ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet60g11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 107 bits (54), Expect = 1e-20 Identities = 60/62 (96%) Strand = Plus / Minus Query: 135 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| Sbjct: 867 agcttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtc 808 Query: 195 gg 196 || Sbjct: 807 gg 806 Score = 69.9 bits (35), Expect = 3e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 3 agtctcacaatagtcttttgcattcaaccctcgtactttacatcatg 49 ||||| |||| |||||||||||||||||| ||||||||||||||||| Sbjct: 1016 agtctaacaacagtcttttgcattcaaccttcgtactttacatcatg 970 Score = 40.1 bits (20), Expect = 2.5 Identities = 42/49 (85%), Gaps = 4/49 (8%) Strand = Plus / Minus Query: 71 gcacacttcatcgcgtacgt----acgtgcactgtcggtttctagacac 115 |||||||| ||||||||||| |||||||| ||||||||| |||||| Sbjct: 926 gcacacttgatcgcgtacgtacgcacgtgcacggtcggtttccagacac 878
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 91.7 bits (46), Expect = 8e-16 Identities = 55/58 (94%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggc 751
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 91.7 bits (46), Expect = 8e-16 Identities = 55/58 (94%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 781
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 91.7 bits (46), Expect = 8e-16 Identities = 55/58 (94%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggc 1136
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 89.7 bits (45), Expect = 3e-15 Identities = 57/61 (93%) Strand = Plus / Minus Query: 137 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 196 ||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||| Sbjct: 811 cttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 752 Query: 197 c 197 | Sbjct: 751 c 751
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 87.7 bits (44), Expect = 1e-14 Identities = 53/56 (94%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||| || |||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggc 812
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 85.7 bits (43), Expect = 5e-14 Identities = 55/59 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggca 1750
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 85.7 bits (43), Expect = 5e-14 Identities = 55/59 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||| Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggca 802
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 85.7 bits (43), Expect = 5e-14 Identities = 55/59 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggca 1750
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 739
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 727
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 1188
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 13935
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 30025076 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 23604270
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 21066
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 66969
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 798
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 797
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 1227
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 820
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 820
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 822
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggc 327
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 805
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 83.8 bits (42), Expect = 2e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggc 822
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 79.8 bits (40), Expect = 3e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 138 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||||| || |||||||||||||||||||| || |||||||| ||||||||||| Sbjct: 975 ttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggc 916
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 752
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| |||||||||||||| || ||||| || |||||||||||||||||||| Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggc 413
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 93262 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 96055
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 80940 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 78147
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 10793723
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 110
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 771
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 88 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 145
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 17446
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 130341
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||||||||||| |||||||||||||| |||||||| Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 1039
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 791
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 798
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 796
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||||||||||| ||||||||| |||||||||||| Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggc 1475
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 75.8 bits (38), Expect = 5e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggc 777
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 73.8 bits (37), Expect = 2e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 154 aagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||||||||||||||| |||||||||||||||||||| Sbjct: 693 aagttggtggcgaaggcccaggcgttgttgttgacggggtc 653
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 73.8 bits (37), Expect = 2e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 138 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||| || || ||||||||||||||| ||||||| |||||||||||||| |||||||| Sbjct: 851 ttactttccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792 Query: 198 a 198 | Sbjct: 791 a 791
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 73.8 bits (37), Expect = 2e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 196 |||||||||| || |||||||||||| | ||||| |||||||||||||||||||||| Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcgg 2663
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 71.9 bits (36), Expect = 7e-10 Identities = 54/60 (90%) Strand = Plus / Minus Query: 135 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||| |||||||| || |||||||||||| ||||||| |||||||||||||| ||||| Sbjct: 1683 agcttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtc 1624
