ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet61c01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC124603.5| Mus musculus BAC clone RP23-52H14 from chromosome... 46 0.038
2gb|AC159425.1| Trypanosoma brucei chromosome 3 clone RPCI93-27F1... 42 0.60
3emb|AL441964.4| Human DNA sequence from clone RP11-151G12 on chr... 42 0.60
4emb|AL031368.2|HS662N3 Human DNA sequence from clone RP4-662N3 o... 42 0.60
5emb|AL928632.13| Mouse DNA sequence from clone RP23-303M15 on ch... 42 0.60
6gb|AC153889.19| Mus musculus 10 BAC RP23-434A12 (Roswell Park Ca... 40 2.4
7emb|CR388061.11| Zebrafish DNA sequence from clone DKEY-69P22 in... 40 2.4
8gb|AC093605.3| Homo sapiens BAC clone RP11-583P24 from 4, comple... 40 2.4
9gb|AC025105.10| Homo sapiens chromosome 18, clone RP11-695P1, co... 40 2.4
10gb|AC154190.2| Mus musculus BAC clone RP24-465P16 from chromosom... 40 2.4
11gb|AC155278.5| Mus musculus 6 BAC RP24-141E2 (Roswell Park Cance... 40 2.4
12gb|AC073895.22| Homo sapiens 3 BAC RP11-622L21 (Roswell Park Can... 40 2.4
13emb|CT030235.12| Mouse DNA sequence from clone RP23-240F19 on ch... 40 2.4
14emb|AL831714.14| Mouse DNA sequence from clone RP23-311D24 on ch... 40 2.4
15gb|AC171183.6| Mus musculus BAC RP24-545B2 (Roswell Park Cancer... 40 2.4
16dbj|AP004371.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 2.4
17gb|AC101727.8| Mus musculus chromosome 1, clone RP23-327G3, comp... 38 9.3
18ref|XM_642356.1| Dictyostelium discoideum hypothetical protein (... 38 9.3
19gb|AC079632.4| Oryza sativa (japonica cultivar-group) chromosome... 38 9.3
20gb|AC145616.2| Homo sapiens BAC clone RP11-1172A19 from UL, comp... 38 9.3
21gb|AC145547.3| Homo sapiens BAC clone RP11-1437O6 from UL, compl... 38 9.3
22emb|CT010512.8| Mouse DNA sequence from clone RP23-283M18 on chr... 38 9.3
23emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 38 9.3
24gb|AC112150.4| Mus musculus BAC clone RP24-84I17 from chromosome... 38 9.3
25emb|CR376747.28| Zebrafish DNA sequence from clone CH211-248D20 ... 38 9.3
26gb|AC122885.4| Mus musculus BAC clone RP23-90H14 from chromosome... 38 9.3
27gb|AC122500.5| Mus musculus BAC clone RP24-409J4 from chromosome... 38 9.3
28gb|AC112154.4| Mus musculus BAC clone RP24-98L2 from chromosome ... 38 9.3
29gb|AE014313.1| Homo sapiens chromosome 13q34 schizophrenia regio... 38 9.3
30ref|XM_648673.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 38 9.3
31gb|AC004894.1| Homo sapiens PAC clone RP4-808G16 from 7, complet... 38 9.3
32emb|AL365444.11| Human DNA sequence from clone RP11-115P16 on ch... 38 9.3
33emb|AL359704.9| Human DNA sequence from clone RP11-118H4 on chro... 38 9.3
34emb|AL159982.17| Human DNA sequence from clone RP11-94P17 on chr... 38 9.3
35gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome... 38 9.3
36emb|AJ458447.1|DME458447 Drosophila melanogaster mRNA for procto... 38 9.3
37gb|AC166065.1| Oryza sativa (japonica cultivar-group) chromosome... 38 9.3
38gb|AC151907.5| Mus musculus BAC clone RP23-163E23 from chromosom... 38 9.3
39gb|AY119161.1| Drosophila melanogaster RH15319 full insert cDNA 38 9.3
40dbj|AK124630.1| Homo sapiens cDNA FLJ42639 fis, clone BRACE3024662 38 9.3
41gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Can... 38 9.3
42gb|AC051634.6| Oryza sativa chromosome 10 BAC OSJNBb0018B10 geno... 38 9.3
43ref|NM_135314.2| Drosophila melanogaster Proctolin CG7105-RA (Pr... 38 9.3
44gb|AC108883.1| Genomic sequence for (japonica cultivar-group) cu... 38 9.3
45ref|XM_686569.1| PREDICTED: Danio rerio similar to cingulin (LOC... 38 9.3
46gb|AC012495.9| Homo sapiens BAC clone RP11-327F6 from 2, complet... 38 9.3
47gb|AC154618.2| Mus musculus BAC clone RP23-321M11 from chromosom... 38 9.3
48emb|BX276115.11| Zebrafish DNA sequence from clone DKEY-274M17 i... 38 9.3
49gb|AC008329.3|AC008329 Drosophila melanogaster, chromosome 2L, r... 38 9.3
50dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.3
51gb|AC013731.10| Homo sapiens BAC clone RP11-546J1 from 2, comple... 38 9.3
52gb|AC134729.2| Homo sapiens 3 BAC RP11-671L3 (Roswell Park Cance... 38 9.3
53gb|AC068769.19| Homo sapiens 3 BAC RP11-14I2 (Roswell Park Cance... 38 9.3
54emb|CR628394.17| Zebrafish DNA sequence from clone DKEY-204A24 i... 38 9.3
55emb|AL606751.5| Zebrafish DNA sequence from clone BUSM1-173A8 in... 38 9.3
56gb|AE003619.3| Drosophila melanogaster chromosome 2L, section 28... 38 9.3
57emb|BX005016.8| Zebrafish DNA sequence from clone DKEY-104E13 in... 38 9.3
58gb|AC004723.1|AC004723 Drosophila melanogaster, chromosome 2L, r... 38 9.3
59gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 9.3
60emb|CR933002.7| Zebrafish DNA sequence from clone DKEY-246A18 in... 38 9.3
61emb|AL928801.6| Mouse DNA sequence from clone RP23-116P4 on chro... 38 9.3
62emb|AL672004.12| Mouse DNA sequence from clone RP23-200C21 on ch... 38 9.3 
>gb|AC124603.5| Mus musculus BAC clone RP23-52H14 from chromosome 14, complete sequence
          Length = 179891

