatcttc 134373



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 111753 tcttcttcctcttcttcttcttct 111776

to top

>gb|DQ115418.1| Human adenovirus type 2 hexon protein gene, partial cds
          Length = 795

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 125 tcttcttcctcttcttcatcttc 103

to top

>gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence
          Length = 219626

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             |||||||||| ||||||||||||||||
Sbjct: 37699 ctctcttctttctcttcttcatcttct 37673



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 20167 ctcttcttcctcttcttcttcttct 20191



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 20159 tcttcttcctcttcttcctcttct 20182



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 19957 ctcttcttcctcttcttcttcttc 19980

to top

>gb|AC164078.4| Mus musculus chromosome 3, clone RP23-123C15, complete sequence
          Length = 188095

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 376    tcttcttcctcttcttcatcttc 398
              |||||||||||||||||||||||
Sbjct: 104604 tcttcttcctcttcttcatcttc 104582

to top

>gb|AC020616.7| Mus musculus strain C57BL/6J clone RP23-3A24, complete sequence
          Length = 191243

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||| ||||||
Sbjct: 37271 ctctcttcttcctcttcttcctcttct 37245



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 37260 ctcttcttcctcttcttcctcttc 37237

to top

>dbj|AK221511.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
           clone: RAFL07-59-D11
          Length = 808

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 363 tcttcttcctcttcttcatcttc 341

to top

>ref|NM_182000.1| Caenorhabditis elegans Y18D10A.1 (Y18D10A.1) mRNA, complete cds
          Length = 4905

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 376  tcttcttcctcttcttcatcttc 398
            |||||||||||||||||||||||
Sbjct: 2906 tcttcttcctcttcttcatcttc 2884

to top

>dbj|AK029861.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4931415K24 product:similar to NEDD4-LIKE
           UBIQUITIN LIGASE 1 [Homo sapiens], full insert sequence
          Length = 3695

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 375 ctcttcttcctcttcttcatctt 397
           |||||||||||||||||||||||
Sbjct: 572 ctcttcttcctcttcttcatctt 550

to top

>ref|XM_623936.1| PREDICTED: Apis mellifera similar to heat shock protein
           (LOC408928), mRNA
          Length = 2688

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 770 tcttcttcctcttcttcatcttc 748

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 376      tcttcttcctcttcttcatcttc 398
                |||||||||||||||||||||||
Sbjct: 24248123 tcttcttcctcttcttcatcttc 24248145



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 375     ctcttcttcctcttcttcatcttct 399
               |||||||||||||||||| ||||||
Sbjct: 9535521 ctcttcttcctcttcttcctcttct 9535545

to top

>gb|AF322857.1|AF322857 Danio rerio transcription factor Stat3 (stat3) gene, exons 13 through
             24 and partial cds
          Length = 44033

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 55    acccacaatcaatttgtacataa 77
             |||||||||||||||||||||||
Sbjct: 23487 acccacaatcaatttgtacataa 23509

to top

>gb|AC084683.1|CBRG47P01 Caenorhabditis briggsae cosmid G47P01, complete sequence
          Length = 37515

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 21935 tcttcttcctcttcttcatcttc 21913

to top

>gb|AF542120.1| Human adenovirus type 2 strain KNIH Ad00/4 hexon gene, complete cds
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>gb|AF542118.1| Human adenovirus type 2 strain KNIH Ad00/1 hexon gene, complete cds
          Length = 2907

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 376 tcttcttcctcttcttcatcttc 398
           |||||||||||||||||||||||
Sbjct: 482 tcttcttcctcttcttcatcttc 460

to top

>dbj|AK172932.1| Mus musculus mRNA for mKIAA0322 protein
          Length = 6123

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 375 ctcttcttcctcttcttcatctt 397
           |||||||||||||||||||||||
Sbjct: 294 ctcttcttcctcttcttcatctt 272

to top

>dbj|AB083710.1| Mus musculus NEDL1 mRNA for HECT type E3 ubiquitin ligase, complete
            cds
          Length = 4992

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 375  ctcttcttcctcttcttcatctt 397
            |||||||||||||||||||||||
Sbjct: 1470 ctcttcttcctcttcttcatctt 1448

to top

>gb|AC154511.2| Mus musculus BAC clone RP24-69N19 from 13, complete sequence
          Length = 197061

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 375    ctcttcttcctcttcttcatctt 397
              |||||||||||||||||||||||
Sbjct: 134492 ctcttcttcctcttcttcatctt 134514

to top

>emb|AL672063.36| Mouse DNA sequence from clone RP23-65A22 on chromosome X, complete
             sequence
          Length = 229278

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||| ||||||
Sbjct: 14040 ctctcttcttcctcttcttcctcttct 14066

to top

>gb|AC137126.13| Mus musculus chromosome 15, clone RP24-250I9, complete sequence
          Length = 193459

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||| ||||||
Sbjct: 32223 ctctcttcttcctcttcttcctcttct 32249



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 32279 ctcttcttcctcttcttcttcttct 32303



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 32270 ctcttcttcctcttcttcctcttct 32294



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 32261 ctcttcttcctcttcttcctcttct 32285



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 32252 ctcttcttcctcttcttcctcttct 32276



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 32243 ctcttcttcctcttcttcctcttct 32267



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 32234 ctcttcttcctcttcttcctcttct 32258



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 192254 tcttcttcctcttcttcttcttct 192277

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 376      tcttcttcctcttcttcatcttc 398
                |||||||||||||||||||||||
Sbjct: 24559792 tcttcttcctcttcttcatcttc 24559814



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 375     ctcttcttcctcttcttcatcttct 399
               |||||||||||||||||| ||||||
Sbjct: 9607218 ctcttcttcctcttcttcctcttct 9607242

to top

>emb|AL034393.1|CEY18D10A Caenorhabditis elegans YAC Y18D10A, complete sequence
          Length = 152878

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 15877 tcttcttcctcttcttcatcttc 15899

to top

>emb|AL163912.1|ATT2I1 Arabidopsis thaliana DNA chromosome 5, BAC clone T2I1 (ESSA
           project)
          Length = 116763

