ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet60h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U54767.1|HVU54767 Hordeum vulgare caffeic acid O-methyltransf... 135 2e-29
2gb|U43498.1|HVU43498 Hordeum vulgare 0-methyltransferase mRNA, p... 111 3e-22
3gb|AC078842.2|AC078842 Homo sapiens chromosome 7 clone RP11-102G... 48 0.003
4gb|AC146052.3| Pan troglodytes BAC clone RP43-75P3 from 7, compl... 46 0.013
5gb|AC117176.2| Dictyostelium discoideum chromosome 2 map 5018074... 46 0.013
6emb|BX663516.23| Zebrafish DNA sequence from clone DKEY-16F21 in... 46 0.013
7emb|BX255921.2| Zebrafish DNA sequence from clone CH211-236K19 i... 46 0.013
8emb|BX322643.8| Zebrafish DNA sequence from clone CH211-281E1 in... 44 0.051
9gb|AE014845.1| Plasmodium falciparum 3D7 chromosome 12, section ... 44 0.051
10emb|AL691509.6| Mouse DNA sequence from clone RP23-222A18 on chr... 44 0.051
11gb|AC182666.2| Populus trichocarpa clone Pop1-18F23, complete se... 42 0.20
12emb|AJ539388.1|ASA539388 Anopheles sacharovi microsatellite DNA,... 42 0.20
13gb|AC123032.5| Mus musculus BAC clone RP24-480K24 from chromosom... 42 0.20
14gb|AC122388.5| Mus musculus BAC clone RP24-80J12 from chromosome... 42 0.20
15gb|AC098738.2| Mus musculus BAC clone RP23-122F7 from 8, complet... 42 0.20
16gb|AC121602.2| Mus musculus BAC clone RP23-309B19 from 10, compl... 42 0.20
17ref|XM_737253.1| Plasmodium chabaudi chabaudi hypothetical prote... 42 0.20
18emb|AL591604.6| Human DNA sequence from clone RP11-356F4 on chro... 42 0.20
19emb|AL096707.13|HSJ729N16 Human DNA sequence from clone RP4-729N... 42 0.20
20emb|AL035667.12|HS805C22 Human DNA sequence from clone RP4-805C2... 42 0.20
21emb|AL021812.1|HSU86H4 Human DNA sequence from clone LL0XNC01-86... 42 0.20
22gb|AC006593.5| Arabidopsis thaliana chromosome 2 clone F16D14 ma... 42 0.20
23gb|AC104358.4| Homo sapiens chromosome 8, clone RP11-151L10, com... 42 0.20
24gb|AC091647.4| Homo sapiens chromosome 18, clone RP11-635D8, com... 42 0.20
25gb|AC008912.5| Homo sapiens chromosome 5 clone CITB-H1_2269J5, c... 42 0.20
26gb|AC008586.6|AC008586 Homo sapiens chromosome 5 clone CTC-568N2... 42 0.20
27gb|AC019239.5|AC019239 Homo sapiens chromosome 18, clone RP11-34... 42 0.20
28dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.20
29gb|AC093730.3| Homo sapiens BAC clone RP11-12K22 from 4, complet... 42 0.20
30gb|AC003667.3| Homo sapiens X PAC RP1-17L20 (Roswell Park Cancer... 42 0.20
31dbj|AP003220.6| Oryza sativa (japonica cultivar-group) genomic D... 42 0.20
32emb|BX005128.4| Zebrafish DNA sequence from clone CH211-129H14 i... 42 0.20
33gb|AC006840.17|AC006840 Homo sapiens chromosome 4 clone C0422C23... 42 0.20
34gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 42 0.20
35emb|CT573077.2| Medicago truncatula chromosome 5 clone mth2-43j1... 42 0.20
36dbj|AP005622.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 0.20
37emb|BX088567.6| Mouse DNA sequence from clone RP23-21L20 on chro... 42 0.20
38emb|AL929124.13| Zebrafish DNA sequence from clone CH211-128D23,... 42 0.20
39gb|AC139027.12| Mus musculus chromosome 18, clone RP23-396C22, c... 40 0.79
40gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8... 40 0.79
41gb|AE014842.1| Plasmodium falciparum 3D7 chromosome 11 section 7... 40 0.79
42gb|AC099037.2| Drosophila melanogaster clone BACR27P17, complete... 40 0.79
43gb|AC095018.2| Drosophila melanogaster clone BACR24L18, complete... 40 0.79
44gb|AY523014.1| Colinus virginianus clone A-12A microsatellite se... 40 0.79
45gb|AC008257.6| Drosophila melanogaster clone BACR08A11, complete... 40 0.79
46gb|AC146241.4| Pan troglodytes BAC clone RP43-31L17 from 7, comp... 40 0.79
47gb|AY642135.1| Homo sapiens interleukin 5 receptor, alpha (IL5RA... 40 0.79
48gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosom... 40 0.79
49gb|AC024730.7| Homo sapiens BAC clone RP11-422E4 from 7, complet... 40 0.79
50emb|AJ966296.1| Pisum sativum insertion site for PDR1 retrotrans... 40 0.79
51emb|CT025525.8| Mouse DNA sequence from clone RP23-285C6 on chro... 40 0.79
52gb|AC146095.3| Pan troglodytes BAC clone RP43-48M24 from 7, comp... 40 0.79
53emb|CR388050.16| Zebrafish DNA sequence from clone CH211-287N14 ... 40 0.79
54gb|AC135115.5| Mus musculus BAC clone RP24-251K13 from chromosom... 40 0.79
55gb|AC127575.4| Mus musculus BAC clone RP24-240L12 from chromosom... 40 0.79
56gb|AC111014.6| Mus musculus BAC clone RP24-371P8 from chromosome... 40 0.79
57emb|BX936377.16| Zebrafish DNA sequence from clone DKEY-149J2 in... 40 0.79
58gb|AE014311.1| Homo sapiens chromosome 13q34 schizophrenia regio... 40 0.79
59ref|XM_722872.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 0.79
60ref|XM_724967.1| Plasmodium yoelii yoelii str. 17XNL CCAAT-box D... 40 0.79
61ref|XM_719435.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 0.79
62ref|XM_961106.1| Plasmodium falciparum 3D7 hypothetical protein ... 40 0.79
63gb|AC113309.7| Mus musculus chromosome 6, clone RP23-440D19, com... 40 0.79
64gb|AC073348.8| Homo sapiens BAC clone RP11-786A20 from 7, comple... 40 0.79
65ref|XM_735144.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 0.79
66ref|XM_671013.1| Plasmodium berghei strain ANKA RNA binding prot... 40 0.79
67gb|AC146114.3| Pan troglodytes BAC clone RP43-22O2 from 7, compl... 40 0.79
68gb|AC142305.1| Pan troglodytes BAC clone RP43-130P22 from 7, com... 40 0.79
69gb|AC140950.1| Pan troglodytes BAC clone RP43-58I22 from 7, comp... 40 0.79
70emb|CR376723.15| Zebrafish DNA sequence from clone DKEY-90N12 in... 40 0.79
71gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 40 0.79
72emb|CR352207.9| Zebrafish DNA sequence from clone CH211-110B5 in... 40 0.79
73emb|BX927334.17| Zebrafish DNA sequence from clone CH211-112H5 i... 40 0.79
74emb|AL591847.8| Human DNA sequence from clone RP11-510L10 on chr... 40 0.79
75gb|AE014822.1| Plasmodium falciparum 3D7 chromosome 14 section 7... 40 0.79
76emb|AL157402.19| Human DNA sequence from clone RP11-553K8 on chr... 40 0.79
77gb|AC069439.18| Homo sapiens 3 BAC RP11-12K11 (Roswell Park Canc... 40 0.79
78emb|AL033376.17|HS278N12 Human DNA sequence from clone RP1-278N1... 40 0.79
79gb|AC090894.10| Homo sapiens chromosome 17, clone RP11-744K17, c... 40 0.79
80emb|CR382400.1| Plasmodium falciparum chromosome 6, complete seq... 40 0.79
81gb|AC140254.4| Mus musculus BAC clone RP23-467N7 from chromosome... 40 0.79
82emb|CR388130.8| Zebrafish DNA sequence from clone CH211-276A12 i... 40 0.79
83emb|AL161531.2|ATCHRIV31 Arabidopsis thaliana DNA chromosome 4, ... 40 0.79
84emb|AL096882.2|ATF8L21 Arabidopsis thaliana DNA chromosome 4, BA... 40 0.79
85gb|AC100852.2| Homo sapiens chromosome 17, clone RP11-125C16, co... 40 0.79
86emb|BX908795.10| Zebrafish DNA sequence from clone DKEY-92J12 in... 40 0.79
87emb|BX511081.8| Zebrafish DNA sequence from clone DKEY-6B12 in l... 40 0.79
88gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosom... 40 0.79
89gb|AC107905.5| Homo sapiens chromosome 15, clone CTD-2026J24, co... 40 0.79
90gb|AC108120.3| Homo sapiens chromosome 5 clone RP11-524L6, compl... 40 0.79
91gb|AC091559.7| Homo sapiens chromosome 8, clone RP11-60C8, compl... 40 0.79
92gb|AC018728.6| Homo sapiens chromosome 7 clone RP11-206N24, comp... 40 0.79
93gb|AC024938.29| Homo sapiens 3 BAC RP11-485J7 (Roswell Park Canc... 40 0.79
94gb|AC099540.2| Homo sapiens chromosome 3 clone RP11-353D4, compl... 40 0.79
95gb|AC091984.3| Homo sapiens chromosome 5 clone RP11-569B13, comp... 40 0.79
96gb|AC009839.10| Drosophila melanogaster 3L BAC RP98-16G9 (Roswel... 40 0.79
97gb|AC104083.3| Homo sapiens BAC clone RP11-588K22 from 4, comple... 40 0.79
98gb|AC009383.8| Drosophila melanogaster 3L BAC RP98-31C3 (Roswell... 40 0.79
99gb|AC008382.6| Homo sapiens chromosome 5 clone CTC-218P2, comple... 40 0.79
100emb|BX649368.5| Zebrafish DNA sequence from clone CH211-191A16 i... 40 0.79
101emb|BX120001.10| Zebrafish DNA sequence from clone CH211-217J8 i... 40 0.79
102gb|AC008339.2|AC008339 Drosophila melanogaster, chromosome 2R, r... 40 0.79
103gb|AC083799.17| Homo sapiens 3 BAC RP11-332M2 (Roswell Park Canc... 40 0.79
104gb|AC007467.4|AC007467 Drosophila melanogaster, chromosome 2L, r... 40 0.79
105gb|AC008771.4|AC008771 Homo sapiens chromosome 5 clone CTD-2015H... 40 0.79
106gb|AC097459.3| Homo sapiens BAC clone RP11-13F20 from 4, complet... 40 0.79
107gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete... 40 0.79
108gb|AC010907.10| Homo sapiens BAC clone RP11-568H24 from 2, compl... 40 0.79
109gb|AC105399.3| Homo sapiens BAC clone RP11-715P7 from 2, complet... 40 0.79
110gb|AC153641.3| Mus musculus 6 BAC RP23-5F24 (Roswell Park Cancer... 40 0.79
111gb|AC026423.9| Homo sapiens chromosome 16 clone CTD-2169M19, com... 40 0.79
112gb|AC017083.7| Homo sapiens BAC clone RP11-474G23 from 2, comple... 40 0.79
113gb|AC115598.2| Dictyostelium discoideum chromosome 2 map 581427-... 40 0.79
114gb|AC115604.2| Dictyostelium discoideum chromosome 2 map 4354771... 40 0.79
115gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470... 40 0.79
116gb|AC018812.5|AC018812 Homo sapiens chromosome 3 clone RP11-161D... 40 0.79
117gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195... 40 0.79
118gb|AC100793.8| Homo sapiens chromosome 17, clone CTD-3193K9, com... 40 0.79
119gb|AC107940.13| Homo sapiens chromosome 17, clone RP11-158C19, c... 40 0.79
120gb|AC132825.8| Homo sapiens chromosome 8, clone RP13-929K23, com... 40 0.79
121gb|AC024060.6| Homo sapiens chromosome 3 clone RP11-97C16 map 3p... 40 0.79
122emb|BX649277.5| Zebrafish DNA sequence from clone DKEYP-67A10 in... 40 0.79
123emb|BX571946.9| Zebrafish DNA sequence from clone DKEY-232H18 in... 40 0.79
124emb|Z46996.1|CEC34C12 Caenorhabditis elegans Cosmid C34C12, comp... 40 0.79
125gb|AE003715.4| Drosophila melanogaster chromosome 3R, section 53... 40 0.79
126gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77... 40 0.79
127gb|AE003784.5| Drosophila melanogaster chromosome 2R, section 5 ... 40 0.79
128gb|AC005710.2|AC005710 Drosophila melanogaster, chromosome 2R, r... 40 0.79
129gb|AE003514.4| Drosophila melanogaster chromosome 3L, section 71... 40 0.79
130gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72... 40 0.79
131gb|AC158383.3| Mus musculus BAC clone RP23-135O16 from chromosom... 40 0.79
132emb|AL732620.14| Mouse DNA sequence from clone RP23-167G19 on ch... 40 0.79
133emb|BX897719.9| Zebrafish DNA sequence from clone CH211-199I23 i... 40 0.79
134emb|BX005283.6| Zebrafish DNA sequence from clone CH211-93G21, c... 40 0.79
135gb|DQ316259.1| Homo sapiens nemo like kinase (NLK) gene, complet... 40 0.79
136gb|AC134445.3| Mus musculus BAC clone RP24-170M15 from 6, comple... 40 0.79
137gb|AC004759.1|AC004759 Drosophila melanogaster DNA sequence (P1s... 40 0.79
138gb|AC154362.1| Mus musculus BAC clone RP23-154E1 from 14, comple... 40 0.79
139gb|AC134907.5| Mus musculus BAC clone RP23-362K17 from 8, comple... 40 0.79
140gb|AC002546.1|AC002546 Homo sapiens chromosome 17, clone 193h18,... 40 0.79
141gb|L31790.1|L31790 Drosophila melanogaster (P1 DS00846 (D02)) DN... 40 0.79
142gb|AC022002.5| Homo sapiens chromosome 3 clone RP11-198P17 map 3... 40 0.79
143dbj|AP005202.3| Homo sapiens genomic DNA, chromosome 18 clone:CT... 40 0.79
144dbj|AP006104.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 0.79
145gb|AC166321.3| Cavia porcellus, clone Cavia porcellus-24949357D4... 40 0.79
146gb|U31961.1|DMU31961 Drosophila melanogaster bithorax complex (B... 40 0.79
147emb|AL592224.17| Mouse DNA sequence from clone RP23-174G1 on chr... 40 0.79
148emb|AL713855.7| Mouse DNA sequence from clone RP23-206E19 on chr... 40 0.79
149emb|AL808118.8| Mouse DNA sequence from clone RP23-287O8 on chro... 40 0.79
150emb|X99254.1|PFPRIMSSU P.falciparum gene encoding primase, small... 40 0.79
151gb|AC132822.3| Homo sapiens chromosome 17, clone RP13-885L6, com... 40 0.79
152ref|NM_123170.2| Arabidopsis thaliana methyltransferase AT5G3810... 38 3.1
153gb|AC153488.1| Tribolium castaneum BAC T.cast_C24H10 (Clemson U... 38 3.1
154gb|AC101593.16| Mus musculus chromosome 18, clone RP23-198A7, co... 38 3.1
155gb|AC152927.1| Tribolium castaneum BAC T.cast_C19N19 (Clemson U... 38 3.1
156gb|CP000014.1| Borrelia garinii PBi plasmid cp26, complete sequence 38 3.1
157gb|CP000013.1| Borrelia garinii PBi, complete genome 38 3.1
158ref|XM_642081.1| Dictyostelium discoideum hypothetical protein (... 38 3.1
159ref|XM_636105.1| Dictyostelium discoideum hypothetical protein (... 38 3.1
160ref|XM_635560.1| Dictyostelium discoideum hypothetical protein (... 38 3.1
161gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosom... 38 3.1
162gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosom... 38 3.1
163gb|AC132905.13| Mus musculus chromosome 13, clone RP24-295E18, c... 38 3.1
164gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5... 38 3.1
165gb|AE014835.1| Plasmodium falciparum 3D7 chromosome 10 section 7... 38 3.1
166gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5... 38 3.1
167gb|AE014828.1| Plasmodium falciparum 3D7 chromosome 14 section 1... 38 3.1
168gb|AC161431.4| Mus musculus chromosome 7, clone RP24-306C18, com... 38 3.1
169gb|AF499727.1| Cucumis melo BAC clone PIT92-60K17, complete sequ... 38 3.1
170gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section ... 38 3.1
171gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 38 3.1
172gb|AC104617.9| Trypanosoma brucei chromosome 5 clone RPCI93-1P6,... 38 3.1
173gb|AY552485.1| Odontomachus sp. CPS172 cytochrome b (Cytb) gene,... 38 3.1
174gb|AC109302.9| Mus musculus chromosome 3, clone RP24-331E17, com... 38 3.1
175gb|AC159249.3| Mus musculus BAC clone RP24-177C7 from chromosome... 38 3.1
176gb|AC150658.7| Mus musculus BAC clone RP24-474E20 from chromosom... 38 3.1
177gb|AC134400.4| Mus musculus chromosome 3, clone RP24-284D6, comp... 38 3.1
178gb|AF487277.1| Lecanicillium muscarium, complete genome 38 3.1
179ref|XM_873391.1| PREDICTED: Bos taurus similar to receptor (TNFR... 38 3.1
180gb|AC147991.4| Mus musculus BAC clone RP24-362D11 from chromosom... 38 3.1
181gb|AC132276.4| Mus musculus BAC clone RP24-344B8 from chromosome... 38 3.1
182gb|AC145587.4| Mus musculus BAC clone RP24-343E24 from chromosom... 38 3.1
183gb|AC147260.3| Mus musculus BAC clone RP24-186L11 from chromosom... 38 3.1
184gb|AC123741.9| Mus musculus chromosome 1, clone RP24-113A5, comp... 38 3.1
185gb|AC121313.8| Mus musculus chromosome 14, clone RP24-395N22, co... 38 3.1
186gb|AE006818.1| Sulfolobus solfataricus P2 section 177 of 272 of ... 38 3.1
187gb|AE006252.1| Lactococcus lactis subsp. lactis IL1403 section 1... 38 3.1
188gb|AC145562.5| Mus musculus BAC clone RP24-67L21 from chromosome... 38 3.1
189gb|AC147268.5| Mus musculus BAC clone RP24-263J19 from chromosom... 38 3.1
190gb|AC145598.5| Mus musculus BAC clone RP24-324I11 from chromosom... 38 3.1
191gb|AC134564.5| Mus musculus BAC clone RP24-182E8 from chromosome... 38 3.1
192gb|AC146687.1| Mus musculus BAC clone RP24-487N17 from chromosom... 38 3.1
193gb|AC148322.2| Mus musculus BAC clone RP24-467F9 from chromosome... 38 3.1
194gb|AC147996.3| Mus musculus BAC clone RP24-253L14 from chromosom... 38 3.1
195gb|AC131763.4| Mus musculus BAC clone RP24-231M1 from chromosome... 38 3.1
196gb|AC145991.2| Pan troglodytes BAC clone RP43-170F9 from 7, comp... 38 3.1
197gb|AC174382.2| Mus musculus BAC clone RP24-94K20 from chromosome... 38 3.1
198gb|AC126453.5| Mus musculus BAC clone RP23-244A6 from chromosome... 38 3.1
199gb|AC147109.2| Mus musculus BAC clone RP24-75P8 from chromosome ... 38 3.1
200gb|AC147107.2| Mus musculus BAC clone RP24-69F17 from chromosome... 38 3.1
201gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome... 38 3.1
202gb|AC145569.3| Mus musculus BAC clone RP24-89N16 from chromosome... 38 3.1
203gb|AC147372.3| Mus musculus BAC clone RP24-212L10 from chromosom... 38 3.1
204gb|AC140239.3| Mus musculus BAC clone RP24-280O4 from chromosome... 38 3.1
205gb|AC134552.4| Mus musculus BAC clone RP24-279K10 from chromosom... 38 3.1
206gb|AC132323.3| Mus musculus BAC clone RP24-268M17 from chromosom... 38 3.1
207gb|AC147461.2| Mus musculus BAC clone RP24-304I19 from chromosom... 38 3.1
208gb|AC147149.2| Mus musculus BAC clone RP24-248P15 from chromosom... 38 3.1
209gb|AC147150.2| Mus musculus BAC clone RP24-386L15 from chromosom... 38 3.1
210gb|AC145577.2| Mus musculus BAC clone RP24-382J15 from chromosom... 38 3.1
211gb|AC132254.3| Mus musculus BAC clone RP24-469M1 from chromosome... 38 3.1
212gb|AC146633.2| Mus musculus BAC clone RP24-483C21 from chromosom... 38 3.1
213gb|AC140223.3| Mus musculus BAC clone RP24-477G22 from chromosom... 38 3.1
214gb|AC175743.2| Mus musculus BAC clone RP24-44F3 from chromosome ... 38 3.1
215gb|AC183415.1| Mus musculus BAC clone RP24-121M4 from chromosome... 38 3.1
216gb|AC183975.1| Mus musculus BAC clone RP24-352C21 from chromosom... 38 3.1
217gb|AC123665.9| Mus musculus chromosome 14, clone RP23-226A4, com... 38 3.1
218gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, co... 38 3.1
219gb|AC115911.14| Mus musculus chromosome 6, clone RP24-481I20, co... 38 3.1
220gb|AC115607.2| Dictyostelium discoideum chromosome 2 map 4559693... 38 3.1
221gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124... 38 3.1
222gb|AC140920.4| Mus musculus BAC clone RP24-498A2 from chromosome... 38 3.1
223gb|AC140255.4| Mus musculus BAC clone RP24-291E19 from chromosom... 38 3.1
224gb|AC140258.4| Mus musculus BAC clone RP24-295F23 from chromosom... 38 3.1
225gb|AC132283.4| Mus musculus BAC clone RP24-351L16 from chromosom... 38 3.1
226gb|AC144647.3| Mus musculus BAC clone RP24-369F17 from chromosom... 38 3.1
227gb|AC140423.2| Mus musculus BAC clone RP24-446B23 from chromosom... 38 3.1
228gb|AC139297.4| Mus musculus BAC clone RP24-62H18 from chromosome... 38 3.1
229gb|AC134579.5| Mus musculus BAC clone RP24-82I10 from chromosome... 38 3.1
230gb|AC129191.4| Mus musculus BAC clone RP24-81F10 from chromosome... 38 3.1
231gb|AC140382.3| Mus musculus BAC clone RP24-86A10 from chromosome... 38 3.1
232gb|AC145292.2| Mus musculus BAC clone RP24-84H20 from chromosome... 38 3.1
233gb|AC147709.1| Mus musculus BAC clone RP24-97E15 from chromosome... 38 3.1
234gb|AC130833.3| Mus musculus BAC clone RP24-91H16 from chromosome... 38 3.1
235gb|AC147113.2| Mus musculus BAC clone RP24-120I13 from chromosom... 38 3.1
236gb|AC133178.3| Mus musculus BAC clone RP24-123P23 from chromosom... 38 3.1
237gb|AC140493.3| Mus musculus BAC clone RP24-137I9 from chromosome... 38 3.1
238gb|AC130836.4| Mus musculus BAC clone RP24-147P10 from chromosom... 38 3.1
239gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosom... 38 3.1
240gb|AC140390.1| Mus musculus BAC clone RP24-207C7 from chromosome... 38 3.1
241gb|AC134852.4| Mus musculus BAC clone RP24-248B6 from chromosome... 38 3.1
242gb|AC136452.4| Mus musculus BAC clone RP24-274L23 from chromosom... 38 3.1
243gb|AC147166.2| Mus musculus BAC clone RP24-277F21 from chromosom... 38 3.1
244gb|AC140473.3| Mus musculus BAC clone RP24-405H7 from chromosome... 38 3.1
245gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosom... 38 3.1
246gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome... 38 3.1
247gb|AC136638.4| Mus musculus BAC clone RP24-369F2 from chromosome... 38 3.1
248gb|AC135808.4| Mus musculus BAC clone RP24-316N5 from chromosome... 38 3.1
249gb|AC144851.3| Mus musculus BAC clone RP24-329H15 from chromosom... 38 3.1
250gb|AC147156.2| Mus musculus BAC clone RP24-343M19 from chromosom... 38 3.1
251gb|AC146008.3| Pan troglodytes BAC clone RP43-13N15 from 7, comp... 38 3.1
252gb|AC132428.3| Mus musculus BAC clone RP23-203K20 from chromosom... 38 3.1
253gb|AC171129.2| Helobdella robusta clone CH306-1A11, complete seq... 38 3.1
254gb|AC146014.2| Pan troglodytes BAC clone RP43-128N21 from 7, com... 38 3.1
255emb|Z81050.1|CEC50B6 Caenorhabditis elegans Cosmid C50B6, comple... 38 3.1
256emb|CR936846.7| Zebrafish DNA sequence from clone DKEY-20N3 in l... 38 3.1
257gb|AC132596.5| Mus musculus BAC clone RP24-173K19 from chromosom... 38 3.1
258gb|AC141890.3| Mus musculus BAC clone RP23-410K18 from chromosom... 38 3.1
259emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 ... 38 3.1
260gb|AC134099.2| Homo sapiens 3 BAC RP11-221B6 (Roswell Park Cance... 38 3.1
261gb|AC087432.3| Homo sapiens chromosome 3 clone RP11-96G4 map 3p,... 38 3.1
262gb|AC127299.3| Mus musculus BAC clone RP23-264I11 from 7, comple... 38 3.1
263gb|AC122305.4| Mus musculus BAC clone RP23-284E19 from 9, comple... 38 3.1
264gb|AC122798.3| Mus musculus BAC clone RP23-301A3 from 2, complet... 38 3.1
265gb|AC121601.4| Mus musculus BAC clone RP23-305F2 from 1, complet... 38 3.1
266ref|XM_725685.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 3.1
267ref|XM_719703.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 3.1
268ref|XM_724943.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 3.1
269gb|AC079756.4| Homo sapiens BAC clone RP11-108J15 from 7, comple... 38 3.1
270gb|AC073332.13| Homo sapiens BAC clone RP11-435M6 from 7, comple... 38 3.1
271gb|AC006381.2| Homo sapiens BAC clone RP11-494A9 from 7, complet... 38 3.1
272gb|AC074347.8| Homo sapiens BAC clone RP11-646H18 from 7, comple... 38 3.1
273gb|AC004953.2| Homo sapiens PAC clone RP5-1059M17 from 7, comple... 38 3.1
274ref|XM_670493.1| Plasmodium berghei strain ANKA hypothetical pro... 38 3.1
275ref|XM_671018.1| Plasmodium berghei strain ANKA protein phosphat... 38 3.1
276ref|XM_672738.1| Plasmodium berghei strain ANKA hypothetical pro... 38 3.1
277gb|AC102494.6| Mus musculus chromosome 7, clone RP24-565J5, comp... 38 3.1
278gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosom... 38 3.1
279gb|AC144893.15| Medicago truncatula clone mth2-29d23, complete s... 38 3.1
280gb|AC151742.9| Medicago truncatula clone mth2-83e4, complete seq... 38 3.1
281gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete s... 38 3.1
282gb|AC125479.16| Medicago truncatula clone mth2-7f11, complete se... 38 3.1
283gb|AC138451.15| Medicago truncatula clone mth2-24k1, complete se... 38 3.1
284gb|AC146909.23| Medicago truncatula clone mth2-57e16, complete s... 38 3.1
285gb|AC110225.5| Mus musculus chromosome 7, clone RP24-324L10, com... 38 3.1
286gb|AC184149.2| Mus musculus BAC clone RP24-143K6 from chromosome... 38 3.1
287emb|AL772197.12| Human DNA sequence from clone RP11-24O6 on chro... 38 3.1
288emb|AL390035.10| Human DNA sequence from clone RP13-9D14 on chro... 38 3.1
289emb|AL512770.21| Human DNA sequence from clone RP11-186N15 on ch... 38 3.1
290emb|AL445543.20| Human DNA sequence from clone RP11-4H20 on chro... 38 3.1
291emb|AL360169.17| Human DNA sequence from clone RP11-732M18 on ch... 38 3.1
292emb|AL391002.9| Human DNA sequence from clone RP11-490H23 on chr... 38 3.1
293gb|AE014821.1| Plasmodium falciparum 3D7 chromosome 14 section 6... 38 3.1
294gb|AE014818.1| Plasmodium falciparum 3D7 chromosome 14 section 3... 38 3.1
295emb|AL162615.13| Human DNA sequence from clone RP5-1041C10 on ch... 38 3.1
296emb|AL353682.11| Human DNA sequence from clone RP11-203D19 on ch... 38 3.1
297emb|AL354754.9| Human DNA sequence from clone RP11-281A20 on chr... 38 3.1
298emb|AL354716.9| Human DNA sequence from clone RP11-86F4 on chrom... 38 3.1
299emb|AL137224.17| Human DNA sequence from clone RP4-594L9 on chro... 38 3.1
300emb|AL135929.5| Human DNA sequence from clone RP4-801G22 on chro... 38 3.1
301emb|AL117378.15|HSJ131F15 Human DNA sequence from clone RP1-131F... 38 3.1
302emb|AL133419.15| Human DNA sequence from clone RP11-101E14 on ch... 38 3.1
303emb|AL035704.9|HS74M1 Human DNA sequence from clone RP1-74M1 on ... 38 3.1
304gb|AC128768.4| Rattus norvegicus 1 BAC CH230-445L3 (Children's H... 38 3.1
305gb|AC092053.3| Homo sapiens chromosome 3 clone RP11-331G2, compl... 38 3.1
306emb|CR627485.10| Zebrafish DNA sequence from clone DKEY-203E10 i... 38 3.1
307gb|AC073585.8| Homo sapiens chromosome 10 clone RP11-564D11, com... 38 3.1
308emb|Y08256.1|SS100KBFR S.solfataricus 100 kbp DNA fragment 38 3.1
309gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 38 3.1
310emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 38 3.1
311emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete se... 38 3.1
312gb|AC161866.4| Mus musculus chromosome 3, clone RP24-145B15, com... 38 3.1
313gb|AC182483.3| Mus musculus BAC clone RP24-458L18 from chromosom... 38 3.1
314emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chrom... 38 3.1
315gb|AC182455.3| Mus musculus BAC clone RP24-77P23 from chromosome... 38 3.1
316emb|CR932965.2| Medicago truncatula chromosome 5 clone mth2-47e6... 38 3.1
317gb|AC090150.9| Homo sapiens chromosome 8, clone RP11-521M14, com... 38 3.1
318emb|AL596103.22| Mouse DNA sequence from clone RP23-309E16 on ch... 38 3.1
319emb|BX901956.4| Zebrafish DNA sequence from clone CH211-284C12 i... 38 3.1
320gb|AC119734.7| Homo sapiens 3 BAC RP11-305D6 (Roswell Park Cance... 38 3.1
321gb|AC012151.14| Homo sapiens 12 BAC RP11-677C1 (Roswell Park Can... 38 3.1
322emb|BX927401.14| Zebrafish DNA sequence from clone CH211-210H11 ... 38 3.1
323gb|AC184107.1| Mus musculus chromosome UNK clone CH33-213P12, co... 38 3.1
324gb|AC181981.2| Mus musculus BAC clone RP24-56E16 from chromosome... 38 3.1
325gb|AC120367.8| Mus musculus chromosome 7, clone RP24-325B21, com... 38 3.1
326gb|AC142261.5| Mus musculus BAC clone RP24-469C3 from chromosome... 38 3.1
327gb|AC102055.13| Mus musculus chromosome 18, clone RP23-52J5, com... 38 3.1
328gb|AC092323.3| Homo sapiens chromosome 16 clone RP11-133B5, comp... 38 3.1
329gb|AC104629.10| Homo sapiens 3 BAC RP11-12N13 (Roswell Park Canc... 38 3.1
330gb|AC125387.2| Homo sapiens chromosome 19 clone CTD-3056C15, com... 38 3.1
331gb|AC016383.11| Homo sapiens chromosome 18, clone RP11-25O3, com... 38 3.1
332gb|AC010026.7| Drosophila melanogaster 3L BAC RP98-1I24 (Roswell... 38 3.1
333emb|BX276182.13| Zebrafish DNA sequence from clone CH211-283K4 i... 38 3.1