 Score = 46.1 bits (23), Expect = 0.038
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 47    aatcatcttttataacttataagccagtgatctat 81
             |||||||||  ||||||||||||||||| ||||||
Sbjct: 50159 aatcatcttcaataacttataagccagtaatctat 50125
to top
>gb|AC159425.1| Trypanosoma brucei chromosome 3 clone RPCI93-27F10, complete sequence
          Length = 135196

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 39     ttcgtccgaatcatcttttat 59
              |||||||||||||||||||||
Sbjct: 134315 ttcgtccgaatcatcttttat 134335
to top
>emb|AL441964.4| Human DNA sequence from clone RP11-151G12 on chromosome X Contains a
             mortality factor 4 like 1 (MORF4L1) pseudogene and a novel
             pseudogene, complete sequence
          Length = 92775

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 155   ttgagatatattccatcacta 175
             |||||||||||||||||||||
Sbjct: 25173 ttgagatatattccatcacta 25153
to top
>emb|AL031368.2|HS662N3 Human DNA sequence from clone RP4-662N3 on chromosome Xp21.1-21.3,
             complete sequence
          Length = 143890

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 56    ttataacttataagccagtga 76
             |||||||||||||||||||||
Sbjct: 43053 ttataacttataagccagtga 43033
to top
>emb|AL928632.13| Mouse DNA sequence from clone RP23-303M15 on chromosome 2, complete
            sequence
          Length = 217309

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 85   agcagagcaattcagggcctg 105
            |||||||||||||||||||||
Sbjct: 8194 agcagagcaattcagggcctg 8214
to top
>gb|AC153889.19| Mus musculus 10 BAC RP23-434A12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190042