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 69.9 bits (35), Expect = 3e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 215 actttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtc 161 Score = 61.9 bits (31), Expect = 7e-07 Identities = 49/55 (89%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| |||||||||||||| ||||||||||| || ||||| Sbjct: 8573 actttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtc 8627
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 69.9 bits (35), Expect = 3e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||| ||||| || |||||||||||||||||||| ||||||||||| || ||||||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggca 770
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 69.9 bits (35), Expect = 3e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||| ||||| |||||||||||||| ||||||| |||||||||||||| ||||||||| Sbjct: 850 actttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggca 792
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 69.9 bits (35), Expect = 3e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||||| || |||||||||||||||||||| || ||||||||||| ||||| Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtc 772
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 585
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 757
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||| Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 745
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||| Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 791
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 823
>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZE02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 307 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 127
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 792
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 703
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||| Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 22483 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 19837 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 16158
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 67.9 bits (34), Expect = 1e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| ||||||||||||||||||||||| ||||||||||| Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgtt 974
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| ||||||||||| ||||||||||| |||||||||||||| || ||||| Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 951
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 67.9 bits (34), Expect = 1e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 890
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 65.9 bits (33), Expect = 4e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||||||||||||||| |||||||||||||| Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 582
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 65.9 bits (33), Expect = 4e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||||||||||||||| |||||||||||||| Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2326
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 65.9 bits (33), Expect = 4e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||| || |||||||||||| ||||||| ||||||||||| |||||||| Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 808
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 65.9 bits (33), Expect = 4e-08 Identities = 39/41 (95%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||||||||||| |||||||||||||| |||||||| Sbjct: 814 ttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 65.9 bits (33), Expect = 4e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||||||||||||||| |||||||||||||| Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2327
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 65.9 bits (33), Expect = 4e-08 Identities = 54/61 (88%) Strand = Plus / Minus Query: 137 cttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 196 |||| |||||||| || ||||| ||||| || ||||| |||||||||||||||||||||| Sbjct: 820 cttatttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcgg 761 Query: 197 c 197 | Sbjct: 760 c 760
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 65.9 bits (33), Expect = 4e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 ||||| || ||||||||||||||| ||||||| |||||||||||||| ||||| Sbjct: 834 ttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtc 782
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 65.9 bits (33), Expect = 4e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||| || |||||||||||| ||||||| ||||||||||| |||||||| Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 817
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 65.9 bits (33), Expect = 4e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||| || |||||||||||| | ||||| ||||||||||||||||||||||| Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggc 337
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 61.9 bits (31), Expect = 7e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||||||||| || ||||| |||||||||||||| ||||| Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtc 797
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 61.9 bits (31), Expect = 7e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| || |||||||||||| ||||||| |||||||||||||| ||||| Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtc 794
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 61.9 bits (31), Expect = 7e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtc 975
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 61.9 bits (31), Expect = 7e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| || |||||||| ||||||||||| |||||||||||||| ||||| Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 61.9 bits (31), Expect = 7e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| ||||||||||| |||||||| |||||||| Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtc 133
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 61.9 bits (31), Expect = 7e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||||| || |||||||||||| ||||||| || ||||||||||| ||||| Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtc 767
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end Length = 351 Score = 61.9 bits (31), Expect = 7e-07 Identities = 52/59 (88%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||| ||||| |||||||| ||||| |||||||| ||||||||||| || ||||||||| Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggca 291
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||| |||||||||||| Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 79031