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 372 tctctcttcttcctcttcttcatcttc 398
           |||||||||||| ||||||||||||||
Sbjct: 78  tctctcttcttcttcttcttcatcttc 104

to top

>gb|AC149588.4| Mus musculus BAC clone RP23-366I10 from 15, complete sequence
          Length = 200656

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 373 ctctcttcttcctcttcttcatcttct 399
           |||||||||| ||||||||||||||||
Sbjct: 852 ctctcttctttctcttcttcatcttct 878



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 18384 ctcttcttcctcttcttcttcttct 18360



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 18594 ctcttcttcctcttcttcttcttc 18571



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 18392 tcttcttcctcttcttcctcttct 18369

to top

>dbj|AP006658.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT27P02, TM0343,
             complete sequence
          Length = 92507

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             ||||| |||||||||||||||||||||
Sbjct: 69646 ctctcctcttcctcttcttcatcttct 69620

to top

>dbj|AP006113.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT45A24, TM0197,
             complete sequence
          Length = 112846

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             ||||| |||||||||||||||||||||
Sbjct: 88928 ctctcctcttcctcttcttcatcttct 88902

to top

>dbj|AP004896.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT16I07, TM0040,
             complete sequence
          Length = 92281

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             ||||| |||||||||||||||||||||
Sbjct: 15302 ctctcctcttcctcttcttcatcttct 15328

to top

>gb|J01917.1|ADRCG Adenovirus type 2, complete genome
          Length = 35937

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 376   tcttcttcctcttcttcatcttc 398
             |||||||||||||||||||||||
Sbjct: 19319 tcttcttcctcttcttcatcttc 19297

to top

>emb|AL929421.7| Mouse DNA sequence from clone RP23-284N23 on chromosome 2, complete
             sequence
          Length = 102530

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 373   ctctcttcttcctcttcttcatcttct 399
             |||||||||||||||||||| ||||||
Sbjct: 67851 ctctcttcttcctcttcttcctcttct 67825



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 67840 ctcttcttcctcttcttcctcttc 67817

to top

>ref|NM_117893.3| Arabidopsis thaliana unknown protein AT4G17840 mRNA, complete cds
          Length = 1722

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 372 tctctcttcttcctcttcttcatctt 397
           |||||||||||| |||||||||||||
Sbjct: 327 tctctcttcttcttcttcttcatctt 352

to top

>ref|NM_100126.3| Arabidopsis thaliana unknown protein AT1G02450 mRNA, complete cds
          Length = 541

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           ||||||||||||||||||| ||||||
Sbjct: 166 tctcttcttcctcttcttcgtcttct 141

to top

>ref|NM_126630.1| Arabidopsis thaliana AtGRF6 (GROWTH-REGULATING FACTOR 6) AT2G06200
           (AtGRF6) mRNA, complete cds
          Length = 872

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           |||||||||| |||||||||||||||
Sbjct: 203 tctcttcttcttcttcttcatcttct 228

to top

>gb|AC121304.7| Mus musculus chromosome 3, clone RP24-63C3, complete sequence
          Length = 192911

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 99693 tctcttcttcctcttcttcctcttct 99668



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 99815 ctcttcttcctcttcttcctcttct 99791



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 99806 ctcttcttcctcttcttcctcttct 99782



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 99683 ctcttcttcctcttcttcctcttct 99659



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 99674 ctcttcttcctcttcttcctcttct 99650



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 99665 ctcttcttcctcttcttcctcttct 99641



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 99656 ctcttcttcctcttcttcctcttct 99632



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 99647 ctcttcttcctcttcttcctcttct 99623



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 99797 ctcttcttcctcttcttcctcttc 99774

to top

>gb|AC119269.9| Mus musculus chromosome 5, clone RP24-324B22, complete sequence
          Length = 172282

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 378    ttcttcctcttcttcatcttct 399
              ||||||||||||||||||||||
Sbjct: 167245 ttcttcctcttcttcatcttct 167266

to top

>ref|XM_641401.1| Dictyostelium discoideum hypothetical protein (DDB0190760), partial
           mRNA
          Length = 6714

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 374 tctcttcttcctcttcttcatc 395
           ||||||||||||||||||||||
Sbjct: 745 tctcttcttcctcttcttcatc 724

to top

>gb|AY440873.1| Armigeres subalbatus ASAP ID: 42423 unknown mRNA sequence
          Length = 600

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 377 cttcttcctcttcttcatcttc 398
           ||||||||||||||||||||||
Sbjct: 416 cttcttcctcttcttcatcttc 395

to top

>gb|AC116895.12| Mus musculus chromosome 8, clone RP24-531C8, complete sequence
          Length = 170041

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 109572 tctcttcttcctcttcttcttcttct 109597

to top

>gb|AC114512.5| Rattus norvegicus 5 BAC CH230-5N9 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 247588

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 228914 tctcttcttcctcttcttcctcttct 228939

to top

>gb|AC121292.9| Mus musculus chromosome 1, clone RP23-172B15, complete sequence
          Length = 193192

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 373    ctctcttcttcctcttcttcatcttc 398
              |||||||||||||||||||| |||||
Sbjct: 179003 ctctcttcttcctcttcttcctcttc 179028

to top

>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence
          Length = 203437

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 373   ctctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||||
Sbjct: 52029 ctctcttcttcctcttctccatcttc 52004

to top

>ref|XM_705388.1| Candida albicans SC5314 hypothetical protein (CaO19.1915), mRNA
          Length = 1704

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 375 ctcttcttcctcttcttcatct 396
           ||||||||||||||||||||||
Sbjct: 321 ctcttcttcctcttcttcatct 300

to top

>gb|AC102554.7| Mus musculus chromosome 9, clone RP23-159E10, complete sequence
          Length = 197397

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 374   tctcttcttcctcttcttcatc 395
             ||||||||||||||||||||||
Sbjct: 25725 tctcttcttcctcttcttcatc 25746

to top

>gb|AC060781.8| Mus musculus chromosome 19, clone RP23-196A19, complete sequence
          Length = 207702

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 10876 tctcttcttcctcttcttcttcttct 10901



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 372    tctctcttcttcctcttcttcatcttct 399
              |||||||||||| |||||||| ||||||
Sbjct: 193321 tctctcttcttcttcttcttcttcttct 193294



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 12668 ctcttcttcctcttcttcctcttc 12691