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 58     ataacttataagccagtgatctat 81
              ||||||||||||||| ||||||||
Sbjct: 181319 ataacttataagccattgatctat 181342
to top
>emb|CR388061.11| Zebrafish DNA sequence from clone DKEY-69P22 in linkage group 5,
             complete sequence
          Length = 122069

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   aaattcacaacaatctcaat 144
             ||||||||||||||||||||
Sbjct: 75654 aaattcacaacaatctcaat 75673
to top
>gb|AC093605.3| Homo sapiens BAC clone RP11-583P24 from 4, complete sequence
          Length = 187035

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 151    ataattgagatatattccat 170
              ||||||||||||||||||||
Sbjct: 153193 ataattgagatatattccat 153212
to top
>gb|AC025105.10| Homo sapiens chromosome 18, clone RP11-695P1, complete sequence
          Length = 201027

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 74    tgatctatgtgagcagagca 93
             ||||||||||||||||||||
Sbjct: 42235 tgatctatgtgagcagagca 42254
to top
>gb|AC154190.2| Mus musculus BAC clone RP24-465P16 from chromosome 16, complete
             sequence
          Length = 150894

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   cctgtgtgaactttagaatg 121
             ||||||||||||||||||||
Sbjct: 29308 cctgtgtgaactttagaatg 29327
to top
>gb|AC155278.5| Mus musculus 6 BAC RP24-141E2 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 202028

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    aacaatctcaatttctacat 152
              ||||||||||||||||||||
Sbjct: 150885 aacaatctcaatttctacat 150866
to top
>gb|AC073895.22| Homo sapiens 3 BAC RP11-622L21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 167311

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 120   tgcagaaattcacaacaatc 139
             ||||||||||||||||||||
Sbjct: 20822 tgcagaaattcacaacaatc 20803
to top
>emb|CT030235.12| Mouse DNA sequence from clone RP23-240F19 on chromosome 16, complete
             sequence
          Length = 236028

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   cctgtgtgaactttagaatg 121
             ||||||||||||||||||||
Sbjct: 17120 cctgtgtgaactttagaatg 17101
to top
>emb|AL831714.14| Mouse DNA sequence from clone RP23-311D24 on chromosome 4, complete
             sequence
          Length = 120815

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   agaaattcacaacaatctca 142
             ||||||||||||||||||||
Sbjct: 23698 agaaattcacaacaatctca 23679
to top
>gb|AC171183.6| Mus musculus  BAC RP24-545B2 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 211697

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 58     ataacttataagccagtgatctat 81
              ||||||||||||||| ||||||||
Sbjct: 134271 ataacttataagccattgatctat 134294
to top
>dbj|AP004371.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-535N6, complete
              sequence
          Length = 180721

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    aacaatctcaatttctacat 152
              ||||||||||||||||||||
Sbjct: 118533 aacaatctcaatttctacat 118514
to top
>gb|AC101727.8| Mus musculus chromosome 1, clone RP23-327G3, complete sequence
          Length = 196065

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 119    atgcagaaattcacaacaa 137
              |||||||||||||||||||
Sbjct: 130850 atgcagaaattcacaacaa 130868
to top
>ref|XM_642356.1| Dictyostelium discoideum hypothetical protein (DDB0189677), partial
            mRNA
          Length = 2736

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 125  aaattcacaacaatctcaa 143
            |||||||||||||||||||
Sbjct: 1551 aaattcacaacaatctcaa 1569
to top
>gb|AC079632.4| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNBa0046L02, complete sequence
          Length = 142381

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 141   caatttctacataattgag 159
             |||||||||||||||||||
Sbjct: 42416 caatttctacataattgag 42398
to top
>gb|AC145616.2| Homo sapiens BAC clone RP11-1172A19 from UL, complete sequence
          Length = 172810

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 8    aatattaataaactcatta 26
            |||||||||||||||||||
Sbjct: 2158 aatattaataaactcatta 2176
to top
>gb|AC145547.3| Homo sapiens BAC clone RP11-1437O6 from UL, complete sequence
          Length = 185637