334gb|AC182731.2| Pan troglodytes BAC clone CH251-677O10 from chrom... 38 3.1
335gb|AC183791.2| Mus musculus BAC clone RP24-44H8 from chromosome ... 38 3.1
336gb|AC177805.2| Mus musculus BAC clone RP24-82J12 from chromosome... 38 3.1
337gb|AC175387.3| Mus musculus BAC clone RP24-166B21 from chromosom... 38 3.1
338gb|AC182449.4| Mus musculus BAC clone RP24-361G20 from chromosom... 38 3.1
339gb|AC175056.3| Mus musculus BAC clone RP24-212M24 from chromosom... 38 3.1
340gb|AC117397.2| Homo sapiens 3 BAC RP11-92D20 (Roswell Park Cance... 38 3.1
341gb|AC183526.2| Mus musculus BAC clone RP24-121M8 from chromosome... 38 3.1
342gb|AC182038.2| Mus musculus BAC clone RP24-95H15 from chromosome... 38 3.1
343emb|BX663515.13| Zebrafish DNA sequence from clone DKEY-228G21 i... 38 3.1
344emb|BX890576.12| Zebrafish DNA sequence from clone DKEY-203O14 i... 38 3.1
345gb|AC173705.5| Mus musculus BAC clone RP24-244N11 from chromosom... 38 3.1
346gb|AC105074.5| Homo sapiens chromosome 18, clone RP11-693M3, com... 38 3.1
347gb|AC181982.2| Mus musculus BAC clone RP24-36K1 from chromosome ... 38 3.1
348gb|AC177798.3| Mus musculus BAC clone RP24-456H11 from chromosom... 38 3.1
349gb|AC125392.15| Pan troglodytes clone rp43-143k16, complete sequ... 38 3.1
350gb|AC010424.9| Homo sapiens chromosome 5 clone CTD-2195M15, comp... 38 3.1
351gb|AC008682.6| Homo sapiens chromosome 5 clone CTB-54G2, complet... 38 3.1
352gb|AC015954.9| Homo sapiens chromosome 18, clone RP11-24L5, comp... 38 3.1
353gb|AC092500.2| Homo sapiens chromosome 3 clone RP11-111P21, comp... 38 3.1
354gb|AC124960.26| Medicago truncatula clone mth2-26j24, complete s... 38 3.1
355gb|AC119407.15| Pan troglodytes clone ch251-541e23, complete seq... 38 3.1
356gb|AC174478.3| Mus musculus BAC clone RP24-72B9 from chromosome ... 38 3.1
357gb|AC182426.3| Mus musculus BAC clone RP24-81E19 from chromosome... 38 3.1
358gb|AC182366.4| Mus musculus BAC clone RP24-360I14 from chromosom... 38 3.1
359gb|AC175671.2| Mus musculus BAC clone RP24-313O14 from chromosom... 38 3.1
360gb|AC006515.7| Homo sapiens 3p22-7 PAC RPCI5-1053D16 (Roswell Pa... 38 3.1
361gb|AC177800.3| Mus musculus BAC clone RP24-323K10 from chromosom... 38 3.1
362gb|AC099564.2| Homo sapiens chromosome 1 clone RP11-359A17, comp... 38 3.1
363gb|AC109518.6| Homo sapiens BAC clone RP11-492P11 from 4, comple... 38 3.1
364gb|AC020983.8| Homo sapiens chromosome 7 clone RP11-269N18, comp... 38 3.1
365gb|AC090179.4| Homo sapiens chromosome 15, clone RP11-236J21, co... 38 3.1
366gb|AC093300.3| Homo sapiens chromosome 5 clone RP11-560A7, compl... 38 3.1
367gb|AC023396.4| Homo sapiens chromosome 8, clone RP11-545M21, com... 38 3.1
368gb|AF404306.1| Rhizophydium sp. 136 mitochondrion, complete genome 38 3.1
369gb|AC183492.1| Brassica oleracea Contig G, complete sequence 38 3.1
370gb|AC025289.6| Homo sapiens chromosome 16 clone RP11-533D19, com... 38 3.1
371gb|AC093788.3| Homo sapiens BAC clone RP11-218F10 from 4, comple... 38 3.1
372gb|AC183416.2| Mus musculus BAC clone RP24-68E17 from chromosome... 38 3.1
373gb|AF238375.3| Homo sapiens chromosome 21 clone BAC 49B5 map 21q... 38 3.1
374gb|AC182252.2| Mus musculus BAC clone RP24-316G13 from chromosom... 38 3.1
375gb|AC090193.7| Homo sapiens chromosome 8, clone RP11-174I12, com... 38 3.1
376gb|AC175491.3| Mus musculus BAC clone RP24-90O21 from chromosome... 38 3.1
377gb|AC177799.3| Mus musculus BAC clone RP24-374O22 from chromosom... 38 3.1
378gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, com... 38 3.1
379gb|AC105901.2| Homo sapiens chromosome 3 clone RP11-437B5, compl... 38 3.1
380gb|AC027273.5| Homo sapiens BAC clone RP11-764F10 from 4, comple... 38 3.1
381gb|AC020703.7| Homo sapiens BAC clone RP11-259G7 from 4, complet... 38 3.1
382gb|AC175120.3| Mus musculus BAC clone RP24-26J9 from chromosome ... 38 3.1
383gb|AC018478.4| Drosophila melanogaster, chromosome 4, region 101... 38 3.1
384gb|AC010668.7| Drosophila melanogaster, chromosome 4, region 101... 38 3.1
385dbj|AK155483.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 38 3.1
386gb|AC091948.3| Homo sapiens chromosome 5 clone RP11-373N22, comp... 38 3.1
387gb|AC175666.3| Mus musculus BAC clone RP24-350M1 from chromosome... 38 3.1
388gb|AC182389.2| Mus musculus BAC clone RP24-399J2 from chromosome... 38 3.1
389gb|AC182254.2| Mus musculus BAC clone RP24-66O22 from chromosome... 38 3.1
390gb|AC173998.3| Mus musculus BAC clone RP24-446E18 from chromosom... 38 3.1
391gb|DP000040.1| Otolemur garnettii target 106 genomic scaffold 38 3.1
392dbj|AK163801.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 38 3.1
393gb|AC147606.2| Mus musculus BAC clone RP24-359I4 from chromosome... 38 3.1
394emb|BX323074.14| Zebrafish DNA sequence from clone RP71-26B20, c... 38 3.1
395emb|BX571968.10| Zebrafish DNA sequence from clone DKEY-27C4 in ... 38 3.1
396gb|S69380.1| SOHo-1=sensory organ homeobox-1 [chickens, embryoni... 38 3.1
397gb|AC091609.2| Homo sapiens chromosome 1 clone RP11-109I2, compl... 38 3.1
398gb|AC175462.3| Mus musculus BAC clone RP24-24E12 from chromosome... 38 3.1
399gb|AC120670.8| Rattus norvegicus 2 BAC CH230-23N23 (Children's H... 38 3.1
400gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 38 3.1
401gb|AC174475.4| Mus musculus BAC clone RP24-169K6 from chromosome... 38 3.1
402gb|AY005260.1| Xylocopa sulcatipes cytochrome b (cytb) gene, par... 38 3.1
403gb|AC147264.5| Mus musculus BAC clone RP24-225P12 from chromosom... 38 3.1
404gb|AC140776.6| Mus musculus chromosome 1, clone RP23-284K5, comp... 38 3.1
405dbj|AK051432.1| Mus musculus 12 days embryo spinal ganglion cDNA... 38 3.1
406gb|AC182230.1| Mus musculus BAC clone RP24-72K10 from chromosome... 38 3.1
407gb|AC175662.3| Mus musculus BAC clone RP24-425D4 from chromosome... 38 3.1
408gb|AC092239.1|AC092239 Drosophila melanogaster, chromosome 2L, r... 38 3.1
409gb|AC174234.4| Mus musculus BAC clone RP24-50H9 from chromosome ... 38 3.1
410gb|AC181977.2| Mus musculus BAC clone RP24-346B5 from chromosome... 38 3.1
411gb|AC013355.7|AC013355 Homo sapiens chromosome 15 clone RP11-178... 38 3.1
412gb|AC026800.4|AC026800 Homo sapiens chromosome 5 clone CTD-2377N... 38 3.1
413gb|AC175317.3| Mus musculus BAC clone RP24-65G8 from chromosome ... 38 3.1
414gb|AC174442.3| Mus musculus BAC clone RP24-542K12 from chromosom... 38 3.1
415dbj|AK090069.1| Mus musculus RCB-0545 OHTA cDNA, RIKEN full-leng... 38 3.1
416gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 38 3.1
417gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B... 38 3.1
418gb|AC151052.4| Mus musculus BAC clone RP24-72K12 from chromosome... 38 3.1
419emb|BX119314.13| Zebrafish DNA sequence from clone DKEY-18H19 in... 38 3.1
420emb|BX323880.7| Zebrafish DNA sequence from clone CH211-139K8 in... 38 3.1
421dbj|AB222993.1| Homo sapiens gene for TWEAK, complete cds 38 3.1
422gb|AC018693.8| Homo sapiens BAC clone RP11-555N21 from 2, comple... 38 3.1
423gb|AC145558.5| Mus musculus BAC clone RP24-502L18 from Y, comple... 38 3.1
424gb|AC115978.23| Mus musculus chromosome 14, clone RP24-83J8, com... 38 3.1
425gb|AC154554.2| Mus musculus BAC clone RP23-416P6 from chromosome... 38 3.1
426gb|AC149207.3| Medicago truncatula chromosome 2 BAC clone mte1-6... 38 3.1
427gb|AC093526.5| Homo sapiens chromosome 16 clone RP11-213K2, comp... 38 3.1
428gb|AC092326.4| Homo sapiens chromosome 16 clone RP11-14N9, compl... 38 3.1
429gb|AC026472.8| Homo sapiens chromosome 16 clone RP11-511J24, com... 38 3.1
430dbj|AP000031.1| Homo sapiens genomic DNA, chromosome 21q22.1, se... 38 3.1
431gb|AC159235.2| Mus musculus BAC clone RP24-432L4 from chromosome... 38 3.1
432gb|AC138811.3| Homo sapiens chromosome 16 clone RP11-1035H13, co... 38 3.1
433gb|AC134507.2| Homo sapiens 3 BAC RP11-674K24 (Roswell Park Canc... 38 3.1
434gb|AC007564.10| Homo sapiens 12 BAC RP11-513P18 (Roswell Park Ca... 38 3.1
435gb|AC092131.5| Homo sapiens chromosome 16 clone RP11-164F14, com... 38 3.1
436gb|AC113431.2| Homo sapiens chromosome 5 clone RP11-90F2, comple... 38 3.1
437ref|NM_205386.1| Gallus gallus sensory organ homeobox protein SO... 38 3.1
438gb|AC008166.2| Homo sapiens BAC clone RP11-155J2 from 2, complet... 38 3.1
439gb|AC010373.7| Homo sapiens chromosome 16 clone CTD-2053O6, comp... 38 3.1
440gb|AC175709.2| Mus musculus BAC clone RP24-7D4 from chromosome y... 38 3.1
441gb|AC175460.3| Mus musculus BAC clone RP24-48K24 from chromosome... 38 3.1
442gb|AC175707.2| Mus musculus BAC clone RP24-89D4 from chromosome ... 38 3.1
443gb|AC175384.2| Mus musculus BAC clone RP24-168P1 from chromosome... 38 3.1
444gb|AC027243.20| Homo sapiens chromosome 15, clone RP11-685G9, co... 38 3.1
445gb|AY190937.1| Drosophila erecta clone DERF01_40_C09 (D1409) gen... 38 3.1
446gb|AC126760.4| Homo sapiens chromosome 16 clone RP11-1307B12, co... 38 3.1
447gb|AC175748.1| Mus musculus chromosome Y clone RP24-269D6, compl... 38 3.1
448gb|AC142166.6| Mus musculus BAC clone RP24-455G9 from chromosome... 38 3.1
449gb|AC175746.1| Mus musculus chromosome Y clone RP24-387C1, compl... 38 3.1
450gb|AC141474.4| Mus musculus BAC clone RP24-192L11 from chromosom... 38 3.1
451gb|AC173997.2| Mus musculus BAC clone RP24-190A13 from chromosom... 38 3.1
452gb|AC134255.4| Mus musculus BAC clone RP24-81J5 from chromosome ... 38 3.1
453gb|AC092833.4| Homo sapiens BAC clone RP13-490C19 from 2, comple... 38 3.1
454gb|AC156989.3| Mus musculus chromosome 1, clone RP23-379L2, comp... 38 3.1
455gb|AC006231.18|AC006231 Homo sapiens chromosome 4 clone RP11-576... 38 3.1
456gb|L43550.1|BUHTRPE Buchnera aphidicola anthranilate synthase sm... 38 3.1
457emb|AL954666.10| Zebrafish DNA sequence from clone CH211-81I19 i... 38 3.1
458dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome 38 3.1
459dbj|BS000113.1| Pan troglodytes chromosome 22 clone:RP43-098E13,... 38 3.1
460dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03,... 38 3.1
461emb|BX571805.4| Mouse DNA sequence from clone RP23-18E8 on chrom... 38 3.1
462emb|AL663026.13| Mouse DNA sequence from clone RP23-224M19 on ch... 38 3.1
463emb|BX005129.6| Zebrafish DNA sequence from clone CH211-241D24 i... 38 3.1
464emb|AL929074.5| Zebrafish DNA sequence from clone CH211-101B14, ... 38 3.1
465dbj|AB028606.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 38 3.1
466emb|X03715.1|SMTRNA1 Spiroplasma melliferum tRNA gene cluster 38 3.1
467gb|AF177226.1|AF177226 Crassostrea gigas mitochondrial DNA, comp... 38 3.1
468emb|AL390816.4|CNS06C7V Human chromosome 14 DNA sequence BAC R-3... 38 3.1
469gb|AC147627.6| Mus musculus BAC clone RP24-382F19 from Y, comple... 38 3.1
470emb|BX649427.7| Zebrafish DNA sequence from clone DKEYP-85D7 in ... 38 3.1
471emb|AL844883.15| Zebrafish DNA sequence from clone DKEY-3J22 in ... 38 3.1
472emb|BX005054.7| Zebrafish DNA sequence from clone DKEY-209N16 in... 38 3.1
473gb|AC021867.19| Homo sapiens 3 BAC RP11-220G20 (Roswell Park Can... 38 3.1
474emb|CT476800.3| RP43-013D05, complete sequence 38 3.1
475emb|CT025571.15| Mouse DNA sequence from clone RP23-315D7 on chr... 38 3.1
476gb|AC174445.2| Mus musculus BAC clone RP24-115O3 from chromosome... 38 3.1
477gb|AE003611.3| Drosophila melanogaster chromosome 2L, section 20... 38 3.1
478emb|AL160211.2|CNS01RGV Human chromosome 14 DNA sequence BAC R-1... 38 3.1
479gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 ... 38 3.1
480dbj|AP001804.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 3.1
481gb|AE003843.5| Drosophila melanogaster chromosome 4, section 3 o... 38 3.1
482dbj|AP001711.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 38 3.1
483dbj|AP001677.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 38 3.1
484gb|AC121294.13| Mus musculus chromosome 8, clone RP23-187L12, co... 38 3.1
485emb|AL732520.14| Mouse DNA sequence from clone RP23-123E1 on chr... 38 3.1
486gb|AE015927.1| Clostridium tetani E88, complete genome 38 3.1
487dbj|AP000892.4| Homo sapiens genomic DNA, chromosome 11q clone:C... 38 3.1
488dbj|AP003421.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 3.1
489dbj|AP002965.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 3.1
490emb|BX470214.6| Zebrafish DNA sequence from clone DKEY-27M7 in l... 38 3.1
491gb|DQ150069.1| Pieris brassicae voucher PBR1 16S ribosomal RNA g... 38 3.1
492gb|AC002556.1|AC002556 Human Chromosome 11q25 PAC clone pDJ9j14,... 38 3.1
493gb|AE016830.1| Enterococcus faecalis V583, complete genome 38 3.1
494gb|DQ309427.1| Halmenus robustus 16S ribosomal RNA gene, partial... 38 3.1
495gb|AC145207.2| Homo sapiens chromosome 17, clone RP11-498C9, com... 38 3.1
496gb|AC005333.1|AC005333 Drosophila melanogaster DNA sequence (P1s... 38 3.1
497gb|CP000164.1| Drosophila melanogaster genomic scaffold 21100002... 38 3.1
498gb|AC145373.4| Mus musculus BAC clone RP24-155N24 from Y, comple... 38 3.1
499gb|AC145583.3| Mus musculus BAC clone RP24-154F7 from Y, complet... 38 3.1
500gb|AC147622.3| Mus musculus BAC clone RP24-318A22 from Y, comple... 38 3.1