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 12660 tcttcttcctcttcttcctcttct 12683

to top

>gb|AC162887.5| Mus musculus chromosome 19, clone RP23-414O6, complete sequence
          Length = 190704

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 17379 tctcttcttcctcttcttcttcttct 17354



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 15595 tcttcttcctcttcttcctcttct 15572



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 15587 ctcttcttcctcttcttcctcttc 15564

to top

>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence
          Length = 181395

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 373    ctctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||||
Sbjct: 135218 ctctcttcttcctcttctccatcttc 135243

to top

>ref|XM_448393.1| Candida glabrata CBS138, CAGL0K03861g partial mRNA
          Length = 1542

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 376 tcttcttcctcttcttcatctt 397
           ||||||||||||||||||||||
Sbjct: 575 tcttcttcctcttcttcatctt 554

to top

>ref|XM_810077.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053511089.19) partial mRNA
          Length = 795

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           ||||||||||||||||||| ||||||
Sbjct: 397 tctcttcttcctcttcttcctcttct 372



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 375 ctcttcttcctcttcttcatcttc 398
           |||||||||||||||||| |||||
Sbjct: 387 ctcttcttcctcttcttcctcttc 364

to top

>gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome 1, complete sequence
          Length = 207475

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 378    ttcttcctcttcttcatcttct 399
              ||||||||||||||||||||||
Sbjct: 205077 ttcttcctcttcttcatcttct 205098



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 205093 tcttcttcctcttcttcctcttct 205116



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 141930 tcttcttcctcttcttcttcttct 141953



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 141861 tcttcttcctcttcttcctcttct 141884

to top

>gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome 6, complete sequence
          Length = 200673

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||| |||||||||||||||||||||
Sbjct: 56386 tctcctcttcctcttcttcatcttct 56411

to top

>gb|AC122317.4| Mus musculus BAC clone RP23-304C21 from 12, complete sequence
          Length = 173567

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 146500 tctcttcttcctcttcttcctcttct 146525

to top

>ref|XM_721334.1| Plasmodium yoelii yoelii str. 17XNL RNA 3'-terminal phosphate cyclase
            protein (PY05891) partial mRNA
          Length = 1668

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 378  ttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||
Sbjct: 1023 ttcttcctcttcttcatcttct 1002

to top

>ref|XM_725280.1| Plasmodium yoelii yoelii str. 17XNL protein kinase (PY02490) partial
            mRNA
          Length = 8100

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 378  ttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||
Sbjct: 3588 ttcttcctcttcttcatcttct 3567

to top

>ref|XM_536202.2| PREDICTED: Canis familiaris similar to adaptor-related protein
            complex 3, beta 2 subunit, transcript variant 1
            (LOC479053), mRNA
          Length = 3370

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 377  cttcttcctcttcttcatcttc 398
            ||||||||||||||||||||||
Sbjct: 2109 cttcttcctcttcttcatcttc 2088

to top

>ref|XM_855529.1| PREDICTED: Canis familiaris similar to adaptor-related protein
            complex 3, beta 2 subunit, transcript variant 3
            (LOC479053), mRNA
          Length = 3211

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 377  cttcttcctcttcttcatcttc 398
            ||||||||||||||||||||||
Sbjct: 1950 cttcttcctcttcttcatcttc 1929

to top

>ref|XM_740949.1| Plasmodium chabaudi chabaudi minichromosome maintenance protein 3
            (PC000670.02.0) partial mRNA
          Length = 2847

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 378  ttcttcctcttcttcatcttct 399
            ||||||||||||||||||||||
Sbjct: 2421 ttcttcctcttcttcatcttct 2400

to top

>ref|XM_662188.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.40234)
           partial mRNA
          Length = 1749

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           ||||||||||||||||||| ||||||
Sbjct: 220 tctcttcttcctcttcttcctcttct 195



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 375 ctcttcttcctcttcttcatcttc 398
           ||||||||||||||||||| ||||
Sbjct: 210 ctcttcttcctcttcttcaacttc 187

to top

>gb|AC160124.3| Mus musculus BAC clone RP23-297P22 from chromosome 9, complete sequence
          Length = 182831

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||| ||||||||||||||||||
Sbjct: 168943 tctcttcctcctcttcttcatcttct 168968

to top

>emb|AL589684.7| Human DNA sequence from clone RP11-437J19 on chromosome 6 Contains a
             novel gene, complete sequence
          Length = 94555

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 34183 tctcttcttcctcttcttcttcttct 34158

to top

>gb|AC073939.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-218B2, complete
              sequence
          Length = 195281

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 374    tctcttcttcctcttcttcatc 395
              ||||||||||||||||||||||
Sbjct: 109654 tctcttcttcctcttcttcatc 109675

to top

>gb|AC158590.3| Mus musculus chromosome 5, clone RP24-388K6, complete sequence
          Length = 186514

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 378    ttcttcctcttcttcatcttct 399
              ||||||||||||||||||||||
Sbjct: 172146 ttcttcctcttcttcatcttct 172125

to top

>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence
          Length = 1302002

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 376    tcttcttcctcttcttcatctt 397
              ||||||||||||||||||||||
Sbjct: 360415 tcttcttcctcttcttcatctt 360436

to top

>emb|AL161547.2|ATCHRIV47 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 47
          Length = 198067

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 372   tctctcttcttcctcttcttcatctt 397
             |||||||||||| |||||||||||||
Sbjct: 80498 tctctcttcttcttcttcttcatctt 80473

to top

>emb|AL021889.2|ATT6K21 Arabidopsis thaliana DNA chromosome 4, BAC clone T6K21 (ESSA project)
          Length = 99643

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 372  tctctcttcttcctcttcttcatctt 397
            |||||||||||| |||||||||||||
Sbjct: 4117 tctctcttcttcttcttcttcatctt 4092

to top

>gb|AC160633.3| Mus musculus chromosome 8, clone RP23-407P24, complete sequence
          Length = 203628

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 57515 tctcttcttcctcttcttcttcttct 57490

to top

>gb|AC159886.2| Mus musculus BAC clone RP24-397P9 from chromosome 9, complete sequence
          Length = 191328