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 8     aatattaataaactcatta 26
             |||||||||||||||||||
Sbjct: 74708 aatattaataaactcatta 74726
to top
>emb|CT010512.8| Mouse DNA sequence from clone RP23-283M18 on chromosome 16, complete
              sequence
          Length = 202415

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 115    tagaatgcagaaattcaca 133
              |||||||||||||||||||
Sbjct: 186223 tagaatgcagaaattcaca 186205
to top
>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete
              sequence
          Length = 3214944

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 8      aatattaataaactcatta 26
              |||||||||||||||||||
Sbjct: 245950 aatattaataaactcatta 245932
to top
>gb|AC112150.4| Mus musculus BAC clone RP24-84I17 from chromosome 16, complete sequence
          Length = 211640

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 115    tagaatgcagaaattcaca 133
              |||||||||||||||||||
Sbjct: 207868 tagaatgcagaaattcaca 207886
to top
>emb|CR376747.28| Zebrafish DNA sequence from clone CH211-248D20 in linkage group 8,
              complete sequence
          Length = 153394

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 124    gaaattcacaacaatctca 142
              |||||||||||||||||||
Sbjct: 110100 gaaattcacaacaatctca 110082
to top
>gb|AC122885.4| Mus musculus BAC clone RP23-90H14 from chromosome 14, complete sequence
          Length = 186387

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 157    gagatatattccatcacta 175
              |||||||||||||||||||
Sbjct: 150940 gagatatattccatcacta 150958
to top
>gb|AC122500.5| Mus musculus BAC clone RP24-409J4 from chromosome 8, complete sequence
          Length = 175361

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 138    tctcaatttctacataatt 156
              |||||||||||||||||||
Sbjct: 106488 tctcaatttctacataatt 106470
to top
>gb|AC112154.4| Mus musculus BAC clone RP24-98L2 from chromosome 1, complete sequence
          Length = 200202

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 119    atgcagaaattcacaacaa 137
              |||||||||||||||||||
Sbjct: 172976 atgcagaaattcacaacaa 172994
to top
>gb|AE014313.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 10 of
              11 of the complete sequence
          Length = 250029

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 144    tttctacataattgagata 162
              |||||||||||||||||||
Sbjct: 219054 tttctacataattgagata 219072
to top
>ref|XM_648673.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (73.t00012)
            partial mRNA
          Length = 1110

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 126  aattcacaacaatctcaat 144
            |||||||||||||||||||
Sbjct: 1057 aattcacaacaatctcaat 1075
to top
>gb|AC004894.1| Homo sapiens PAC clone RP4-808G16 from 7, complete sequence
          Length = 164511

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    attgagatatattccatca 172
              |||||||||||||||||||
Sbjct: 110359 attgagatatattccatca 110377
to top
>emb|AL365444.11| Human DNA sequence from clone RP11-115P16 on chromosome 1 Contains the 3'
              UTR of a novel gene (DKFZp761P211), the ITPKB gene for
              inositol 1,4,5-trisphosphate 3-kinase B, two novel genes, a
              ribosomal protein S27 (metallopanstimulin 1) (RPS27)
              pseudogene and a CpG island, complete sequence
          Length = 181144

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    gcagaaattcacaacaatc 139
              |||||||||||||||||||
Sbjct: 118827 gcagaaattcacaacaatc 118845
to top
>emb|AL359704.9| Human DNA sequence from clone RP11-118H4 on chromosome 1 Contains the 5'
              end of the ADPRT gene for ADP-ribosyltransferase (NAD+;
              poly (ADP-ribose) polymerase), a ribosomal protein S3A
              (RPS3A) pseudogene, a novel pseudogene, the 5' end of a
              novel gene (DKFZp761P211) and a CpG island, complete
              sequence
          Length = 171501

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 102    cctgtgtgaactttagaat 120
              |||||||||||||||||||
Sbjct: 125925 cctgtgtgaactttagaat 125907
to top
>emb|AL159982.17| Human DNA sequence from clone RP11-94P17 on chromosome 13 Contains the
             3' end of a novel gene (FLJ25324) and a novel gene,
             complete sequence
          Length = 162414