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||| |||||||||||| Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 21808785
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||| |||||||||||| Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 21801814
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 60.0 bits (30), Expect = 3e-06 Identities = 52/58 (89%), Gaps = 1/58 (1%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcggc 783
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||| ||||| || |||||||||||| ||||||| |||||||||| ||| |||||||| Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggc 781
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||| |||||||||||| Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 784
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||| |||||||||||| Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 359
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| || |||||||||||| | ||||| ||||||||| |||||||||||| Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggc 773
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 60.0 bits (30), Expect = 3e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||||| ||||| ||||||||| | ||||| ||||||||| |||||||||||| Sbjct: 837 acttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggc 780
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 60.0 bits (30), Expect = 3e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 ||||| |||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtc 742
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 60.0 bits (30), Expect = 3e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||||||| ||||||||||| | | |||||||||||||||||| ||||||||| Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggca 941
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 58.0 bits (29), Expect = 1e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||| || |||||||||||| ||||||| || |||||||| ||||||||||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggc 840
>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein Length = 1656 Score = 58.0 bits (29), Expect = 1e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 138 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||| ||||| |||||||| ||||| ||||||| ||||||||||| |||||||| Sbjct: 1305 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 1249
>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3102 Score = 58.0 bits (29), Expect = 1e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 138 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||| ||||| |||||||| ||||| ||||||| ||||||||||| |||||||| Sbjct: 2708 ttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 2652
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 56.0 bits (28), Expect = 4e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||| || ||||||||||| ||||||| ||||||||| | ||||||||||| Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 829
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 56.0 bits (28), Expect = 4e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||| || ||||||||||| ||||||| ||||||||| | ||||||||||| Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 1907
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 56.0 bits (28), Expect = 4e-05 Identities = 40/44 (90%) Strand = Plus / Minus Query: 154 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||||| ||||||| ||||||||||| ||||||||||| Sbjct: 273 aagttggtggcataggcccaggcgttgttgttaacggggtcggc 230
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 56.0 bits (28), Expect = 4e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 135 agcttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| |||| ||||| |||||||| ||||| |||||||| ||||||||||| || ||||| Sbjct: 842 agctcactttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783
>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 907 Score = 54.0 bits (27), Expect = 2e-04 Identities = 52/59 (88%), Gaps = 1/59 (1%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggccc-acgcgttgttgttgacggggtcggc 197 |||| ||||| ||||||||||| |||||||||| | |||||||||||||| || ||||| Sbjct: 53 actttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||||||||| ||||||| || ||||||||||| ||||| Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtc 759
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 54.0 bits (27), Expect = 2e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 152 caaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 ||||||| |||||||||||||| || |||||||| || ||||||||| Sbjct: 802 caaagtttgtggcgaaggcccaagcattgttgttaactgggtcggca 756
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| |||||||| ||||||||||| || ||||| Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtc 295
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||||||||| ||||||| || ||||||||||| ||||| Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtc 936
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 52.0 bits (26), Expect = 7e-04 Identities = 44/50 (88%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 ||||| |||||||| |||||||||||||| || ||||| ||||| ||||| Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtc 950
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 50.1 bits (25), Expect = 0.003 Identities = 40/45 (88%) Strand = Plus / Minus Query: 154 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 ||||||||||| || ||||| || |||||||||||||| |||||| Sbjct: 658 aagttggtggcaaacgcccaggcattgttgttgacgggatcggca 614
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || ||||||||||| |||||||| || ||||||||||| Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 819
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 471
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 813
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 50.1 bits (25), Expect = 0.003 Identities = 46/53 (86%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||| || |||||||||||| ||||||| ||||||||| ||||||||||| Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggc 2965
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 1051
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 50.1 bits (25), Expect = 0.003 Identities = 37/41 (90%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| ||||||| || |||||||| ||||||||||| Sbjct: 873 ttggtggcgtaggcccaggcattgttgttcacggggtcggc 833
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || ||||||||||| ||||||| |||||||||||||| Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgac 992
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 50.1 bits (25), Expect = 0.003 Identities = 43/49 (87%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 |||| ||||| || |||||||| ||||||||||| || ||||||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgac 751