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||| ||||||||||||||||||
Sbjct: 144348 tctcttcctcctcttcttcatcttct 144323

to top

>gb|AY125572.1| Arabidopsis thaliana At2g06200/F5K7.4 mRNA, complete cds
          Length = 735

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           |||||||||| |||||||||||||||
Sbjct: 134 tctcttcttcttcttcttcatcttct 159

to top

>gb|AC093318.52| Mus musculus strain C57BL/6J clone rp23-252h7 map 1, complete sequence
          Length = 198381

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 94131 tctcttcttcctcttcttcttcttct 94106

to top

>gb|AC006413.4| Arabidopsis thaliana chromosome 2 clone F5K7 map ve013, complete
             sequence
          Length = 106716

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||||||||| |||||||||||||||
Sbjct: 15151 tctcttcttcttcttcttcatcttct 15126

to top

>gb|AC092295.2| Homo sapiens chromosome 19 clone CTD-2630F21, complete sequence
          Length = 165566

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 127   ataaagaaagacatggcattat 148
             ||||||||||||||||||||||
Sbjct: 18086 ataaagaaagacatggcattat 18107

to top

>gb|AC087098.8| Genomic sequence for Mus musculus, clone RP23-206M19, complete sequence
          Length = 198338

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 55207 tctcttcttcctcttcttcttcttct 55232



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 56999 ctcttcttcctcttcttcctcttc 57022



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 56991 tcttcttcctcttcttcctcttct 57014

to top

>gb|AY060586.1| Arabidopsis thaliana At2g06200/F5K7.4 mRNA, complete cds
          Length = 873

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           |||||||||| |||||||||||||||
Sbjct: 203 tctcttcttcttcttcttcatcttct 228

to top

>gb|AC154596.2| Mus musculus BAC clone RP23-354C17 from chromosome 17, complete
             sequence
          Length = 208266

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 22450 tctcttcttcctcttcttcctcttct 22475



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 22424 tctcttcttcctcttcttcctcttct 22449

to top

>gb|DQ066852.1| Strongylocentrotus purpuratus clone A22 extracellular protein
           (endo16) gene, promoter region
          Length = 2144

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           |||||||||| |||||||||||||||
Sbjct: 406 tctcttcttcttcttcttcatcttct 431

to top

>gb|AC160090.4| Mus musculus 6 BAC RP23-322E20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 206093

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 57405 tctcttcttcctcttcttcttcttct 57380

to top

>gb|AC154004.7| Mus musculus 6 BAC RP24-169F24 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 168376

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 154362 tctcttcttcctcttcttcttcttct 154337



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||| ||||||
Sbjct: 2780 tcttcttcctcttcttcttcttct 2757

to top

>gb|AC153935.2| Mus musculus 10 BAC RP24-273A2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 169237

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 376   tcttcttcctcttcttcatctt 397
             ||||||||||||||||||||||
Sbjct: 99977 tcttcttcctcttcttcatctt 99998

to top

>gb|AC158607.7| Mus musculus 10 BAC RP23-183G4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 205308

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 376   tcttcttcctcttcttcatctt 397
             ||||||||||||||||||||||
Sbjct: 20368 tcttcttcctcttcttcatctt 20347

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 378     ttcttcctcttcttcatcttct 399
               ||||||||||||||||||||||
Sbjct: 9254465 ttcttcctcttcttcatcttct 9254486



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 375     ctcttcttcctcttcttcatcttct 399
               |||||||||||||||||| ||||||
Sbjct: 3023055 ctcttcttcctcttcttcttcttct 3023031



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 379      tcttcctcttcttcatcttc 398
                ||||||||||||||||||||
Sbjct: 27484120 tcttcctcttcttcatcttc 27484139



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 376      tcttcttcctcttcttcatc 395
                ||||||||||||||||||||
Sbjct: 10653272 tcttcttcctcttcttcatc 10653291



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 376     tcttcttcctcttcttcatcttct 399
               |||||||| |||||||||||||||
Sbjct: 5454753 tcttcttcatcttcttcatcttct 5454730



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 372     tctctcttcttcctcttcttcatcttct 399
               |||||||||||| |||||||| ||||||
Sbjct: 3200734 tctctcttcttcttcttcttcttcttct 3200707

to top

>emb|BX828322.1|CNS0A3W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH76ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1628

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 372 tctctcttcttcctcttcttcatctt 397
           |||||||||||| |||||||||||||
Sbjct: 275 tctctcttcttcttcttcttcatctt 300

to top

>emb|BX827730.1|CNS0A3VA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH16ZA04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1447

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 372 tctctcttcttcctcttcttcatctt 397
           |||||||||||| |||||||||||||
Sbjct: 136 tctctcttcttcttcttcttcatctt 161

to top

>emb|BX827424.1|CNS0A3NZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS53ZC02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1710

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 372 tctctcttcttcctcttcttcatctt 397
           |||||||||||| |||||||||||||
Sbjct: 331 tctctcttcttcttcttcttcatctt 356

to top

>gb|BT003662.1| Arabidopsis thaliana At1g02450 mRNA, complete cds
          Length = 429

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           ||||||||||||||||||| ||||||
Sbjct: 130 tctcttcttcctcttcttcgtcttct 105

to top

>gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BAC T14P4 genomic sequence, complete
              sequence
          Length = 121668

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 119486 tctcttcttcctcttcttcgtcttct 119461

to top

>ref|XM_216034.3| PREDICTED: Rattus norvegicus CDKN1A interacting zinc finger protein 1
            (predicted) (Ciz1_predicted), mRNA
          Length = 2971

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 374  tctcttcttcctcttcttcatc 395
            ||||||||||||||||||||||
Sbjct: 2407 tctcttcttcctcttcttcatc 2386

to top

>gb|AC064879.3|AC064879 Arabidopsis thaliana chromosome I BAC T6A9 genomic sequence, complete
             sequence
          Length = 109180

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 93367 tctcttcttcctcttcttcgtcttct 93392

to top

>gb|AC009756.9|AC009756 Homo sapiens, clone RP11-45P2, complete sequence
          Length = 178624

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 127   ataaagaaagacatggcattat 148
             ||||||||||||||||||||||
Sbjct: 23892 ataaagaaagacatggcattat 23913

to top

>gb|AC134587.3| Mus musculus BAC clone RP23-306P12 from chromosome 7, complete sequence
          Length = 166576

