>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 1       tattttgctaaaaaaacacg 20
               ||||||||||||||||||||
Sbjct: 2893434 tattttgctaaaaaaacacg 2893453

>gb|U97403.2| Caenorhabditis elegans cosmid T10E9, complete sequence
          Length = 27586

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 82  ttttcgaacgtataaacca 100
           |||||||||||||||||||
Sbjct: 620 ttttcgaacgtataaacca 638

>emb|AL157836.11| Human DNA sequence from clone RP11-477D14 on chromosome 10, complete
             sequence
          Length = 175382

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     tattttgctaaaaaaacac 19
             |||||||||||||||||||
Sbjct: 36427 tattttgctaaaaaaacac 36445

>gb|S70730.1| triose phosphate isomerase=5.3.1.1 [Stellaria longipes, mRNA, 1064
           nt]
          Length = 1064

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 5   ttgctaaaaaaacacggtccatg 27
           |||||||||| ||||||||||||
Sbjct: 927 ttgctaaaaatacacggtccatg 905

>ref|NM_059477.1| Caenorhabditis elegans T10E9.5 (T10E9.5) mRNA, complete cds
          Length = 714

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ttttcgaacgtataaacca 100
           |||||||||||||||||||
Sbjct: 611 ttttcgaacgtataaacca 593

>gb|AC156541.7| Mus musculus chromosome 1, clone RP23-478I8, complete sequence
          Length = 173297

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 65    cacccatgactttgagctt 83
             |||||||||||||||||||
Sbjct: 99195 cacccatgactttgagctt 99177

>gb|AC101783.12| Mus musculus chromosome 1, clone RP24-136B19, complete sequence
          Length = 169909

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 65     cacccatgactttgagctt 83
              |||||||||||||||||||
Sbjct: 119779 cacccatgactttgagctt 119797


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 760,997
Number of Sequences: 3902068
Number of extensions: 760997
Number of successful extensions: 47226
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47194
Number of HSP's gapped (non-prelim): 32
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)