>gb|U54767.1|HVU54767 Hordeum vulgare caffeic acid O-methyltransferase (HvCOMT) gene,
            complete cds
          Length = 5238

 Score =  135 bits (68), Expect = 2e-29
 Identities = 74/76 (97%)
 Strand = Plus / Minus

                                                                        
Query: 2    gaacaaagaagcttattaaggacattatgcggcccatggcttttatgataaaaataataa 61
            |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 4897 gaacaaagaagcttattaaggacattatgcggtccatggcttttatgatagaaataataa 4838

                            
Query: 62   aatgaaaatcataaat 77
            ||||||||||||||||
Sbjct: 4837 aatgaaaatcataaat 4822



to top

>gb|U43498.1|HVU43498 Hordeum vulgare 0-methyltransferase mRNA, partial cds
          Length = 983

 Score =  111 bits (56), Expect = 3e-22
 Identities = 62/64 (96%)
 Strand = Plus / Minus

                                                                       
Query: 14  ttattaaggacattatgcggcccatggcttttatgataaaaataataaaatgaaaatcat 73
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 982 ttattaaggacattatgcggtccatggcttttatgatagaaataataaaatgaaaatcat 923

               
Query: 74  aaat 77
           ||||
Sbjct: 922 aaat 919



to top

>gb|AC078842.2|AC078842 Homo sapiens chromosome 7 clone RP11-102G17, complete sequence
          Length = 173844

 Score = 48.1 bits (24), Expect = 0.003
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 47   tgataaaaataataaaatgaaaat 70
            ||||||||||||||||||||||||
Sbjct: 3084 tgataaaaataataaaatgaaaat 3061



to top

>gb|AC146052.3| Pan troglodytes BAC clone RP43-75P3 from 7, complete sequence
          Length = 152119

 Score = 46.1 bits (23), Expect = 0.013
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 50    taaaaataataaaatgaaaatca 72
             |||||||||||||||||||||||
Sbjct: 53941 taaaaataataaaatgaaaatca 53963



to top

>gb|AC117176.2| Dictyostelium discoideum chromosome 2 map 5018074-5200947 strain AX4,
             complete sequence
          Length = 182871

 Score = 46.1 bits (23), Expect = 0.013
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 44    ttatgataaaaataataaaatgaaaat 70
             ||||||||||||||| |||||||||||
Sbjct: 93291 ttatgataaaaataaaaaaatgaaaat 93317



to top

>emb|BX663516.23| Zebrafish DNA sequence from clone DKEY-16F21 in linkage group 10,
             complete sequence
          Length = 183367

 Score = 46.1 bits (23), Expect = 0.013
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 45    tatgataaaaataataaaatgaaaatc 71
             ||||||||||| |||||||||||||||
Sbjct: 74182 tatgataaaaaaaataaaatgaaaatc 74156



to top

>emb|BX255921.2| Zebrafish DNA sequence from clone CH211-236K19 in linkage group 5,
             complete sequence
          Length = 142918

 Score = 46.1 bits (23), Expect = 0.013
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 50    taaaaataataaaatgaaaatca 72
             |||||||||||||||||||||||
Sbjct: 38786 taaaaataataaaatgaaaatca 38764



to top

>emb|BX322643.8| Zebrafish DNA sequence from clone CH211-281E1 in linkage group 21,
             complete sequence
          Length = 153972

 Score = 44.1 bits (22), Expect = 0.051
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 44    ttatgataaaaataataaaatgaaaa 69
             ||||||||||||||||||||| ||||
Sbjct: 69459 ttatgataaaaataataaaataaaaa 69484



to top

>gb|AE014845.1| Plasmodium falciparum 3D7 chromosome 12, section 2 of 9 of the complete
             sequence
          Length = 250531

 Score = 44.1 bits (22), Expect = 0.051
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 44    ttatgataaaaataataaaatgaaaa 69
             ||||||||||||||| ||||||||||
Sbjct: 36309 ttatgataaaaataagaaaatgaaaa 36284



to top

>emb|AL691509.6| Mouse DNA sequence from clone RP23-222A18 on chromosome 4, complete
            sequence
          Length = 217607

 Score = 44.1 bits (22), Expect = 0.051
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 51   aaaaataataaaatgaaaatcataaa 76
            ||||||||||||||||||||| ||||
Sbjct: 7168 aaaaataataaaatgaaaatcttaaa 7193



to top

>gb|AC182666.2| Populus trichocarpa clone Pop1-18F23, complete sequence
          Length = 105222

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 43    tttatgataaaaataataaaa 63
             |||||||||||||||||||||
Sbjct: 80668 tttatgataaaaataataaaa 80688



to top

>emb|AJ539388.1|ASA539388 Anopheles sacharovi microsatellite DNA, clone SachQ7
          Length = 524

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 46  atgataaaaataataaaatgaaaat 70
           |||| ||||||||||||||||||||
Sbjct: 481 atgaaaaaaataataaaatgaaaat 457



to top

>gb|AC123032.5| Mus musculus BAC clone RP24-480K24 from chromosome 10, complete
             sequence
          Length = 162676

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 50    taaaaataataaaatgaaaat 70
             |||||||||||||||||||||
Sbjct: 38543 taaaaataataaaatgaaaat 38563



to top

>gb|AC122388.5| Mus musculus BAC clone RP24-80J12 from chromosome 16, complete sequence
          Length = 214268

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    ataaaaataataaaatgaaaa 69
             |||||||||||||||||||||
Sbjct: 89940 ataaaaataataaaatgaaaa 89960



to top

>gb|AC098738.2| Mus musculus BAC clone RP23-122F7 from 8, complete sequence
          Length = 216974

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 53    aaataataaaatgaaaatcataaat 77
             |||| ||||||||||||||||||||
Sbjct: 79608 aaattataaaatgaaaatcataaat 79632



to top

>gb|AC121602.2| Mus musculus BAC clone RP23-309B19 from 10, complete sequence
          Length = 182661

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 50    taaaaataataaaatgaaaat 70
             |||||||||||||||||||||
Sbjct: 17911 taaaaataataaaatgaaaat 17891



to top

>ref|XM_737253.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000070.03.0)
           partial mRNA
          Length = 2427

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 50  taaaaataataaaatgaaaat 70
           |||||||||||||||||||||
Sbjct: 504 taaaaataataaaatgaaaat 524



to top

>emb|AL591604.6| Human DNA sequence from clone RP11-356F4 on chromosome 1 Contains the 5'
              end of the SLICK gene for a sodium- and chloride-activated
              ATP-sensitive potassium channel, complete sequence
          Length = 185560

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 50     taaaaataataaaatgaaaat 70
              |||||||||||||||||||||
Sbjct: 178102 taaaaataataaaatgaaaat 178122



to top

>emb|AL096707.13|HSJ729N16 Human DNA sequence from clone RP4-729N16 on chromosome 10, complete
             sequence
          Length = 154469

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 45    tatgataaaaataataaaatg 65
             |||||||||||||||||||||
Sbjct: 30051 tatgataaaaataataaaatg 30071



to top

>emb|AL035667.12|HS805C22 Human DNA sequence from clone RP4-805C22 on chromosome 20q13.2-13.32
              Contains the 3' end of the gene for downstream of tyrosine
              kinase 5 (DOK5) protein, complete sequence
          Length = 135391

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 46     atgataaaaataataaaatgaaaatcata 74
              ||||||| ||||||||||| |||||||||
Sbjct: 123107 atgataataataataaaataaaaatcata 123135



to top

>emb|AL021812.1|HSU86H4 Human DNA sequence from clone LL0XNC01-86H4 on chromosome X, complete
             sequence
          Length = 45199

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 52    aaaataataaaatgaaaatca 72
             |||||||||||||||||||||
Sbjct: 26938 aaaataataaaatgaaaatca 26918



to top

>gb|AC006593.5| Arabidopsis thaliana chromosome 2 clone F16D14 map nga361, complete
             sequence
          Length = 84872

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 45    tatgataaaaataataaaatg 65
             |||||||||||||||||||||
Sbjct: 74601 tatgataaaaataataaaatg 74581



to top

>gb|AC104358.4| Homo sapiens chromosome 8, clone RP11-151L10, complete sequence
          Length = 174055