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             |||||||||| |||||||||||||||
Sbjct: 39520 tctcttcttcttcttcttcatcttct 39545



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 39258 tcttcttcctcttcttcttcttct 39281

to top

>emb|AL845323.18| Mouse DNA sequence from clone RP23-304D11 on chromosome 2, complete
              sequence
          Length = 228137

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 171188 tctcttcttcctcttcttcctcttct 171213



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 171198 ctcttcttcctcttcttcctcttct 171222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||
Sbjct: 171380 ctcttcttcctcttcttcttcttc 171403



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 171372 tcttcttcctcttcttcctcttct 171395

to top

>dbj|AK119149.1| Arabidopsis thaliana At1g02450 mRNA for unknown protein, complete
           cds, clone: RAFL21-49-L15
          Length = 548

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           ||||||||||||||||||| ||||||
Sbjct: 167 tctcttcttcctcttcttcgtcttct 142

to top

>emb|AJ250184.1|ATH250184 Arabidopsis thaliana mRNA for NIMIN-1 protein (nimin-1 gene)
          Length = 429

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 374 tctcttcttcctcttcttcatcttct 399
           ||||||||||||||||||| ||||||
Sbjct: 130 tctcttcttcctcttcttcgtcttct 105

to top

>gb|AC140381.3| Mus musculus BAC clone RP23-176M4 from 10, complete sequence
          Length = 223470

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 140557 tctcttcttcctcttcttcttcttct 140582



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 140508 ctcttcttcctcttcttcttcttct 140532



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 140500 tcttcttcctcttcttcctcttct 140523

to top

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
              locus, strain C57BL/6
          Length = 2500000

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 374    tctcttcttcctcttcttcatc 395
              ||||||||||||||||||||||
Sbjct: 519477 tctcttcttcctcttcttcatc 519498

to top

>gb|AC007759.1|AC007759 Homo sapiens chromosome 19, cosmid R27714, complete sequence
          Length = 40331

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 24164 tctcttcttcctcttcttcttcttct 24139

to top

>gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome 8, complete sequence
          Length = 249808

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 189423 tctcttcttcctcttcttcctcttct 189398



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||
Sbjct: 234351 ctcttcttcctcttcttcttcttc 234328



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||
Sbjct: 234082 ctcttcttcctcttcttcttcttc 234059



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 233251 tcttcttcctcttcttcttcttct 233228



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 233106 tcttcttcctcttcttcttcttct 233083



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 232923 tcttcttcctcttcttcttcttct 232900



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 232778 tcttcttcctcttcttcttcttct 232755



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 128332 tcttcttcctcttcttcttcttct 128355

to top

>gb|AC120412.12| Mus musculus chromosome 5, clone RP24-447P14, complete sequence
          Length = 149454

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 13960 tctcttcttcctcttcttcttcttct 13985

to top

>gb|AC102602.9| Mus musculus chromosome 9, clone RP23-381L11, complete sequence
          Length = 253504

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 57766 tctcttcttcctcttcttcctcttct 57791

to top

>gb|AC163348.5| Mus musculus BAC clone RP23-230L2 from chromosome 12, complete sequence
          Length = 233932

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 374    tctcttcttcctcttcttcatc 395
              ||||||||||||||||||||||
Sbjct: 221485 tctcttcttcctcttcttcatc 221506

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 378     ttcttcctcttcttcatcttct 399
               ||||||||||||||||||||||
Sbjct: 9254350 ttcttcctcttcttcatcttct 9254371



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 375     ctcttcttcctcttcttcatcttct 399
               |||||||||||||||||| ||||||
Sbjct: 3023000 ctcttcttcctcttcttcttcttct 3022976



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 379      tcttcctcttcttcatcttc 398
                ||||||||||||||||||||
Sbjct: 27409720 tcttcctcttcttcatcttc 27409739



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 376      tcttcttcctcttcttcatc 395
                ||||||||||||||||||||
Sbjct: 10652971 tcttcttcctcttcttcatc 10652990



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 376     tcttcttcctcttcttcatcttct 399
               |||||||| |||||||||||||||
Sbjct: 5454742 tcttcttcatcttcttcatcttct 5454719



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 372     tctctcttcttcctcttcttcatcttct 399
               |||||||||||| |||||||| ||||||
Sbjct: 3200679 tctctcttcttcttcttcttcttcttct 3200652

to top

>emb|AL731744.6|CNS08C7T Oryza sativa chromosome 12, . BAC OSJNBa0026C14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 190718

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 378    ttcttcctcttcttcatcttct 399
              ||||||||||||||||||||||
Sbjct: 184590 ttcttcctcttcttcatcttct 184569

to top

>gb|AC140250.3| Mus musculus BAC clone RP24-288J3 from 1, complete sequence
          Length = 163490

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 378   ttcttcctcttcttcatcttct 399
             ||||||||||||||||||||||
Sbjct: 24906 ttcttcctcttcttcatcttct 24927



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 24922 tcttcttcctcttcttcctcttct 24945

to top

>emb|CT025674.13| Mouse DNA sequence from clone RP24-364I17 on chromosome 13, complete
             sequence
          Length = 117646

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 95870 tctcttcttcctcttcttcctcttct 95895

to top

>gb|AC134598.3| Mus musculus BAC clone RP23-175C23 from 8, complete sequence
          Length = 205622

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||| ||||||||||||||||||
Sbjct: 57183 tctcttcctcctcttcttcatcttct 57208

to top

>gb|AC134249.4| Mus musculus BAC clone RP23-359K17 from 12, complete sequence
          Length = 190423

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 374   tctcttcttcctcttcttcatcttct 399
             ||||||||||||||||||| ||||||
Sbjct: 41163 tctcttcttcctcttcttcctcttct 41188

to top

>emb|CT030654.8| Mouse DNA sequence from clone RP23-332G16 on chromosome 17, complete
              sequence
          Length = 194694

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 178600 tctcttcttcctcttcttcctcttct 178625



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 178574 tctcttcttcctcttcttcctcttct 178599

to top

>gb|AC167020.3| Mus musculus BAC clone RP23-201I6 from chromosome 1, complete sequence
          Length = 209249