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 144   tttctacataattgagata 162
             |||||||||||||||||||
Sbjct: 19380 tttctacataattgagata 19398
to top
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 141   caatttctacataattgag 159
             |||||||||||||||||||
Sbjct: 56522 caatttctacataattgag 56504
to top
>emb|AJ458447.1|DME458447 Drosophila melanogaster mRNA for proctolin precursor (Proct gene)
          Length = 2001

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 113  tttagaatgcagaaattca 131
            |||||||||||||||||||
Sbjct: 1351 tttagaatgcagaaattca 1369
to top
>gb|AC166065.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OJA1136E01,
             complete sequence
          Length = 105139

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 141   caatttctacataattgag 159
             |||||||||||||||||||
Sbjct: 61661 caatttctacataattgag 61643
to top
>gb|AC151907.5| Mus musculus BAC clone RP23-163E23 from chromosome 15, complete sequence
          Length = 197165

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 56     ttataacttataagccagt 74
              |||||||||||||||||||
Sbjct: 185383 ttataacttataagccagt 185365
to top
>gb|AY119161.1| Drosophila melanogaster RH15319 full insert cDNA
          Length = 2017

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 113  tttagaatgcagaaattca 131
            |||||||||||||||||||
Sbjct: 1351 tttagaatgcagaaattca 1369
to top
>dbj|AK124630.1| Homo sapiens cDNA FLJ42639 fis, clone BRACE3024662
          Length = 3151

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 154 attgagatatattccatca 172
           |||||||||||||||||||
Sbjct: 38  attgagatatattccatca 20
to top
>gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 183896

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 152   taattgagatatattccat 170
             |||||||||||||||||||
Sbjct: 70441 taattgagatatattccat 70459
to top
>gb|AC051634.6| Oryza sativa chromosome 10 BAC OSJNBb0018B10 genomic sequence, complete
             sequence
          Length = 135789

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 108   tgaactttagaatgcagaaattcacaa 134
             ||||||||  |||||||||||||||||
Sbjct: 84693 tgaactttgaaatgcagaaattcacaa 84719
to top
>ref|NM_135314.2| Drosophila melanogaster Proctolin CG7105-RA (Proct), mRNA
          Length = 1980

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 113  tttagaatgcagaaattca 131
            |||||||||||||||||||
Sbjct: 1327 tttagaatgcagaaattca 1345
to top
>gb|AC108883.1| Genomic sequence for (japonica cultivar-group) cultivar Nipponbare
             clone OJ1136E01, from chromosome 10, complete sequence
          Length = 113856

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 141   caatttctacataattgag 159
             |||||||||||||||||||
Sbjct: 57335 caatttctacataattgag 57353
to top
>ref|XM_686569.1| PREDICTED: Danio rerio similar to cingulin (LOC563205), mRNA
          Length = 3797

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 11  attaataaactcattagcc 29
           |||||||||||||||||||
Sbjct: 810 attaataaactcattagcc 828
to top
>gb|AC012495.9| Homo sapiens BAC clone RP11-327F6 from 2, complete sequence
          Length = 215359

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     attagccacaaaaggcttc 41
              |||||||||||||||||||
Sbjct: 148296 attagccacaaaaggcttc 148278
to top
>gb|AC154618.2| Mus musculus BAC clone RP23-321M11 from chromosome 14, complete sequence
          Length = 209522

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 157    gagatatattccatcacta 175
              |||||||||||||||||||
Sbjct: 112007 gagatatattccatcacta 111989
to top
>emb|BX276115.11| Zebrafish DNA sequence from clone DKEY-274M17 in linkage group 11,
              complete sequence
          Length = 175216

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    atgcagaaattcacaacaa 137
              |||||||||||||||||||
Sbjct: 119148 atgcagaaattcacaacaa 119130
to top
>gb|AC008329.3|AC008329 Drosophila melanogaster, chromosome 2L, region 28C-28D, BAC clone
             BACR31D05, complete sequence
          Length = 172633

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   tttagaatgcagaaattca 131
             |||||||||||||||||||
Sbjct: 73773 tttagaatgcagaaattca 73755
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                           
Query: 108      tgaactttagaatgcagaaattcacaa 134
                ||||||||  |||||||||||||||||
Sbjct: 19627502 tgaactttgaaatgcagaaattcacaa 19627528