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 51    aaaaataataaaatgaaaatc 71
             |||||||||||||||||||||
Sbjct: 37888 aaaaataataaaatgaaaatc 37908



to top

>gb|AC091647.4| Homo sapiens chromosome 18, clone RP11-635D8, complete sequence
          Length = 173368

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 50    taaaaataataaaatgaaaat 70
             |||||||||||||||||||||
Sbjct: 94965 taaaaataataaaatgaaaat 94985



to top

>gb|AC008912.5| Homo sapiens chromosome 5 clone CITB-H1_2269J5, complete sequence
          Length = 115378

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 42    ttttatgataaaaataataaa 62
             |||||||||||||||||||||
Sbjct: 18785 ttttatgataaaaataataaa 18805



to top

>gb|AC008586.6|AC008586 Homo sapiens chromosome 5 clone CTC-568N24, complete sequence
          Length = 133691

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 44    ttatgataaaaataataaaat 64
             |||||||||||||||||||||
Sbjct: 67214 ttatgataaaaataataaaat 67194



to top

>gb|AC019239.5|AC019239 Homo sapiens chromosome 18, clone RP11-346H17, complete sequence
          Length = 165591

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 50    taaaaataataaaatgaaaat 70
             |||||||||||||||||||||
Sbjct: 65538 taaaaataataaaatgaaaat 65558



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 49       ataaaaataataaaatgaaaa 69
                |||||||||||||||||||||
Sbjct: 25190648 ataaaaataataaaatgaaaa 25190628



to top

>gb|AC093730.3| Homo sapiens BAC clone RP11-12K22 from 4, complete sequence
          Length = 158566

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 51    aaaaataataaaatgaaaatcataa 75
             ||||||||||||||| |||||||||
Sbjct: 85616 aaaaataataaaatggaaatcataa 85640



to top

>gb|AC003667.3| Homo sapiens X PAC RP1-17L20 (Roswell Park Cancer Institute Human PAC
             Library) complete sequence
          Length = 147371

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 50    taaaaataataaaatgaaaat 70
             |||||||||||||||||||||
Sbjct: 37970 taaaaataataaaatgaaaat 37950



to top

>dbj|AP003220.6| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0035I14
          Length = 117919

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    ataaaaataataaaatgaaaa 69
             |||||||||||||||||||||
Sbjct: 56657 ataaaaataataaaatgaaaa 56637



to top

>emb|BX005128.4| Zebrafish DNA sequence from clone CH211-129H14 in linkage group 17,
             complete sequence
          Length = 152345

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 51    aaaaataataaaatgaaaatcataa 75
             |||||||||||||| ||||||||||
Sbjct: 17572 aaaaataataaaataaaaatcataa 17596



to top

>gb|AC006840.17|AC006840 Homo sapiens chromosome 4 clone C0422C23, complete sequence
          Length = 201657

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     ataaaaataataaaatgaaaa 69
              |||||||||||||||||||||
Sbjct: 135730 ataaaaataataaaatgaaaa 135750



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 41      cttttatgataaaaataataa 61
               |||||||||||||||||||||
Sbjct: 2952281 cttttatgataaaaataataa 2952261



to top

>emb|CT573077.2| Medicago truncatula chromosome 5 clone mth2-43j18, COMPLETE SEQUENCE
          Length = 142338

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aataaaatgaaaatcataaat 77
             |||||||||||||||||||||
Sbjct: 57822 aataaaatgaaaatcataaat 57842



to top

>dbj|AP005622.3| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1016F12, complete
             sequence
          Length = 200738

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 51    aaaaataataaaatgaaaatc 71
             |||||||||||||||||||||
Sbjct: 26739 aaaaataataaaatgaaaatc 26759



to top

>emb|BX088567.6| Mouse DNA sequence from clone RP23-21L20 on chromosome X, complete
             sequence
          Length = 150122

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    ataaaaataataaaatgaaaa 69
             |||||||||||||||||||||
Sbjct: 84252 ataaaaataataaaatgaaaa 84272



to top

>emb|AL929124.13| Zebrafish DNA sequence from clone CH211-128D23, complete sequence
          Length = 165243

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 49     ataaaaataataaaatgaaaatcataaat 77
              |||||||||||||||| ||||| ||||||
Sbjct: 163993 ataaaaataataaaataaaaataataaat 164021



to top

>gb|AC139027.12| Mus musculus chromosome 18, clone RP23-396C22, complete sequence
          Length = 195153

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    taaaaataataaaatgaaaa 69
             ||||||||||||||||||||
Sbjct: 82868 taaaaataataaaatgaaaa 82887



to top

>gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8 of 8 of the complete
              sequence
          Length = 271546

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     ttttatgataaaaataataa 61
              ||||||||||||||||||||
Sbjct: 253196 ttttatgataaaaataataa 253215



to top

>gb|AE014842.1| Plasmodium falciparum 3D7 chromosome 11 section 7 of 8 of the complete
              sequence
          Length = 253151

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     cttttatgataaaaataata 60
              ||||||||||||||||||||
Sbjct: 105869 cttttatgataaaaataata 105850



to top

>gb|AC099037.2| Drosophila melanogaster clone BACR27P17, complete sequence
          Length = 193320

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 43    tttatgataaaaataataaaatgaaaat 70
             ||||| |||| |||||||||||||||||
Sbjct: 28595 tttataataacaataataaaatgaaaat 28568



to top

>gb|AC095018.2| Drosophila melanogaster clone BACR24L18, complete sequence
          Length = 163116

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 52     aaaataataaaatgaaaatcataa 75
              |||||||| |||||||||||||||
Sbjct: 123445 aaaataatgaaatgaaaatcataa 123468



to top

>gb|AY523014.1| Colinus virginianus clone A-12A microsatellite sequence
          Length = 496

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  ataaaaataataaaatgaaa 68
           ||||||||||||||||||||
Sbjct: 409 ataaaaataataaaatgaaa 390



to top

>gb|AC008257.6| Drosophila melanogaster clone BACR08A11, complete sequence
          Length = 170478

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    taaaaataataaaatgaaaa 69
             ||||||||||||||||||||
Sbjct: 35987 taaaaataataaaatgaaaa 36006



to top

>gb|AC146241.4| Pan troglodytes BAC clone RP43-31L17 from 7, complete sequence
          Length = 160620

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 47     tgataaaaataataaaatgaaaat 70
              ||||||||||||| ||||||||||
Sbjct: 108671 tgataaaaataatgaaatgaaaat 108648



to top

>gb|AY642135.1| Homo sapiens interleukin 5 receptor, alpha (IL5RA) gene, complete cds
          Length = 43944

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 57    aataaaatgaaaatcataaa 76
             ||||||||||||||||||||
Sbjct: 15438 aataaaatgaaaatcataaa 15419



to top

>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete
             sequence
          Length = 149455

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 49    ataaaaataataaaatgaaaatcataaa 76
             |||||||||||||||||| ||| |||||
Sbjct: 94257 ataaaaataataaaatgataataataaa 94284



to top

>gb|AC024730.7| Homo sapiens BAC clone RP11-422E4 from 7, complete sequence
          Length = 151198

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 56866 aaaaataataaaatgaaaat 56847



to top

>emb|AJ966296.1| Pisum sativum insertion site for PDR1 retrotransposon insertion,
           strain JI281, John Innes Pisum Collection Accession JI64
           (Pisum elatius RBIP 64x40)
          Length = 402

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 55  ataataaaatgaaaatcata 74
           ||||||||||||||||||||
Sbjct: 384 ataataaaatgaaaatcata 365



to top

>emb|CT025525.8| Mouse DNA sequence from clone RP23-285C6 on chromosome 14, complete
              sequence
          Length = 194278

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 50     taaaaataataaaatgaaaa 69
              ||||||||||||||||||||
Sbjct: 143306 taaaaataataaaatgaaaa 143287



to top

>gb|AC146095.3| Pan troglodytes BAC clone RP43-48M24 from 7, complete sequence
          Length = 190243

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     ttttatgataaaaataataa 61
              ||||||||||||||||||||
Sbjct: 152000 ttttatgataaaaataataa 152019



to top

>emb|CR388050.16| Zebrafish DNA sequence from clone CH211-287N14 in linkage group 24,
              complete sequence
          Length = 176933

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     tttatgataaaaataataaaatga 66
              |||||||||| |||||||||||||
Sbjct: 120128 tttatgataataataataaaatga 120105



to top

>gb|AC135115.5| Mus musculus BAC clone RP24-251K13 from chromosome 10, complete
             sequence
          Length = 178241

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ttatgataaaaataataaaa 63
             ||||||||||||||||||||
Sbjct: 66626 ttatgataaaaataataaaa 66607



to top

>gb|AC127575.4| Mus musculus BAC clone RP24-240L12 from chromosome 8, complete sequence
          Length = 162564

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 48    gataaaaataataaaatgaaaatc 71
             ||||||||||||||||| ||||||
Sbjct: 10643 gataaaaataataaaataaaaatc 10666



to top

>gb|AC111014.6| Mus musculus BAC clone RP24-371P8 from chromosome 10, complete sequence
          Length = 141953

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ttatgataaaaataataaaa 63
             ||||||||||||||||||||
Sbjct: 29053 ttatgataaaaataataaaa 29072



to top

>emb|BX936377.16| Zebrafish DNA sequence from clone DKEY-149J2 in linkage group 17,
              complete sequence
          Length = 137894

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 49     ataaaaataataaaatgaaaatca 72
              |||||||||||||||| |||||||
Sbjct: 113725 ataaaaataataaaataaaaatca 113702



to top

>gb|AE014311.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 8 of
              11 of the complete sequence
          Length = 250029

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 49     ataaaaataataaaatgaaa 68
              ||||||||||||||||||||
Sbjct: 143993 ataaaaataataaaatgaaa 143974



to top

>ref|XM_722872.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY07162)
            partial mRNA
          Length = 4419

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 51   aaaaataataaaatgaaaat 70
            ||||||||||||||||||||
Sbjct: 2488 aaaaataataaaatgaaaat 2507



to top

>ref|XM_724967.1| Plasmodium yoelii yoelii str. 17XNL CCAAT-box DNA binding protein
           subunit B (PY02192) partial mRNA
          Length = 1981

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ttttatgataaaaataataa 61
           ||||||||||||||||||||
Sbjct: 205 ttttatgataaaaataataa 224



 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 49   ataaaaataataaaatgaa 67
            |||||||||||||||||||
Sbjct: 1856 ataaaaataataaaatgaa 1874



to top

>ref|XM_719435.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04262)
            partial mRNA
          Length = 6072

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 49   ataaaaataataaaatgaaa 68
            ||||||||||||||||||||
Sbjct: 2978 ataaaaataataaaatgaaa 2997



to top

>ref|XM_961106.1| Plasmodium falciparum 3D7 hypothetical protein (PFF1040w) partial
           mRNA
          Length = 1032

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 48  gataaaaataataaaatgaa 67
           ||||||||||||||||||||
Sbjct: 256 gataaaaataataaaatgaa 275



to top

>gb|AC113309.7| Mus musculus chromosome 6, clone RP23-440D19, complete sequence
          Length = 229553

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 49    ataaaaataataaaatgaaaatcataaa 76
             |||||||||||||||| |||||| ||||
Sbjct: 90240 ataaaaataataaaataaaaatcttaaa 90267



to top

>gb|AC073348.8| Homo sapiens BAC clone RP11-786A20 from 7, complete sequence
          Length = 153997

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     ttttatgataaaaataataa 61
              ||||||||||||||||||||
Sbjct: 115825 ttttatgataaaaataataa 115844



to top

>ref|XM_735144.1| Plasmodium chabaudi chabaudi hypothetical protein (PC301305.00.0)
           partial mRNA
          Length = 657

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 49  ataaaaataataaaatgaaa 68
           ||||||||||||||||||||
Sbjct: 590 ataaaaataataaaatgaaa 609



to top

>ref|XM_671013.1| Plasmodium berghei strain ANKA RNA binding protein (PB001104.03.0)
           partial mRNA
          Length = 1989

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 46  atgataaaaataataaaatgaaaa 69
           ||||||||||||||||||| ||||
Sbjct: 719 atgataaaaataataaaataaaaa 742



to top

>gb|AC146114.3| Pan troglodytes BAC clone RP43-22O2 from 7, complete sequence
          Length = 176328

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    ttttatgataaaaataataa 61
             ||||||||||||||||||||
Sbjct: 22720 ttttatgataaaaataataa 22739



to top

>gb|AC142305.1| Pan troglodytes BAC clone RP43-130P22 from 7, complete sequence
          Length = 173535

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 47   tgataaaaataataaaatgaaaat 70
            ||||||||||||| ||||||||||
Sbjct: 3070 tgataaaaataatgaaatgaaaat 3047



to top

>gb|AC140950.1| Pan troglodytes BAC clone RP43-58I22 from 7, complete sequence
          Length = 190084

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 47     tgataaaaataataaaatgaaaat 70
              ||||||||||||| ||||||||||
Sbjct: 100214 tgataaaaataatgaaatgaaaat 100191



to top

>emb|CR376723.15| Zebrafish DNA sequence from clone DKEY-90N12 in linkage group 8, complete
              sequence
          Length = 213541

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     ttttatgataaaaataataa 61
              ||||||||||||||||||||
Sbjct: 116257 ttttatgataaaaataataa 116276



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 45      tatgataaaaataataaaat 64
               ||||||||||||||||||||
Sbjct: 1769973 tatgataaaaataataaaat 1769992



to top

>emb|CR352207.9| Zebrafish DNA sequence from clone CH211-110B5 in linkage group 7,
             complete sequence
          Length = 180005

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 24395 aaaaataataaaatgaaaat 24414



to top

>emb|BX927334.17| Zebrafish DNA sequence from clone CH211-112H5 in linkage group 21,
             complete sequence
          Length = 183608

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 83372 ataaaaataataaaatgaaa 83353



to top

>emb|AL591847.8| Human DNA sequence from clone RP11-510L10 on chromosome 13, complete
             sequence
          Length = 171596

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 24647 ataaaaataataaaatgaaa 24628



to top

>gb|AE014822.1| Plasmodium falciparum 3D7 chromosome 14 section 7 of 13 of the complete
             sequence
          Length = 253924

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 56015 aaaaataataaaatgaaaat 56034



to top

>emb|AL157402.19| Human DNA sequence from clone RP11-553K8 on chromosome 1q31.2-31.3
             Contains the ATP6V1G3 gene for H+ transporting ATPase
             lysosomal 13kDa V1 subunit G isoform 3, two novel genes, a
             prostatic binding protein (PBP) pseudogene and the 5' end
             of the PTPRC gene for receptor type protein tyrosine
             phosphatase C, complete sequence
          Length = 210331