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 373    ctctcttcttcctcttcttcatcttc 398
              |||||||||||||||||||| |||||
Sbjct: 151183 ctctcttcttcctcttcttcctcttc 151158

to top

>gb|AC153936.3| Mus musculus 10 BAC RP24-114G19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 170723

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 376   tcttcttcctcttcttcatctt 397
             ||||||||||||||||||||||
Sbjct: 40054 tcttcttcctcttcttcatctt 40075

to top

>emb|AL671520.6| Mouse DNA sequence from clone RP23-99G21 on chromosome 4, complete
              sequence
          Length = 213303

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 117794 tctcttcttcctcttcttcttcttct 117819

to top

>gb|AC118475.44| Mus musculus chromosome 13, clone RP23-359G8, complete sequence
          Length = 190284

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 374    tctcttcttcctcttcttcatcttct 399
              ||||||||||||||||||| ||||||
Sbjct: 178350 tctcttcttcctcttcttcctcttct 178325

to top

>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence
          Length = 214638

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 18167 ctcttcttcctcttcttcttcttct 18143

to top

>gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, complete sequence
          Length = 180660

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103796 ctcttcttcctcttcttcctcttct 103772



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103787 ctcttcttcctcttcttcctcttct 103763



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103778 ctcttcttcctcttcttcctcttct 103754



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103769 ctcttcttcctcttcttcctcttct 103745



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103760 ctcttcttcctcttcttcctcttct 103736



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103751 ctcttcttcctcttcttcctcttct 103727



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103742 ctcttcttcctcttcttcctcttct 103718



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103733 ctcttcttcctcttcttcctcttct 103709



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103724 ctcttcttcctcttcttcctcttct 103700



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103715 ctcttcttcctcttcttcctcttct 103691



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103649 ctcttcttcctcttcttcctcttct 103625



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103640 ctcttcttcctcttcttcctcttct 103616



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103631 ctcttcttcctcttcttcctcttct 103607



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103622 ctcttcttcctcttcttcctcttct 103598



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103613 ctcttcttcctcttcttcctcttct 103589



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103604 ctcttcttcctcttcttcctcttct 103580



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 103595 ctcttcttcctcttcttcttcttct 103571



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||
Sbjct: 103706 ctcttcttcctcttcttcctcttc 103683

to top

>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence
          Length = 152183

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 57535 ctcttcttcctcttcttcttcttct 57511



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 57543 tcttcttcctcttcttcctcttct 57520



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 57220 ctcttcttcctcttcttcctcttc 57197

to top

>gb|BC108726.1| Homo sapiens cDNA clone MGC:131940 IMAGE:5194296, complete cds
          Length = 1684

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 375 ctcttcttcctcttcttcatcttct 399
           ||||||||||||||| |||||||||
Sbjct: 521 ctcttcttcctcttcctcatcttct 497

to top

>ref|NM_129199.1| Arabidopsis thaliana unknown protein AT2G36420 mRNA, complete cds
          Length = 1320

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 379 tcttcctcttcttcatcttct 399
           |||||||||||||||||||||
Sbjct: 974 tcttcctcttcttcatcttct 954

to top

>ref|NM_128900.2| Arabidopsis thaliana unknown protein AT2G33400 mRNA, complete cds
          Length = 1573

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 tctcttcttcctcttcttcatcttc 398
           |||||||||| ||||||||||||||
Sbjct: 685 tctcttcttcttcttcttcatcttc 661

to top

>ref|NM_103511.3| Arabidopsis thaliana SEU (SEUSS); transcription cofactor AT1G43850
            (SEU) mRNA, complete cds
          Length = 3688

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 374  tctcttcttcctcttcttcat 394
            |||||||||||||||||||||
Sbjct: 3257 tctcttcttcctcttcttcat 3237

to top

>ref|NM_115653.1| Arabidopsis thaliana nucleic acid binding AT3G57910 mRNA, complete
           cds
          Length = 798

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 375 ctcttcttcctcttcttcatc 395
           |||||||||||||||||||||
Sbjct: 654 ctcttcttcctcttcttcatc 634

to top

>gb|AC140431.4| Mus musculus BAC clone RP24-172K3 from chromosome 7, complete sequence
          Length = 172958

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 23331 ctcttcttcctcttcttcctcttct 23307



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 23322 ctcttcttcctcttcttcttcttct 23298



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 24208 tcttcttcctcttcttcttcttct 24185



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 23339 tcttcttcctcttcttcctcttct 23316



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 23288 tcttcttcctcttcttcttcttct 23265



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 22693 tcttcttcctcttcttcttcttct 22670

to top

>gb|AC161810.10| Mus musculus chromosome 3, clone RP24-363L5, complete sequence
          Length = 151433

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 119946 ctcttcttcctcttcttcctcttct 119970

to top

>gb|AY953294.1| Sparus aurata skeletal troponin T mRNA, complete cds
          Length = 825

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 375 ctcttcttcctcttcttcatcttct 399
           ||||||||||||||||||| |||||
Sbjct: 99  ctcttcttcctcttcttcaacttct 75

to top

>gb|AC137127.11| Mus musculus chromosome 9, clone RP24-264F17, complete sequence
          Length = 181842

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 174072 ctcttcttcctcttcttcttcttct 174048



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 173960 tcttcttcctcttcttcttcttct 173937

to top

>gb|AC116375.11| Mus musculus chromosome 5, clone RP24-197K18, complete sequence
          Length = 150306

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 61210 ctcttcttcctcttcttcttcttct 61234



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 61202 tcttcttcctcttcttcctcttct 61225

to top

>ref|XM_511457.1| PREDICTED: Pan troglodytes similar to Dopamine- and cAMP-regulated
            neuronal phosphoprotein (DARPP-32) (LOC454632), mRNA
          Length = 2550

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 375  ctcttcttcctcttcttcatc 395
            |||||||||||||||||||||
Sbjct: 2343 ctcttcttcctcttcttcatc 2323

to top

>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence
          Length = 175318

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 47278 ctcttcttcctcttcttcttcttct 47302



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 47269 ctcttcttcctcttcttcctcttct 47293



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 47260 ctcttcttcctcttcttcctcttct 47284



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 47251 ctcttcttcctcttcttcctcttct 47275



