ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet63e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL161612.13| Human DNA sequence from clone RP11-196P2 on chr... 46 0.093
2gb|AC058784.17|AC058784 Homo sapiens chromosome 13 clone RP11-28... 46 0.093
3gb|AC108101.2| Homo sapiens chromosome 5 clone RP11-125H10, comp... 44 0.37
4gb|AC092280.2| Homo sapiens chromosome 5 clone CTD-2028M21, comp... 44 0.37
5gb|AC106803.3| Homo sapiens chromosome 5 clone RP11-478A7, compl... 44 0.37
6ref|XM_451320.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A07216g ... 42 1.4
7ref|XM_451321.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A07227g ... 42 1.4
8emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 42 1.4
9gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete g... 40 5.7
10gb|AC167018.4| Mus musculus BAC clone RP23-354F11 from chromosom... 40 5.7
11gb|AC124445.4| Mus musculus BAC clone RP24-191B18 from chromosom... 40 5.7
12gb|AC090821.13| Homo sapiens chromosome 8, clone CTD-2309H9, com... 40 5.7
13emb|Z73896.1|CEF09E8 Caenorhabditis elegans Cosmid F09E8, comple... 40 5.7
14gb|DQ366729.1| Uncultured Prochlorococcus marinus clone HF10-88H... 40 5.7
15emb|AL354653.26| Human DNA sequence from clone RP11-326A14 on ch... 40 5.7
16dbj|AK135233.1| Mus musculus 12 days embryo male wolffian duct i... 40 5.7
17gb|AC008948.8| Homo sapiens chromosome 5 clone CTD-2333K2, compl... 40 5.7
18gb|AC122360.4| Mus musculus BAC clone RP23-428P21 from chromosom... 40 5.7
19dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
20dbj|AP006058.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
21emb|AL805930.16| Mouse DNA sequence from clone RP23-455B8 on chr... 40 5.7

>emb|AL161612.13| Human DNA sequence from clone RP11-196P2 on chromosome 13 Contains a
             novel gene, complete sequence
          Length = 160145

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 132   agcatcttataaattacaactta 154
             |||||||||||||||||||||||
Sbjct: 32671 agcatcttataaattacaactta 32649



to top

>gb|AC058784.17|AC058784 Homo sapiens chromosome 13 clone RP11-288O16, complete sequence
          Length = 163781

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 132   agcatcttataaattacaactta 154
             |||||||||||||||||||||||
Sbjct: 24011 agcatcttataaattacaactta 24033



to top

>gb|AC108101.2| Homo sapiens chromosome 5 clone RP11-125H10, complete sequence
          Length = 144841

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 6     atgcttctagaactgatgtgca 27
             ||||||||||||||||||||||
Sbjct: 26564 atgcttctagaactgatgtgca 26585



to top

>gb|AC092280.2| Homo sapiens chromosome 5 clone CTD-2028M21, complete sequence
          Length = 101502

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 6     atgcttctagaactgatgtgca 27
             ||||||||||||||||||||||
Sbjct: 22226 atgcttctagaactgatgtgca 22247



to top

>gb|AC106803.3| Homo sapiens chromosome 5 clone RP11-478A7, complete sequence
          Length = 169122

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 6      atgcttctagaactgatgtgca 27
              ||||||||||||||||||||||
Sbjct: 160329 atgcttctagaactgatgtgca 160350



to top

>ref|XM_451320.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A07216g predicted mRNA
          Length = 561

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 317 gtaaggctccaagaatccaat 337
           |||||||||||||||||||||
Sbjct: 143 gtaaggctccaagaatccaat 123



to top

>ref|XM_451321.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A07227g predicted mRNA
          Length = 561

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 317 gtaaggctccaagaatccaat 337
           |||||||||||||||||||||
Sbjct: 479 gtaaggctccaagaatccaat 499



to top

>emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome A of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1062590