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    taaaaataataaaatgaaaa 69
             ||||||||||||||||||||
Sbjct: 78464 taaaaataataaaatgaaaa 78445



to top

>gb|AC069439.18| Homo sapiens 3 BAC RP11-12K11 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 104485

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 79098 ataaaaataataaaatgaaa 79079



to top

>emb|AL033376.17|HS278N12 Human DNA sequence from clone RP1-278N12 on chromosome 6q25.1-26
             Contains the 5' end of the gene for
             phosphoinositide-binding protein PIP3-E (KIAA0403),
             complete sequence
          Length = 78533

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 53    aaataataaaatgaaaatcataaa 76
             ||||||||||| ||||||||||||
Sbjct: 12198 aaataataaaaagaaaatcataaa 12221



to top

>gb|AC090894.10| Homo sapiens chromosome 17, clone RP11-744K17, complete sequence
          Length = 150680

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 12912 ataaaaataataaaatgaaa 12893



to top

>emb|CR382400.1| Plasmodium falciparum chromosome 6, complete sequence; segment 3/5
          Length = 348034

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     gataaaaataataaaatgaa 67
              ||||||||||||||||||||
Sbjct: 184724 gataaaaataataaaatgaa 184743



to top

>gb|AC140254.4| Mus musculus BAC clone RP23-467N7 from chromosome 10, complete sequence
          Length = 196465

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 51     aaaaataataaaatgaaaat 70
              ||||||||||||||||||||
Sbjct: 112504 aaaaataataaaatgaaaat 112523



to top

>emb|CR388130.8| Zebrafish DNA sequence from clone CH211-276A12 in linkage group 15,
             complete sequence
          Length = 78308

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 49    ataaaaataataaaatgaaaatca 72
             ||||||||||| ||||||||||||
Sbjct: 24812 ataaaaataatcaaatgaaaatca 24835



to top

>emb|AL161531.2|ATCHRIV31 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 31
          Length = 198301

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 93509 ataaaaataataaaatgaaa 93528



to top

>emb|AL096882.2|ATF8L21 Arabidopsis thaliana DNA chromosome 4, BAC clone F8L21 (ESSA project)
          Length = 98948

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 20503 ataaaaataataaaatgaaa 20522



to top

>gb|AC100852.2| Homo sapiens chromosome 17, clone RP11-125C16, complete sequence
          Length = 157980

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 81891 ataaaaataataaaatgaaa 81872



to top

>emb|BX908795.10| Zebrafish DNA sequence from clone DKEY-92J12 in linkage group 1,
             complete sequence
          Length = 142468

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    tttatgataaaaataataaa 62
             ||||||||||||||||||||
Sbjct: 48254 tttatgataaaaataataaa 48273



to top

>emb|BX511081.8| Zebrafish DNA sequence from clone DKEY-6B12 in linkage group 21,
             complete sequence
          Length = 210246

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 48509 ataaaaataataaaatgaaa 48528



to top

>gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosome 14, complete sequence
          Length = 211315

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 49     ataaaaataataaaatgaaaatca 72
              |||| |||||||||||||||||||
Sbjct: 170412 ataagaataataaaatgaaaatca 170389



to top

>gb|AC107905.5| Homo sapiens chromosome 15, clone CTD-2026J24, complete sequence
          Length = 175627

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 43425 aaaaataataaaatgaaaat 43444



to top

>gb|AC108120.3| Homo sapiens chromosome 5 clone RP11-524L6, complete sequence
          Length = 212755

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ttatgataaaaataataaaa 63
             ||||||||||||||||||||
Sbjct: 78033 ttatgataaaaataataaaa 78014



to top

>gb|AC091559.7| Homo sapiens chromosome 8, clone RP11-60C8, complete sequence
          Length = 166357

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 48543 aaaaataataaaatgaaaat 48562



to top

>gb|AC018728.6| Homo sapiens chromosome 7 clone RP11-206N24, complete sequence
          Length = 181935

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 47     tgataaaaataataaaatgaaaat 70
              ||||||||||||| ||||||||||
Sbjct: 130680 tgataaaaataatgaaatgaaaat 130703



to top

>gb|AC024938.29| Homo sapiens 3 BAC RP11-485J7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 63332

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    ataataaaatgaaaatcata 74
             ||||||||||||||||||||
Sbjct: 59336 ataataaaatgaaaatcata 59317



to top

>gb|AC099540.2| Homo sapiens chromosome 3 clone RP11-353D4, complete sequence
          Length = 167799

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 51     aaaaataataaaatgaaaat 70
              ||||||||||||||||||||
Sbjct: 107935 aaaaataataaaatgaaaat 107954



to top

>gb|AC091984.3| Homo sapiens chromosome 5 clone RP11-569B13, complete sequence
          Length = 207040

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 46    atgataaaaataataaaatg 65
             ||||||||||||||||||||
Sbjct: 45625 atgataaaaataataaaatg 45644



to top

>gb|AC009839.10| Drosophila melanogaster 3L BAC RP98-16G9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 185918

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 43    tttatgataaaaataataaaatgaaaat 70
             ||||||||||||||| ||| ||||||||
Sbjct: 37287 tttatgataaaaatagtaatatgaaaat 37260



to top

>gb|AC104083.3| Homo sapiens BAC clone RP11-588K22 from 4, complete sequence
          Length = 196537

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 36     catggcttttatgataaaaa 55
              ||||||||||||||||||||
Sbjct: 154052 catggcttttatgataaaaa 154071



to top

>gb|AC009383.8| Drosophila melanogaster 3L BAC RP98-31C3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 179283

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 43     tttatgataaaaataataaaatgaaaat 70
              ||||||||||||||| ||| ||||||||
Sbjct: 176424 tttatgataaaaatagtaatatgaaaat 176397



to top

>gb|AC008382.6| Homo sapiens chromosome 5 clone CTC-218P2, complete sequence
          Length = 252015

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 45731 ataaaaataataaaatgaaa 45750



to top

>emb|BX649368.5| Zebrafish DNA sequence from clone CH211-191A16 in linkage group 15,
              complete sequence
          Length = 147849

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 46     atgataaaaataataaaatgaaaa 69
              ||||||| ||||||||||||||||
Sbjct: 123586 atgataataataataaaatgaaaa 123609



to top

>emb|BX120001.10| Zebrafish DNA sequence from clone CH211-217J8 in linkage group 16,
             complete sequence
          Length = 211279

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 49    ataaaaataataaaatgaaaatcataaa 76
             |||||||||||||||| ||||| |||||
Sbjct: 40471 ataaaaataataaaataaaaatgataaa 40498



 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 40658 aaaaataataaaatgaaaa 40676



to top

>gb|AC008339.2|AC008339 Drosophila melanogaster, chromosome 2R, region 42A-42A, BAC clone
              BACR13P06, complete sequence
          Length = 180699

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 50     taaaaataataaaatgaaaa 69
              ||||||||||||||||||||
Sbjct: 150113 taaaaataataaaatgaaaa 150132



to top

>gb|AC083799.17| Homo sapiens 3 BAC RP11-332M2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 184129

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 44932 aaaaataataaaatgaaaat 44951



to top

>gb|AC007467.4|AC007467 Drosophila melanogaster, chromosome 2L, region 38E-38F, BAC clone
             BACR07D17, complete sequence
          Length = 173422

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    aataaaatgaaaatcataaa 76
             ||||||||||||||||||||
Sbjct: 27939 aataaaatgaaaatcataaa 27958



to top

>gb|AC008771.4|AC008771 Homo sapiens chromosome 5 clone CTD-2015H6, complete sequence
          Length = 123169

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 18472 ataaaaataataaaatgaaa 18453



to top

>gb|AC097459.3| Homo sapiens BAC clone RP11-13F20 from 4, complete sequence
          Length = 161519

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 49   ataaaaataataaaatgaaaatca 72
            |||||||||||||||| |||||||
Sbjct: 3910 ataaaaataataaaataaaaatca 3933



to top

>gb|AC079755.6| Homo sapiens BAC clone RP11-85L2 from 4, complete sequence
          Length = 184471

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 45    tatgataaaaataataaaat 64
             ||||||||||||||||||||
Sbjct: 99083 tatgataaaaataataaaat 99102



to top

>gb|AC010907.10| Homo sapiens BAC clone RP11-568H24 from 2, complete sequence
          Length = 139357

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 51   aaaaataataaaatgaaaat 70
            ||||||||||||||||||||
Sbjct: 6758 aaaaataataaaatgaaaat 6739



to top

>gb|AC105399.3| Homo sapiens BAC clone RP11-715P7 from 2, complete sequence
          Length = 172435

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 47     tgataaaaataataaaatgaaaat 70
              |||||||||||||||||| |||||
Sbjct: 110642 tgataaaaataataaaattaaaat 110619



to top

>gb|AC153641.3| Mus musculus 6 BAC RP23-5F24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 193417

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 53    aaataataaaatgaaaatca 72
             ||||||||||||||||||||
Sbjct: 81725 aaataataaaatgaaaatca 81744



to top

>gb|AC026423.9| Homo sapiens chromosome 16 clone CTD-2169M19, complete sequence
          Length = 116130

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    ttatgataaaaataataaaa 63
             ||||||||||||||||||||
Sbjct: 14080 ttatgataaaaataataaaa 14099



to top

>gb|AC017083.7| Homo sapiens BAC clone RP11-474G23 from 2, complete sequence
          Length = 198278

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 74299 aaaaataataaaatgaaaat 74280



to top

>gb|AC115598.2| Dictyostelium discoideum chromosome 2 map 581427-735498 strain AX4,
             complete sequence
          Length = 154071

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 49    ataaaaataataaaatgaaaatcataaa 76
             |||||||||||||||| ||||| |||||
Sbjct: 56596 ataaaaataataaaataaaaataataaa 56623



to top

>gb|AC115604.2| Dictyostelium discoideum chromosome 2 map 4354771-4414991 strain AX4,
             complete sequence
          Length = 60220

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 42    ttttatgataaaaataataaaatgaaaa 69
             ||||| ||||||||||| ||||||||||
Sbjct: 48871 ttttaagataaaaataaaaaaatgaaaa 48898



to top

>gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470-3108875 strain AX4,
              complete sequence
          Length = 541399

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 49     ataaaaataataaaatgaaaatcataaa 76
              |||||||||||||||| ||||| |||||
Sbjct: 424283 ataaaaataataaaataaaaataataaa 424256



 Score = 38.2 bits (19), Expect = 3.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 49     ataaaaataataaaatgaaaatcataa 75
              |||||||||||||||| ||||| ||||
Sbjct: 424269 ataaaaataataaaataaaaataataa 424243



to top

>gb|AC018812.5|AC018812 Homo sapiens chromosome 3 clone RP11-161D20 map 3p, complete sequence
          Length = 169199

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     aataaaatgaaaatcataaa 76
              ||||||||||||||||||||
Sbjct: 109012 aataaaatgaaaatcataaa 108993



to top

>gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195B23, complete sequence
          Length = 129402

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    taaaaataataaaatgaaaa 69
             ||||||||||||||||||||
Sbjct: 57824 taaaaataataaaatgaaaa 57805



to top

>gb|AC100793.8| Homo sapiens chromosome 17, clone CTD-3193K9, complete sequence
          Length = 134465

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 58834 aaaaataataaaatgaaaat 58853



to top

>gb|AC107940.13| Homo sapiens chromosome 17, clone RP11-158C19, complete sequence
          Length = 164186

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 53204 ataaaaataataaaatgaaa 53223



to top

>gb|AC132825.8| Homo sapiens chromosome 8, clone RP13-929K23, complete sequence
          Length = 137261

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 67385 ataaaaataataaaatgaaa 67404



to top

>gb|AC024060.6| Homo sapiens chromosome 3 clone RP11-97C16 map 3p, complete sequence
          Length = 174313

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     aataaaatgaaaatcataaa 76
              ||||||||||||||||||||
Sbjct: 161271 aataaaatgaaaatcataaa 161252



to top

>emb|BX649277.5| Zebrafish DNA sequence from clone DKEYP-67A10 in linkage group 20,
             complete sequence
          Length = 125366

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    taaaaataataaaatgaaaa 69
             ||||||||||||||||||||
Sbjct: 68244 taaaaataataaaatgaaaa 68263



to top

>emb|BX571946.9| Zebrafish DNA sequence from clone DKEY-232H18 in linkage group 22,
              complete sequence
          Length = 179796

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 46     atgataaaaataataaaatgaaaa 69
              ||||||||||||||||||| ||||
Sbjct: 128864 atgataaaaataataaaataaaaa 128841



to top

>emb|Z46996.1|CEC34C12 Caenorhabditis elegans Cosmid C34C12, complete sequence
          Length = 34759

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 26922 aaaaataataaaatgaaaat 26903



to top

>gb|AE003715.4| Drosophila melanogaster chromosome 3R, section 53 of 118 of the
             complete sequence
          Length = 228547

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 52    aaaataataaaatgaaaatcataa 75
             |||||||| |||||||||||||||
Sbjct: 34249 aaaataatgaaatgaaaatcataa 34226



to top

>gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77 of 83 of the complete
             sequence
          Length = 270158

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    aataaaatgaaaatcataaa 76
             ||||||||||||||||||||
Sbjct: 17753 aataaaatgaaaatcataaa 17772



to top

>gb|AE003784.5| Drosophila melanogaster chromosome 2R, section 5 of 73 of the complete
              sequence
          Length = 305162

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 50     taaaaataataaaatgaaaa 69
              ||||||||||||||||||||
Sbjct: 212600 taaaaataataaaatgaaaa 212619



to top

>gb|AC005710.2|AC005710 Drosophila melanogaster, chromosome 2R, region 60E1-60E2, P1 clone
             DS04938, complete sequence
          Length = 57955

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 43    tttatgataaaaataataaaatgaaaat 70
             ||||| |||| |||||||||||||||||
Sbjct: 12896 tttataataacaataataaaatgaaaat 12869



to top

>gb|AE003514.4| Drosophila melanogaster chromosome 3L, section 71 of 83 of the complete
              sequence
          Length = 299903

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 43     tttatgataaaaataataaaatgaaaat 70
              ||||||||||||||| ||| ||||||||
Sbjct: 219441 tttatgataaaaatagtaatatgaaaat 219414



to top

>gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72 of 73 of the complete
              sequence
          Length = 343833