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 50.1 bits (25), Expect = 0.003 Identities = 46/53 (86%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||| || |||||||||||| | ||||| ||||||||| ||||||||| Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtc 522
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 50.1 bits (25), Expect = 0.003 Identities = 46/53 (86%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||| || |||||||||||| ||||||| ||||||||| ||||||||||| Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggc 787
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 50.1 bits (25), Expect = 0.003 Identities = 49/57 (85%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 196 |||||||||| || |||||||||||| | | ||| ||||||||| ||||||||||| Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcgg 766
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 48.1 bits (24), Expect = 0.010 Identities = 39/44 (88%) Strand = Plus / Minus Query: 151 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 ||||| || ||||| ||||||||||| |||||||| |||||||| Sbjct: 909 acaaaatttgtggcaaaggcccacgcattgttgttaacggggtc 866
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 48.1 bits (24), Expect = 0.010 Identities = 48/56 (85%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||| || ||||| |||||| | ||||| ||||||||| |||||||||||| Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggc 769
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence Length = 770 Score = 48.1 bits (24), Expect = 0.010 Identities = 48/56 (85%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 |||||||| || ||||| |||||| | ||||| ||||||||| |||||||||||| Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggc 417
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 48.1 bits (24), Expect = 0.010 Identities = 42/48 (87%) Strand = Plus / Minus Query: 138 ttacttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||||| ||||| |||||||||||||| ||||||| || |||||||| Sbjct: 824 ttactttccggggacaaagttggtggcataggcccatgcattgttgtt 777
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 48.1 bits (24), Expect = 0.010 Identities = 39/44 (88%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgac 188 ||||| |||||||| ||||| |||||||| || ||||||||||| Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgac 748
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein Length = 964 Score = 46.1 bits (23), Expect = 0.040 Identities = 47/55 (85%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| ||||||||||||||| ||| ||| || |||||||| || ||||| Sbjct: 869 actttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtc 815
>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10, 3' end and flank Length = 367 Score = 46.1 bits (23), Expect = 0.040 Identities = 50/59 (84%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||| ||||| |||||||| |||||| ||| ||| ||||||||||| || || |||||| Sbjct: 229 actttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggca 171
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1011 Score = 46.1 bits (23), Expect = 0.040 Identities = 47/55 (85%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||||| ||||||| || ||||||||||| || |||||||| || ||||| Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtc 804
>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end Length = 351 Score = 46.1 bits (23), Expect = 0.040 Identities = 47/55 (85%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| || ||||| ||||||||||| || ||||| Sbjct: 349 actttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtc 295
>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end Length = 351 Score = 46.1 bits (23), Expect = 0.040 Identities = 47/55 (85%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| || ||||| ||||||||||| || ||||| Sbjct: 349 actttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtc 295
>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding protein mRNA, partial cds Length = 191 Score = 46.1 bits (23), Expect = 0.040 Identities = 47/55 (85%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 196 |||||||| || ||||| |||||| | ||||| ||||||||| ||||||||||| Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcgg 52
>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll a/b-binding protein of photosystem II, complete cds Length = 935 Score = 46.1 bits (23), Expect = 0.040 Identities = 47/55 (85%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| | ||||| |||||||||||||| ||||| Sbjct: 810 acttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtc 756
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 46.1 bits (23), Expect = 0.040 Identities = 47/55 (85%) Strand = Plus / Plus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| ||||||| ||||||||||| || ||||| Sbjct: 1872 actttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtc 1926
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 44.1 bits (22), Expect = 0.16 Identities = 37/42 (88%) Strand = Plus / Minus Query: 142 ttgccgggcacaaagttggtggcgaaggcccacgcgttgttg 183 |||||||| || |||||||||||| | ||||| ||||||||| Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807
>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I Length = 2432 Score = 44.1 bits (22), Expect = 0.16 Identities = 40/46 (86%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| |||||||| ||||| || ||||| ||||||||||| Sbjct: 1702 actttccgggaacaaagtttgtggcaaaagcccatgcgttgttgtt 1657
>gb|AY104614.1| Zea mays PCO084486 mRNA sequence Length = 1214 Score = 44.1 bits (22), Expect = 0.16 Identities = 22/22 (100%) Strand = Plus / Minus Query: 176 cgttgttgttgacggggtcggc 197 |||||||||||||||||||||| Sbjct: 955 cgttgttgttgacggggtcggc 934
>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein Length = 686 Score = 44.1 bits (22), Expect = 0.16 Identities = 40/46 (86%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgtt 185 |||| ||||| |||||||||||||| ||||||| || |||||||| Sbjct: 580 actttccggggacaaagttggtggcataggcccatgcattgttgtt 535
>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B (ftrbpot gene) Length = 701 Score = 44.1 bits (22), Expect = 0.16 Identities = 44/50 (88%), Gaps = 1/50 (2%) Strand = Plus / Plus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 ||||| |||||||| |||||||| ||| | ||||||||||| |||||||| Sbjct: 6 ccggggacaaagtttgtggcgaaagccaa-gcgttgttgttaacggggtc 54
>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds Length = 351 Score = 44.1 bits (22), Expect = 0.16 Identities = 43/50 (86%) Strand = Plus / Minus Query: 145 ccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 ||||| |||||||| |||||| ||| ||| ||||||||||| || ||||| Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtc 295