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 317    gtaaggctccaagaatccaat 337
              |||||||||||||||||||||
Sbjct: 648513 gtaaggctccaagaatccaat 648493



to top

>gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete genome
          Length = 1709204

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 154     acaccttcaggcctttcaaa 173
               ||||||||||||||||||||
Sbjct: 1338386 acaccttcaggcctttcaaa 1338367



to top

>gb|AC167018.4| Mus musculus BAC clone RP23-354F11 from chromosome 16, complete
             sequence
          Length = 199488

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   acaacatagcttcagccttc 223
             ||||||||||||||||||||
Sbjct: 56368 acaacatagcttcagccttc 56387



to top

>gb|AC124445.4| Mus musculus BAC clone RP24-191B18 from chromosome 10, complete
            sequence
          Length = 190295

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 334  caatgaacctgtaacaggtg 353
            ||||||||||||||||||||
Sbjct: 1729 caatgaacctgtaacaggtg 1710



to top

>gb|AC090821.13| Homo sapiens chromosome 8, clone CTD-2309H9, complete sequence
          Length = 166843

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   tcaaatgacatttccttgga 188
             ||||||||||||||||||||
Sbjct: 50593 tcaaatgacatttccttgga 50612



to top

>emb|Z73896.1|CEF09E8 Caenorhabditis elegans Cosmid F09E8, complete sequence
          Length = 40124

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   ttttggaaaaagaattggaa 124
             ||||||||||||||||||||
Sbjct: 25280 ttttggaaaaagaattggaa 25299



to top

>gb|DQ366729.1| Uncultured Prochlorococcus marinus clone HF10-88H9 genomic sequence
          Length = 34302

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   acaccttcaggcctttcaaa 173
             ||||||||||||||||||||
Sbjct: 24262 acaccttcaggcctttcaaa 24281



to top

>emb|AL354653.26| Human DNA sequence from clone RP11-326A14 on chromosome Xq13.3-21.2
            Contains the 3' end of the RPS6KA6 gene for ribosomal
            protein S6 kinase, complete sequence
          Length = 173760

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 167  tttcaaatgacatttccttg 186
            ||||||||||||||||||||
Sbjct: 6492 tttcaaatgacatttccttg 6473



to top

>dbj|AK135233.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720441I06 product:unclassifiable, full insert
           sequence
          Length = 2303

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 acaacatagcttcagccttc 223
           ||||||||||||||||||||
Sbjct: 690 acaacatagcttcagccttc 671



to top

>gb|AC008948.8| Homo sapiens chromosome 5 clone CTD-2333K2, complete sequence
          Length = 176656

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 115   agaattggaagtactggagcatct 138
             |||||||||||||| |||||||||
Sbjct: 65154 agaattggaagtacaggagcatct 65131



to top

>gb|AC122360.4| Mus musculus BAC clone RP23-428P21 from chromosome 10, complete sequence
          Length = 210757

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 334    caatgaacctgtaacaggtg 353
              ||||||||||||||||||||
Sbjct: 170751 caatgaacctgtaacaggtg 170732



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
              complete sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 246    acatttgaactagtgtacat 265
              ||||||||||||||||||||
Sbjct: 205507 acatttgaactagtgtacat 205488



to top

>dbj|AP006058.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBa0066B16
          Length = 190143

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 246    acatttgaactagtgtacat 265
              ||||||||||||||||||||
Sbjct: 101005 acatttgaactagtgtacat 100986



to top

>emb|AL805930.16| Mouse DNA sequence from clone RP23-455B8 on chromosome 4, complete
             sequence
          Length = 174746

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   cctttcaaatgacatttcct 184
             ||||||||||||||||||||
Sbjct: 14335 cctttcaaatgacatttcct 14354


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,686,821
Number of Sequences: 3902068
Number of extensions: 3686821
Number of successful extensions: 93449
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93381
Number of HSP's gapped (non-prelim): 68
length of query: 426
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 404
effective length of database: 17,147,199,772
effective search space: 6927468707888
effective search space used: 6927468707888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top