 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 141   caatttctacataattgag 159
             |||||||||||||||||||
Sbjct: 56522 caatttctacataattgag 56504
to top
>gb|AC013731.10| Homo sapiens BAC clone RP11-546J1 from 2, complete sequence
          Length = 151851

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 130   cacaacaatctcaatttct 148
             |||||||||||||||||||
Sbjct: 92706 cacaacaatctcaatttct 92688
to top
>gb|AC134729.2| Homo sapiens 3 BAC RP11-671L3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 155733

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    attaataaactcattagcc 29
             |||||||||||||||||||
Sbjct: 38294 attaataaactcattagcc 38312
to top
>gb|AC068769.19| Homo sapiens 3 BAC RP11-14I2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 191246

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 112    ctttagaatgcagaaattc 130
              |||||||||||||||||||
Sbjct: 151849 ctttagaatgcagaaattc 151867
to top
>emb|CR628394.17| Zebrafish DNA sequence from clone DKEY-204A24 in linkage group 19,
             complete sequence
          Length = 242800

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    attaataaactcattagcc 29
             |||||||||||||||||||
Sbjct: 27947 attaataaactcattagcc 27965
to top
>emb|AL606751.5| Zebrafish DNA sequence from clone BUSM1-173A8 in linkage group 1,
             complete sequence
          Length = 104334

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 114   ttagaatgcagaaattcacaaca 136
             |||||||||||||||| ||||||
Sbjct: 35672 ttagaatgcagaaattaacaaca 35650
to top
>gb|AE003619.3| Drosophila melanogaster chromosome 2L, section 28 of 83 of the complete
             sequence
          Length = 289516

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   tttagaatgcagaaattca 131
             |||||||||||||||||||
Sbjct: 44163 tttagaatgcagaaattca 44145
to top
>emb|BX005016.8| Zebrafish DNA sequence from clone DKEY-104E13 in linkage group 1,
             complete sequence
          Length = 148275

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 108   tgaactttagaatgcagaa 126
             |||||||||||||||||||
Sbjct: 71477 tgaactttagaatgcagaa 71459
to top
>gb|AC004723.1|AC004723 Drosophila melanogaster, chromosome 2L, region 28C4-28D2, P1 clone
             DS00289, complete sequence
          Length = 52277

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   tttagaatgcagaaattca 131
             |||||||||||||||||||
Sbjct: 39675 tttagaatgcagaaattca 39657
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                           
Query: 108      tgaactttagaatgcagaaattcacaa 134
                ||||||||  |||||||||||||||||
Sbjct: 19638778 tgaactttgaaatgcagaaattcacaa 19638804



 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 141   caatttctacataattgag 159
             |||||||||||||||||||
Sbjct: 56520 caatttctacataattgag 56502
to top
>emb|CR933002.7| Zebrafish DNA sequence from clone DKEY-246A18 in linkage group 1,
             complete sequence
          Length = 31933

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 103   ctgtgtgaactttagaatg 121
             |||||||||||||||||||
Sbjct: 12780 ctgtgtgaactttagaatg 12762
to top
>emb|AL928801.6| Mouse DNA sequence from clone RP23-116P4 on chromosome 2, complete
              sequence
          Length = 132674

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 83     tgagcagagcaattcaggg 101
              |||||||||||||||||||
Sbjct: 126963 tgagcagagcaattcaggg 126981
to top
>emb|AL672004.12| Mouse DNA sequence from clone RP23-200C21 on chromosome 11, complete
             sequence
          Length = 101730

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    atgtgagcagagcaattca 98
             |||||||||||||||||||
Sbjct: 84056 atgtgagcagagcaattca 84038


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,996,046
Number of Sequences: 3902068
Number of extensions: 1996046
Number of successful extensions: 142759
Number of sequences better than 10.0: 62
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 142384
Number of HSP's gapped (non-prelim): 375
length of query: 189
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 167
effective length of database: 17,147,199,772
effective search space: 2863582361924
effective search space used: 2863582361924
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top