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 43     tttatgataaaaataataaaatgaaaat 70
              ||||| |||| |||||||||||||||||
Sbjct: 141568 tttataataacaataataaaatgaaaat 141595



to top

>gb|AC158383.3| Mus musculus BAC clone RP23-135O16 from chromosome 12, complete sequence
          Length = 196552

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 45     tatgataaaaataataaaatgaaaatca 72
              ||||| ||||||||| ||||||||||||
Sbjct: 139495 tatgaaaaaaataattaaatgaaaatca 139468



to top

>emb|AL732620.14| Mouse DNA sequence from clone RP23-167G19 on chromosome 2, complete
             sequence
          Length = 230116

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 49    ataaaaataataaaatgaaaatcataaa 76
             |||||||||||||||| ||||| |||||
Sbjct: 45660 ataaaaataataaaataaaaataataaa 45633



to top

>emb|BX897719.9| Zebrafish DNA sequence from clone CH211-199I23 in linkage group 13,
              complete sequence
          Length = 216407

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 50     taaaaataataaaatgaaaatcat 73
              |||||||||||||||||| |||||
Sbjct: 204970 taaaaataataaaatgaatatcat 204993



to top

>emb|BX005283.6| Zebrafish DNA sequence from clone CH211-93G21, complete sequence
          Length = 156246

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     tttatgataaaaataataaaatga 66
              |||||||||| |||||||||||||
Sbjct: 111068 tttatgataataataataaaatga 111045



to top

>gb|DQ316259.1| Homo sapiens nemo like kinase (NLK) gene, complete cds
          Length = 158034

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 75583 ataaaaataataaaatgaaa 75564



to top

>gb|AC134445.3| Mus musculus BAC clone RP24-170M15 from 6, complete sequence
          Length = 165568

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 65869 ataaaaataataaaatgaaa 65888



to top

>gb|AC004759.1|AC004759 Drosophila melanogaster DNA sequence (P1s DS04217 (D56) and DS00582
             (D85)), complete sequence
          Length = 142799

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 57    aataaaatgaaaatcataaa 76
             ||||||||||||||||||||
Sbjct: 61596 aataaaatgaaaatcataaa 61577



to top

>gb|AC154362.1| Mus musculus BAC clone RP23-154E1 from 14, complete sequence
          Length = 205650

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 49     ataaaaataataaaatgaaaatca 72
              |||| |||||||||||||||||||
Sbjct: 194008 ataagaataataaaatgaaaatca 194031



to top

>gb|AC134907.5| Mus musculus BAC clone RP23-362K17 from 8, complete sequence
          Length = 186341

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 48    gataaaaataataaaatgaaaatc 71
             ||||||||||||||||| ||||||
Sbjct: 89974 gataaaaataataaaataaaaatc 89951



to top

>gb|AC002546.1|AC002546 Homo sapiens chromosome 17, clone 193h18, complete sequence
          Length = 106420

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 62959 ataaaaataataaaatgaaa 62978



to top

>gb|L31790.1|L31790 Drosophila melanogaster (P1 DS00846 (D02)) DNA sequence, complete
             sequence
          Length = 77447

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 52    aaaataataaaatgaaaatcataa 75
             |||||||| |||||||||||||||
Sbjct: 41297 aaaataatgaaatgaaaatcataa 41320



to top

>gb|AC022002.5| Homo sapiens chromosome 3 clone RP11-198P17 map 3p, complete sequence
          Length = 189097

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 57     aataaaatgaaaatcataaa 76
              ||||||||||||||||||||
Sbjct: 185081 aataaaatgaaaatcataaa 185100



to top

>dbj|AP005202.3| Homo sapiens genomic DNA, chromosome 18 clone:CTD-2124B20, complete
             sequence
          Length = 136283

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    aaaaataataaaatgaaaat 70
             ||||||||||||||||||||
Sbjct: 46181 aaaaataataaaatgaaaat 46200



to top

>dbj|AP006104.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT10H09, TM0189,
             complete sequence
          Length = 92745

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 45    tatgataaaaataataaaatgaaaatcataaa 76
             |||||||||  |||||||||||||| ||||||
Sbjct: 84071 tatgataaatttaataaaatgaaaaacataaa 84040



to top

>gb|AC166321.3| Cavia porcellus, clone Cavia porcellus-24949357D4, complete sequence
          Length = 36966

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 54   aataataaaatgaaaatcat 73
            ||||||||||||||||||||
Sbjct: 3622 aataataaaatgaaaatcat 3641



to top

>gb|U31961.1|DMU31961 Drosophila melanogaster bithorax complex (BX-C), complete sequence
          Length = 338234

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 52     aaaataataaaatgaaaatcataa 75
              |||||||| |||||||||||||||
Sbjct: 149465 aaaataatgaaatgaaaatcataa 149488



to top

>emb|AL592224.17| Mouse DNA sequence from clone RP23-174G1 on chromosome 1, complete
           sequence
          Length = 217775

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  tatgataaaaataataaaat 64
           ||||||||||||||||||||
Sbjct: 705 tatgataaaaataataaaat 686



to top

>emb|AL713855.7| Mouse DNA sequence from clone RP23-206E19 on chromosome 1, complete
             sequence
          Length = 23857

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    tatgataaaaataataaaat 64
             ||||||||||||||||||||
Sbjct: 22562 tatgataaaaataataaaat 22543



to top

>emb|AL808118.8| Mouse DNA sequence from clone RP23-287O8 on chromosome 4, complete
             sequence
          Length = 164068

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 45    tatgataaaaataataaaat 64
             ||||||||||||||||||||
Sbjct: 72564 tatgataaaaataataaaat 72583



to top

>emb|X99254.1|PFPRIMSSU P.falciparum gene encoding primase, small subunit
          Length = 3830

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 51   aaaaataataaaatgaaaat 70
            ||||||||||||||||||||
Sbjct: 2032 aaaaataataaaatgaaaat 2051



to top

>gb|AC132822.3| Homo sapiens chromosome 17, clone RP13-885L6, complete sequence
          Length = 133778

 Score = 40.1 bits (20), Expect = 0.79
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    ataaaaataataaaatgaaa 68
             ||||||||||||||||||||
Sbjct: 57065 ataaaaataataaaatgaaa 57084



to top

>ref|NM_123170.2| Arabidopsis thaliana methyltransferase AT5G38100 mRNA, complete cds
          Length = 1392

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 49   ataaaaataataaaatgaa 67
            |||||||||||||||||||
Sbjct: 1298 ataaaaataataaaatgaa 1280



to top

>gb|AC153488.1| Tribolium castaneum  BAC T.cast_C24H10 (Clemson University Genomics
            Institute Tribolium castaneum BAC Library (Red Flour
            Beetle)) complete sequence
          Length = 40580

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 49   ataaaaataataaaatgaaaatcataa 75
            |||||||||||||||| ||||| ||||
Sbjct: 8565 ataaaaataataaaataaaaataataa 8539



to top

>gb|AC101593.16| Mus musculus chromosome 18, clone RP23-198A7, complete sequence
          Length = 206936

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 44    ttatgataaaaataataaa 62
             |||||||||||||||||||
Sbjct: 53693 ttatgataaaaataataaa 53675



to top

>gb|AC152927.1| Tribolium castaneum  BAC T.cast_C19N19 (Clemson University Genomics
             Institute Tribolium castaneum BAC Library (Red Flour
             Beetle)) complete sequence
          Length = 137018

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 49    ataaaaataataaaatgaaaatcataa 75
             |||||||||||||||| ||||| ||||
Sbjct: 45241 ataaaaataataaaataaaaataataa 45267



to top

>gb|CP000014.1| Borrelia garinii PBi plasmid cp26, complete sequence
          Length = 27108

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 45   tatgataaaaataataaaa 63
            |||||||||||||||||||
Sbjct: 8623 tatgataaaaataataaaa 8641



to top

>gb|CP000013.1| Borrelia garinii PBi, complete genome
          Length = 904246

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     ataaaaataataaaatgaa 67
              |||||||||||||||||||
Sbjct: 105209 ataaaaataataaaatgaa 105227



to top

>ref|XM_642081.1| Dictyostelium discoideum hypothetical protein (DDB0189414),
          partial mRNA
          Length = 1515

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 46 atgataaaaataataaaat 64
          |||||||||||||||||||
Sbjct: 34 atgataaaaataataaaat 16



to top

>ref|XM_636105.1| Dictyostelium discoideum hypothetical protein (DDB0218242), partial
            mRNA
          Length = 8808

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 52   aaaataataaaatgaaaat 70
            |||||||||||||||||||
Sbjct: 6842 aaaataataaaatgaaaat 6860



to top

>ref|XM_635560.1| Dictyostelium discoideum hypothetical protein (DDB0205556),
          partial mRNA
          Length = 1515

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 46 atgataaaaataataaaat 64
          |||||||||||||||||||
Sbjct: 34 atgataaaaataataaaat 16



to top

>gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosome 6, complete sequence
          Length = 190146

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 51     aaaaataataaaatgaaaa 69
              |||||||||||||||||||
Sbjct: 150125 aaaaataataaaatgaaaa 150143



to top

>gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosome y, complete sequence
          Length = 179613

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 135619 tttatgataaaaatgataaaatg 135641



to top

>gb|AC132905.13| Mus musculus chromosome 13, clone RP24-295E18, complete sequence
          Length = 187116

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     atgataaaaataataaaat 64
              |||||||||||||||||||
Sbjct: 145027 atgataaaaataataaaat 145045



to top

>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the complete
              sequence
          Length = 249995

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 52     aaaataataaaatgaaaat 70
              |||||||||||||||||||
Sbjct: 171645 aaaataataaaatgaaaat 171627



to top

>gb|AE014835.1| Plasmodium falciparum 3D7 chromosome 10 section 7 of 7 of the complete
             sequence
          Length = 180450

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 46    atgataaaaataataaaatgaaa 68
             ||||||||||||| |||||||||
Sbjct: 57249 atgataaaaataaaaaaatgaaa 57227



to top

>gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5 of 7 of the complete
             sequence
          Length = 252394

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 95285 aaaaataataaaatgaaaa 95267



 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 95262 aaaaataataaaatgaaaa 95244



to top

>gb|AE014828.1| Plasmodium falciparum 3D7 chromosome 14 section 13 of 13 of the
             complete sequence
          Length = 273275

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 52    aaaataataaaatgaaaat 70
             |||||||||||||||||||
Sbjct: 66824 aaaataataaaatgaaaat 66842



to top

>gb|AC161431.4| Mus musculus chromosome 7, clone RP24-306C18, complete sequence
          Length = 148949

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 44     ttatgataaaaataataaaatga 66
              |||| ||||||||||||||||||
Sbjct: 143778 ttattataaaaataataaaatga 143800



to top

>gb|AF499727.1| Cucumis melo BAC clone PIT92-60K17, complete sequence
          Length = 116877

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 49    ataaaaataataaaatgaa 67
             |||||||||||||||||||
Sbjct: 84225 ataaaaataataaaatgaa 84243



to top

>gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section 8 of 9 of the complete
              sequence
          Length = 251762

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 49     ataaaaataataaaatgaa 67
              |||||||||||||||||||
Sbjct: 203279 ataaaaataataaaatgaa 203261



to top

>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence
          Length = 1608198

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 52     aaaataataaaatgaaaat 70
              |||||||||||||||||||
Sbjct: 666313 aaaataataaaatgaaaat 666331



to top

>gb|AC104617.9| Trypanosoma brucei chromosome 5 clone RPCI93-1P6, complete sequence
          Length = 152664

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 52    aaaataataaaatgaaaat 70
             |||||||||||||||||||
Sbjct: 10959 aaaataataaaatgaaaat 10941



to top

>gb|AY552485.1| Odontomachus sp. CPS172 cytochrome b (Cytb) gene, partial cds;
           mitochondrial
          Length = 433

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 57  aataaaatgaaaatcataa 75
           |||||||||||||||||||
Sbjct: 309 aataaaatgaaaatcataa 291



to top

>gb|AC109302.9| Mus musculus chromosome 3, clone RP24-331E17, complete sequence
          Length = 165229

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 36677 aaaaataataaaatgaaaa 36659



to top

>gb|AC159249.3| Mus musculus BAC clone RP24-177C7 from chromosome y, complete sequence
          Length = 146406

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 94090 tttatgataaaaatgataaaatg 94068



to top

>gb|AC150658.7| Mus musculus BAC clone RP24-474E20 from chromosome y, complete sequence
          Length = 204836

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 190494 tttatgataaaaatgataaaatg 190516



to top

>gb|AC134400.4| Mus musculus chromosome 3, clone RP24-284D6, complete sequence
          Length = 190390

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 73053 aaaaataataaaatgaaaa 73071



to top

>gb|AF487277.1| Lecanicillium muscarium, complete genome
          Length = 24499

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 49   ataaaaataataaaatgaa 67
            |||||||||||||||||||
Sbjct: 3208 ataaaaataataaaatgaa 3226



to top

>ref|XM_873391.1| PREDICTED: Bos taurus similar to receptor (TNFRSF)-interacting
           serine-threonine kinase 1, transcript variant 2
           (LOC613593), mRNA
          Length = 1551

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 49  ataaaaataataaaatgaa 67
           |||||||||||||||||||
Sbjct: 108 ataaaaataataaaatgaa 90



to top

>gb|AC147991.4| Mus musculus BAC clone RP24-362D11 from chromosome Y, complete sequence
          Length = 180675

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 137772 tttatgataaaaatgataaaatg 137750



to top

>gb|AC132276.4| Mus musculus BAC clone RP24-344B8 from chromosome Y, complete sequence
          Length = 168601

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 58862 tttatgataaaaatgataaaatg 58884



to top

>gb|AC145587.4| Mus musculus BAC clone RP24-343E24 from chromosome Y, complete sequence
          Length = 160323

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 31944 tttatgataaaaatgataaaatg 31922



to top

>gb|AC147260.3| Mus musculus BAC clone RP24-186L11 from chromosome Y, complete sequence
          Length = 137361

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 30814 tttatgataaaaatgataaaatg 30836



to top

>gb|AC123741.9| Mus musculus chromosome 1, clone RP24-113A5, complete sequence
          Length = 188453

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 57     aataaaatgaaaatcataa 75
              |||||||||||||||||||
Sbjct: 169809 aataaaatgaaaatcataa 169827



to top

>gb|AC121313.8| Mus musculus chromosome 14, clone RP24-395N22, complete sequence
          Length = 131620