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 47161 ctcttcttcctcttcttcctcttct 47185



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 46975 ctcttcttcctcttcttcctcttct 46999



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 46939 ctcttcttcctcttcttcttcttct 46963



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 47170 ctcttcttcctcttcttcctcttc 47193



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 47137 ctcttcttcctcttcttcctcttc 47160



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 47005 ctcttcttcctcttcttcctcttc 47028



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 46997 tcttcttcctcttcttcctcttct 47020

to top

>ref|XM_631827.1| Dictyostelium discoideum hypothetical protein (DDB0187717), partial
            mRNA
          Length = 3255

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 3243 ctcttcttcctcttcttcctcttct 3219



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||| ||||||
Sbjct: 3251 tcttcttcctcttcttcctcttct 3228

to top

>gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, complete sequence
          Length = 193998

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 186290 ctcttcttcctcttcttcttcttct 186266

to top

>gb|AC115006.12| Mus musculus chromosome 8, clone RP24-184D21, complete sequence
          Length = 163874

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 51767 ctcttcttcctcttcttcctcttct 51791

to top

>gb|AY773858.1| Arabidopsis thaliana clone pENTR221-At2g33400 hypothetical protein
           (At2g33400) mRNA, complete cds
          Length = 819

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 tctcttcttcctcttcttcatcttc 398
           |||||||||| ||||||||||||||
Sbjct: 556 tctcttcttcttcttcttcatcttc 532

to top

>gb|AC123713.13| Mus musculus chromosome 7, clone RP23-391D20, complete sequence
          Length = 183590

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 43333 ctcttcttcctcttcttcctcttct 43309



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 43341 tcttcttcctcttcttcctcttct 43318

to top

>ref|XM_642353.1| Dictyostelium discoideum SMAD/FHA domain-containing protein
            (DDB0220692), partial mRNA
          Length = 2190

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 2049 ctcttcttcctcttcttcctcttct 2025



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            ||||||||||||||| |||||||||
Sbjct: 2031 ctcttcttcctcttcctcatcttct 2007



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 375  ctcttcttcctcttcttcatcttc 398
            |||||||||||||||||| |||||
Sbjct: 2040 ctcttcttcctcttcttcctcttc 2017

to top

>ref|XM_641540.1| Dictyostelium discoideum putative GATA-binding transcription factor
            (DDB0220467), partial mRNA
          Length = 3021

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||| ||||||||||||
Sbjct: 2811 ctcttcttcctcatcttcatcttct 2835

to top

>gb|AC123060.4| Mus musculus chromosome 6 clone RP23-214M22, complete sequence
          Length = 210248

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 206272 ctcttcttcctcttcttcttcttct 206248



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 206280 tcttcttcctcttcttcctcttct 206257

to top

>gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, complete sequence
          Length = 156107

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 97509 ctcttcttcctcttcttcctcttct 97533



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              |||||||| |||||||||||||||
Sbjct: 154681 tcttcttcttcttcttcatcttct 154658



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 97501 tcttcttcctcttcttcctcttct 97524

to top

>ref|XM_638676.1| Dictyostelium discoideum hypothetical protein (DDB0167463), partial
           mRNA
          Length = 222

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 375 ctcttcttcctcttcttcatcttct 399
           |||||||||||||||||| ||||||
Sbjct: 144 ctcttcttcctcttcttcttcttct 120



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 376 tcttcttcctcttcttcatcttct 399
           ||||||||||||||||| ||||||
Sbjct: 152 tcttcttcctcttcttcctcttct 129

to top

>ref|XM_630974.1| Dictyostelium discoideum hypothetical protein (DDB0188529), partial
           mRNA
          Length = 5115

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 378 ttcttcctcttcttcatcttc 398
           |||||||||||||||||||||
Sbjct: 753 ttcttcctcttcttcatcttc 733

to top

>ref|XM_630226.1| Dictyostelium discoideum hypothetical protein (DDB0183998), partial
            mRNA
          Length = 1992

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 379  tcttcctcttcttcatcttct 399
            |||||||||||||||||||||
Sbjct: 1979 tcttcctcttcttcatcttct 1959



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 375  ctcttcttcctcttcttcatcttc 398
            ||||||||| ||||||||||||||
Sbjct: 1974 ctcttcttcatcttcttcatcttc 1951

to top

>gb|AC159309.2| Mus musculus BAC clone RP23-157H14 from chromosome 16, complete sequence
          Length = 201546

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              ||||||||| |||||||||||||||
Sbjct: 107969 ctcttcttcttcttcttcatcttct 107993

to top

>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete
            sequence
          Length = 162597

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 8119 ctcttcttcctcttcttcctcttct 8143



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 8110 ctcttcttcctcttcttcctcttct 8134



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 8101 ctcttcttcctcttcttcctcttct 8125



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 8092 ctcttcttcctcttcttcctcttct 8116



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 375  ctcttcttcctcttcttcatcttct 399
            |||||||||||||||||| ||||||
Sbjct: 8083 ctcttcttcctcttcttcctcttct 8107



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 28250 tcttcttcctcttcttcttcttct 28273



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||| ||||||
Sbjct: 8249 tcttcttcctcttcttcttcttct 8272



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 375  ctcttcttcctcttcttcatcttc 398
            |||||||||||||||||| |||||
Sbjct: 8128 ctcttcttcctcttcttcctcttc 8151



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 376  tcttcttcctcttcttcatcttct 399
            ||||||||||||||||| ||||||
Sbjct: 8075 tcttcttcctcttcttcctcttct 8098

to top

>gb|AC162799.4| Mus musculus BAC clone RP24-392E13 from chromosome 3, complete sequence
          Length = 177586

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 29528 ctcttcttcctcttcttcttcttct 29552



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 29520 tcttcttcctcttcttcctcttct 29543

to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 164347 ctcttcttcctcttcttcctcttct 164371



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 164266 ctcttcttcctcttcttcttcttct 164290



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 164257 ctcttcttcctcttcttcctcttct 164281



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 164564 tcttcttcctcttcttcttcttct 164587



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||
Sbjct: 164323 ctcttcttcctcttcttcctcttc 164346