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 49    ataaaaataataaaatgaa 67
             |||||||||||||||||||
Sbjct: 70628 ataaaaataataaaatgaa 70646



to top

>gb|AE006818.1| Sulfolobus solfataricus P2 section 177 of 272 of the complete genome
          Length = 10370

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 45   tatgataaaaataataaaa 63
            |||||||||||||||||||
Sbjct: 9670 tatgataaaaataataaaa 9652



to top

>gb|AE006252.1| Lactococcus lactis subsp. lactis IL1403 section 14 of 218 of the
            complete genome
          Length = 14267

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 50   taaaaataataaaatgaaa 68
            |||||||||||||||||||
Sbjct: 7601 taaaaataataaaatgaaa 7619



to top

>gb|AC145562.5| Mus musculus BAC clone RP24-67L21 from chromosome Y, complete sequence
          Length = 156048

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 98963 tttatgataaaaatgataaaatg 98941



 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 21947 tttatgataaaaatgataaaatg 21925



to top

>gb|AC147268.5| Mus musculus BAC clone RP24-263J19 from chromosome Y, complete sequence
          Length = 129831

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 77421 tttatgataaaaatgataaaatg 77443



to top

>gb|AC145598.5| Mus musculus BAC clone RP24-324I11 from chromosome Y, complete sequence
          Length = 225035

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 22783 tttatgataaaaatgataaaatg 22761



to top

>gb|AC134564.5| Mus musculus BAC clone RP24-182E8 from chromosome Y, complete
            sequence
          Length = 149047

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 43   tttatgataaaaataataaaatg 65
            |||||||||||||| ||||||||
Sbjct: 7338 tttatgataaaaatgataaaatg 7360



to top

>gb|AC146687.1| Mus musculus BAC clone RP24-487N17 from chromosome Y, complete sequence
          Length = 162474

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 84903 tttatgataaaaatgataaaatg 84925



to top

>gb|AC148322.2| Mus musculus BAC clone RP24-467F9 from chromosome Y, complete sequence
          Length = 140999

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 135786 tttatgataaaaatgataaaatg 135764



 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 43   tttatgataaaaataataaaatg 65
            |||||||||||||| ||||||||
Sbjct: 9317 tttatgataaaaatgataaaatg 9339



to top

>gb|AC147996.3| Mus musculus BAC clone RP24-253L14 from chromosome Y, complete sequence
          Length = 149579

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 134667 tttatgataaaaatgataaaatg 134645



to top

>gb|AC131763.4| Mus musculus BAC clone RP24-231M1 from chromosome Y, complete sequence
          Length = 152276

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 94606 tttatgataaaaatgataaaatg 94628



to top

>gb|AC145991.2| Pan troglodytes BAC clone RP43-170F9 from 7, complete sequence
          Length = 173879

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 39    ggcttttatgataaaaataataaaatg 65
             ||||||||||| ||||||| |||||||
Sbjct: 28059 ggcttttatgaaaaaaatattaaaatg 28033



to top

>gb|AC174382.2| Mus musculus BAC clone RP24-94K20 from chromosome y, complete sequence
          Length = 207355

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 104690 tttatgataaaaatgataaaatg 104668



to top

>gb|AC126453.5| Mus musculus BAC clone RP23-244A6 from chromosome 6, complete sequence
          Length = 172616

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 46753 aaaaataataaaatgaaaa 46771



to top

>gb|AC147109.2| Mus musculus BAC clone RP24-75P8 from chromosome Y, complete sequence
          Length = 216878

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 134100 tttatgataaaaatgataaaatg 134078



to top

>gb|AC147107.2| Mus musculus BAC clone RP24-69F17 from chromosome Y, complete sequence
          Length = 202338

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 79845 tttatgataaaaatgataaaatg 79867



to top

>gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome Y, complete sequence
          Length = 197602

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 62669 tttatgataaaaatgataaaatg 62691



to top

>gb|AC145569.3| Mus musculus BAC clone RP24-89N16 from chromosome Y, complete sequence
          Length = 204741

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 122595 tttatgataaaaatgataaaatg 122617



to top

>gb|AC147372.3| Mus musculus BAC clone RP24-212L10 from chromosome Y, complete sequence
          Length = 187032

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 49494 tttatgataaaaatgataaaatg 49516



to top

>gb|AC140239.3| Mus musculus BAC clone RP24-280O4 from chromosome Y, complete sequence
          Length = 156577

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 28761 tttatgataaaaatgataaaatg 28783



to top

>gb|AC134552.4| Mus musculus BAC clone RP24-279K10 from chromosome 8, complete sequence
          Length = 154774

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 46    atgataaaaataataaaat 64
             |||||||||||||||||||
Sbjct: 68781 atgataaaaataataaaat 68799



to top

>gb|AC132323.3| Mus musculus BAC clone RP24-268M17 from chromosome 9, complete sequence
          Length = 182469

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 97315 aaaaataataaaatgaaaa 97297



to top

>gb|AC147461.2| Mus musculus BAC clone RP24-304I19 from chromosome Y, complete
            sequence
          Length = 171934

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 43   tttatgataaaaataataaaatg 65
            |||||||||||||| ||||||||
Sbjct: 7778 tttatgataaaaatgataaaatg 7800



to top

>gb|AC147149.2| Mus musculus BAC clone RP24-248P15 from chromosome Y, complete sequence
          Length = 144382

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 121656 tttatgataaaaatgataaaatg 121634



to top

>gb|AC147150.2| Mus musculus BAC clone RP24-386L15 from chromosome Y, complete sequence
          Length = 171912

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 34574 tttatgataaaaatgataaaatg 34596



to top

>gb|AC145577.2| Mus musculus BAC clone RP24-382J15 from chromosome Y, complete sequence
          Length = 223903

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 208333 tttatgataaaaatgataaaatg 208355



to top

>gb|AC132254.3| Mus musculus BAC clone RP24-469M1 from chromosome Y, complete sequence
          Length = 163018

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 103938 tttatgataaaaatgataaaatg 103916



 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 43   tttatgataaaaataataaaatg 65
            |||||||||||||| ||||||||
Sbjct: 8836 tttatgataaaaatgataaaatg 8814



to top

>gb|AC146633.2| Mus musculus BAC clone RP24-483C21 from chromosome Y, complete sequence
          Length = 172652

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 59614 tttatgataaaaatgataaaatg 59592



to top

>gb|AC140223.3| Mus musculus BAC clone RP24-477G22 from chromosome Y, complete sequence
          Length = 189728

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 163609 tttatgataaaaatgataaaatg 163631



to top

>gb|AC175743.2| Mus musculus BAC clone RP24-44F3 from chromosome y, complete sequence
          Length = 176317

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 71092 tttatgataaaaatgataaaatg 71114



to top

>gb|AC183415.1| Mus musculus BAC clone RP24-121M4 from chromosome y, complete sequence
          Length = 188947

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 53802 tttatgataaaaatgataaaatg 53824



to top

>gb|AC183975.1| Mus musculus BAC clone RP24-352C21 from chromosome y, complete sequence
          Length = 129948

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 69293 tttatgataaaaatgataaaatg 69271



to top

>gb|AC123665.9| Mus musculus chromosome 14, clone RP23-226A4, complete sequence
          Length = 241576

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    aaataataaaatgaaaatc 71
             |||||||||||||||||||
Sbjct: 80489 aaataataaaatgaaaatc 80471



to top

>gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, complete sequence
          Length = 170056

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     atgataaaaataataaaat 64
              |||||||||||||||||||
Sbjct: 110231 atgataaaaataataaaat 110249



to top

>gb|AC115911.14| Mus musculus chromosome 6, clone RP24-481I20, complete sequence
          Length = 168641

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 59     taaaatgaaaatcataaat 77
              |||||||||||||||||||
Sbjct: 105535 taaaatgaaaatcataaat 105517



to top

>gb|AC115607.2| Dictyostelium discoideum chromosome 2 map 4559693-4624405 strain AX4,
             complete sequence
          Length = 64707

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 51    aaaaataataaaatgaaaatcataaat 77
             ||||| |||||||| ||||||||||||
Sbjct: 15002 aaaaaaaataaaataaaaatcataaat 14976



to top

>gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124-6045772 strain AX4,
             complete sequence
          Length = 183648

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    aaaaataataaaatgaaaa 69
             |||||||||||||||||||
Sbjct: 35956 aaaaataataaaatgaaaa 35938



to top

>gb|AC140920.4| Mus musculus BAC clone RP24-498A2 from chromosome Y, complete sequence
          Length = 164438

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 92025 tttatgataaaaatgataaaatg 92003



to top

>gb|AC140255.4| Mus musculus BAC clone RP24-291E19 from chromosome Y, complete sequence
          Length = 187268

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 64841 tttatgataaaaatgataaaatg 64819



to top

>gb|AC140258.4| Mus musculus BAC clone RP24-295F23 from chromosome Y, complete sequence
          Length = 176758

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 165249 tttatgataaaaatgataaaatg 165271



to top

>gb|AC132283.4| Mus musculus BAC clone RP24-351L16 from chromosome Y, complete sequence
          Length = 165828

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 98632 tttatgataaaaatgataaaatg 98610



to top

>gb|AC144647.3| Mus musculus BAC clone RP24-369F17 from chromosome Y, complete sequence
          Length = 199733

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 185727 tttatgataaaaatgataaaatg 185749



to top

>gb|AC140423.2| Mus musculus BAC clone RP24-446B23 from chromosome Y, complete sequence
          Length = 203358

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 156887 tttatgataaaaatgataaaatg 156865



to top

>gb|AC139297.4| Mus musculus BAC clone RP24-62H18 from chromosome Y, complete sequence
          Length = 206783

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 135348 tttatgataaaaatgataaaatg 135326



to top

>gb|AC134579.5| Mus musculus BAC clone RP24-82I10 from chromosome Y, complete sequence
          Length = 233924

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 215426 tttatgataaaaatgataaaatg 215404



to top

>gb|AC129191.4| Mus musculus BAC clone RP24-81F10 from chromosome Y, complete sequence
          Length = 241616

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 17385 tttatgataaaaatgataaaatg 17407



to top

>gb|AC140382.3| Mus musculus BAC clone RP24-86A10 from chromosome Y, complete sequence
          Length = 193056

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 90433 tttatgataaaaatgataaaatg 90411



to top

>gb|AC145292.2| Mus musculus BAC clone RP24-84H20 from chromosome Y, complete sequence
          Length = 203944

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 189928 tttatgataaaaatgataaaatg 189950



to top

>gb|AC147709.1| Mus musculus BAC clone RP24-97E15 from chromosome Y, complete sequence
          Length = 197983

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 95084 tttatgataaaaatgataaaatg 95062



to top

>gb|AC130833.3| Mus musculus BAC clone RP24-91H16 from chromosome Y, complete sequence
          Length = 208378

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 203255 tttatgataaaaatgataaaatg 203233



to top

>gb|AC147113.2| Mus musculus BAC clone RP24-120I13 from chromosome Y, complete sequence
          Length = 196099

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 57292 tttatgataaaaatgataaaatg 57314



to top

>gb|AC133178.3| Mus musculus BAC clone RP24-123P23 from chromosome Y, complete sequence
          Length = 158872

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 85019 tttatgataaaaatgataaaatg 85041



to top

>gb|AC140493.3| Mus musculus BAC clone RP24-137I9 from chromosome Y, complete sequence
          Length = 150186

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 73532 tttatgataaaaatgataaaatg 73510



to top

>gb|AC130836.4| Mus musculus BAC clone RP24-147P10 from chromosome Y, complete sequence
          Length = 199089

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 56669 tttatgataaaaatgataaaatg 56691



to top

>gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosome Y, complete sequence
          Length = 163892

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 100055 tttatgataaaaatgataaaatg 100033



to top

>gb|AC140390.1| Mus musculus BAC clone RP24-207C7 from chromosome Y, complete sequence
          Length = 121757

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 44169 tttatgataaaaatgataaaatg 44147



to top

>gb|AC134852.4| Mus musculus BAC clone RP24-248B6 from chromosome Y, complete sequence
          Length = 186637

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 123492 tttatgataaaaatgataaaatg 123514



to top

>gb|AC136452.4| Mus musculus BAC clone RP24-274L23 from chromosome Y, complete sequence
          Length = 155057

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 83958 tttatgataaaaatgataaaatg 83936



to top

>gb|AC147166.2| Mus musculus BAC clone RP24-277F21 from chromosome Y, complete
            sequence
          Length = 130964

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 43   tttatgataaaaataataaaatg 65
            |||||||||||||| ||||||||
Sbjct: 5320 tttatgataaaaatgataaaatg 5342



to top

>gb|AC140473.3| Mus musculus BAC clone RP24-405H7 from chromosome Y, complete sequence
          Length = 133519

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 43    tttatgataaaaataataaaatg 65
             |||||||||||||| ||||||||
Sbjct: 77654 tttatgataaaaatgataaaatg 77632



to top

>gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosome Y, complete sequence
          Length = 189490

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 144893 tttatgataaaaatgataaaatg 144915



to top

>gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome Y, complete sequence
          Length = 162132

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 137444 tttatgataaaaatgataaaatg 137422



to top

>gb|AC136638.4| Mus musculus BAC clone RP24-369F2 from chromosome Y, complete sequence
          Length = 165290

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 152601 tttatgataaaaatgataaaatg 152579



to top

>gb|AC135808.4| Mus musculus BAC clone RP24-316N5 from chromosome Y, complete sequence
          Length = 149744

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 145539 tttatgataaaaatgataaaatg 145517



to top

>gb|AC144851.3| Mus musculus BAC clone RP24-329H15 from chromosome Y, complete
            sequence
          Length = 171646

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 43   tttatgataaaaataataaaatg 65
            |||||||||||||| ||||||||
Sbjct: 5559 tttatgataaaaatgataaaatg 5537



to top

>gb|AC147156.2| Mus musculus BAC clone RP24-343M19 from chromosome Y, complete sequence
          Length = 214399

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 43     tttatgataaaaataataaaatg 65
              |||||||||||||| ||||||||
Sbjct: 137355 tttatgataaaaatgataaaatg 137333


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,122,853
Number of Sequences: 3902068
Number of extensions: 2122853
Number of successful extensions: 277379
Number of sequences better than 10.0: 539
Number of HSP's better than 10.0 without gapping: 539
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 272839
Number of HSP's gapped (non-prelim): 4534
length of query: 77
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 56
effective length of database: 17,151,101,840
effective search space: 960461703040
effective search space used: 960461703040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top