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 375    ctcttcttcctcttcttcatcttc 398
              |||||||||||||||||| |||||
Sbjct: 164299 ctcttcttcctcttcttcctcttc 164322

to top

>gb|AC165236.5| Mus musculus chromosome 5, clone RP23-348C18, complete sequence
          Length = 204772

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    tctctcttcttcctcttcttc 392
              |||||||||||||||||||||
Sbjct: 142150 tctctcttcttcctcttcttc 142170

to top

>ref|XM_510635.1| PREDICTED: Pan troglodytes similar to KIAA0596 protein (LOC453704),
           mRNA
          Length = 505

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 375 ctcttcttcctcttcttcatc 395
           |||||||||||||||||||||
Sbjct: 309 ctcttcttcctcttcttcatc 289

to top

>gb|BC059793.1| Danio rerio v-myc myelocytomatosis viral related oncogene,
           neuroblastoma derived (avian), mRNA (cDNA clone
           IMAGE:6788938), partial cds
          Length = 2452

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 379 tcttcctcttcttcatcttct 399
           |||||||||||||||||||||
Sbjct: 820 tcttcctcttcttcatcttct 800



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 376 tcttcttcctcttcttcatc 395
           ||||||||||||||||||||
Sbjct: 805 tcttcttcctcttcttcatc 786

to top

>gb|BC067586.1| Danio rerio v-myc myelocytomatosis viral related oncogene,
           neuroblastoma derived (avian), mRNA (cDNA clone
           MGC:85706 IMAGE:6964714), complete cds
          Length = 2490

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 379 tcttcctcttcttcatcttct 399
           |||||||||||||||||||||
Sbjct: 809 tcttcctcttcttcatcttct 789



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 376 tcttcttcctcttcttcatc 395
           ||||||||||||||||||||
Sbjct: 794 tcttcttcctcttcttcatc 775

to top

>ref|XM_524732.1| PREDICTED: Pan troglodytes similar to mesoderm induction early
           response 1 (LOC469347), mRNA
          Length = 2172

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 375 ctcttcttcctcttcttcatcttct 399
           ||||||||||||||| |||||||||
Sbjct: 906 ctcttcttcctcttcctcatcttct 882

to top

>ref|NM_015884.1| Homo sapiens membrane-bound transcription factor peptidase, site 2
           (MBTPS2), mRNA
          Length = 1759

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 379 tcttcctcttcttcatcttct 399
           |||||||||||||||||||||
Sbjct: 475 tcttcctcttcttcatcttct 495

to top

>gb|AC166646.4| Mus musculus chromosome 3, clone RP24-400P18, complete sequence
          Length = 176864

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67276 ctcttcttcctcttcttcttcttct 67300



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67267 ctcttcttcctcttcttcctcttct 67291



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67258 ctcttcttcctcttcttcctcttct 67282



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67249 ctcttcttcctcttcttcctcttct 67273



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67240 ctcttcttcctcttcttcctcttct 67264



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67231 ctcttcttcctcttcttcctcttct 67255



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67222 ctcttcttcctcttcttcctcttct 67246



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67213 ctcttcttcctcttcttcctcttct 67237



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67204 ctcttcttcctcttcttcctcttct 67228



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67195 ctcttcttcctcttcttcctcttct 67219



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67186 ctcttcttcctcttcttcctcttct 67210



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67177 ctcttcttcctcttcttcctcttct 67201



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 67168 ctcttcttcctcttcttcctcttct 67192

to top

>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence
          Length = 176668

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26817 ctcttcttcctcttcttcctcttct 26841



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26808 ctcttcttcctcttcttcctcttct 26832



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26799 ctcttcttcctcttcttcctcttct 26823



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26766 ctcttcttcctcttcttcctcttct 26790



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26757 ctcttcttcctcttcttcctcttct 26781



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26748 ctcttcttcctcttcttcctcttct 26772



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26739 ctcttcttcctcttcttcctcttct 26763



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 26712 ctcttcttcctcttcttcttcttct 26736



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 27004 tcttcttcctcttcttcttcttct 27027



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 26775 ctcttcttcctcttcttcctcttc 26798



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 26731 tcttcttcctcttcttcctcttct 26754



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 26704 tcttcttcctcttcttcctcttct 26727

to top

>gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, complete sequence
          Length = 212923

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 52710 ctcttcttcctcttcttcctcttct 52686



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 52718 tcttcttcctcttcttcctcttct 52695



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 375   ctcttcttcctcttcttcatcttc 398
             |||||||||||||||||| |||||
Sbjct: 52701 ctcttcttcctcttcttcctcttc 52678

to top

>gb|AC153607.15| Mus musculus 6 BAC RP23-100I21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222828

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 43117 ctcttcttcctcttcttcttcttct 43141

to top

>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold
          Length = 1743090

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 826973 ctcttcttcctcttcttcctcttct 826949



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 375    ctcttcttcctcttcttcatcttct 399
              |||||||||||||||||| ||||||
Sbjct: 826943 ctcttcttcctcttcttcctcttct 826919



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    tcttcttcctcttcttcatcttct 399
              ||||||||||||||||| ||||||
Sbjct: 826951 tcttcttcctcttcttcctcttct 826928

to top

>gb|AC115868.12| Mus musculus chromosome 7, clone RP24-329F21, complete sequence
          Length = 181717

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctcttcttcctcttcttcatcttct 399
             |||||||||||||||||| ||||||
Sbjct: 81336 ctcttcttcctcttcttcctcttct 81360



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             |||||||| |||||||||||||||
Sbjct: 81463 tcttcttcttcttcttcatcttct 81486



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             |||||||| |||||||||||||||
Sbjct: 81445 tcttcttcttcttcttcatcttct 81468



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 81328 tcttcttcctcttcttcctcttct 81351



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tcttcttcctcttcttcatcttct 399
             ||||||||||||||||| ||||||
Sbjct: 81268 tcttcttcctcttcttcttcttct 81291


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,189,707
Number of Sequences: 3902068
Number of extensions: 4189707
Number of successful extensions: 169632
Number of sequences better than 10.0: 3074
Number of HSP's better than 10.0 without gapping: 3093
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 153198
Number of HSP's gapped (non-prelim): 16113
length of query: 399
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 377
effective length of database: 17,147,199,772
effective search space: 6464494314044
effective search space used: 6464494314044
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result