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 776
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 802
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 807
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 840
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 42.1 bits (21), Expect = 0.63 Identities = 27/29 (93%) Strand = Plus / Minus Query: 166 aaggcccacgcgttgttgttgacggggtc 194 |||||||| ||||||||||| |||||||| Sbjct: 662 aaggcccaagcgttgttgttaacggggtc 634
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 22434813
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 95880
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 776
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 800
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 805
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 801
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 42.1 bits (21), Expect = 0.63 Identities = 36/41 (87%) Strand = Plus / Minus Query: 157 ttggtggcgaaggcccacgcgttgttgttgacggggtcggc 197 ||||||||| || |||| ||||||||| |||||||||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggc 807
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 42.1 bits (21), Expect = 0.63 Identities = 24/25 (96%) Strand = Plus / Minus Query: 174 cgcgttgttgttgacggggtcggca 198 ||||||||||||||| ||||||||| Sbjct: 760 cgcgttgttgttgacagggtcggca 736
>dbj|AP004410.1| Lamprogrammus niger mitochondrial DNA, complete genome Length = 16564 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 accctcgtactttacatcat 48 |||||||||||||||||||| Sbjct: 7272 accctcgtactttacatcat 7291
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 40.1 bits (20), Expect = 2.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 151 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||||||||| ||||||| || |||||||| || ||||| Sbjct: 65572 acaaagttggtggcataggcccaggcattgttgttaactgggtc 65615
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 40.1 bits (20), Expect = 2.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 167 aggcccacgcgttgttgttgacggggtcggca 198 ||||||| ||||||||||| || ||||||||| Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggca 2194
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7965 Score = 40.1 bits (20), Expect = 2.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 151 acaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||||||| |||||| ||| ||| ||||||||||| || ||||| Sbjct: 2666 acaaagtttgtggcgtaggaccaggcgttgttgttaactgggtc 2623
>gb|AC122528.3| Mus musculus BAC clone RP24-506F15 from chromosome 9, complete sequence Length = 142071 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 116 tagtggtgacaacacacgt 134 ||||||||||||||||||| Sbjct: 37868 tagtggtgacaacacacgt 37886
>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence Length = 3281944 Score = 38.2 bits (19), Expect = 9.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 150 cacaaagttggtggcgaaggccc 172 |||||| |||||||||||||||| Sbjct: 1555500 cacaaatttggtggcgaaggccc 1555522
>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence Length = 3354505 Score = 38.2 bits (19), Expect = 9.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 150 cacaaagttggtggcgaaggccc 172 |||||| |||||||||||||||| Sbjct: 2872862 cacaaatttggtggcgaaggccc 2872840
>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, complete cds; nuclear gene for chloroplast product Length = 941 Score = 38.2 bits (19), Expect = 9.8 Identities = 46/55 (83%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| | ||||| || ||||||||||| ||||| Sbjct: 848 actttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtc 794
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R Length = 1173 Score = 38.2 bits (19), Expect = 9.8 Identities = 49/59 (83%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||| ||||| |||||||| || ||| | | ||| ||||||||||| || ||||||||| Sbjct: 1032 actttccggggacaaagttagttgcgtaagaccatgcgttgttgttaactgggtcggca 974
>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA Length = 1152 Score = 38.2 bits (19), Expect = 9.8 Identities = 37/43 (86%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgtt 182 |||| ||||| ||||||||||||||| | ||||| || ||||| Sbjct: 962 actttccgggaacaaagttggtggcgtaagcccaggcattgtt 920
>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA Length = 699 Score = 38.2 bits (19), Expect = 9.8 Identities = 46/55 (83%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| ||||||||||| || ||||||| || |||||||| || ||||| Sbjct: 559 actttccgggtacaaagttggtagcataggcccaagcattgttgttaaccgggtc 505
>gb|AF126284.1|AF126284 Aura virus polyprotein 1 and polyprotein 2 genes, complete cds Length = 11824 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 acgtgcactgtcggtttct 109 ||||||||||||||||||| Sbjct: 100 acgtgcactgtcggtttct 82
>emb|AL355097.5|CNS05TCG Human chromosome 14 DNA sequence BAC R-204N11 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 164686 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 aagtctcacaatagtcttt 20 ||||||||||||||||||| Sbjct: 100309 aagtctcacaatagtcttt 100291
>gb|AC122515.5| Mus musculus BAC clone RP24-455N18 from 9, complete sequence Length = 164271 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 116 tagtggtgacaacacacgt 134 ||||||||||||||||||| Sbjct: 150468 tagtggtgacaacacacgt 150486
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 38.2 bits (19), Expect = 9.8 Identities = 46/55 (83%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||||||||| ||| ||| || |||||||| || ||||| Sbjct: 851 actttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtc 797
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 38.2 bits (19), Expect = 9.8 Identities = 46/55 (83%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| | ||||| || ||||||||||| ||||| Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtc 1496
>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide 15) mRNA, clone pAB96 Length = 822 Score = 38.2 bits (19), Expect = 9.8 Identities = 49/59 (83%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtcggca 198 |||| ||||| ||||||||||| || | | ||| ||||||||||| || ||||||||| Sbjct: 686 actttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggca 628
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 748 Score = 38.2 bits (19), Expect = 9.8 Identities = 46/55 (83%) Strand = Plus / Minus Query: 140 acttgccgggcacaaagttggtggcgaaggcccacgcgttgttgttgacggggtc 194 |||| ||||| |||||||| ||||| | ||||| || ||||||||||| ||||| Sbjct: 621 actttccgggaacaaagtttgtggcatatgcccaagcattgttgttgactgggtc 567 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,242,342 Number of Sequences: 3902068 Number of extensions: 1242342 Number of successful extensions: 63211 Number of sequences better than 10.0: 210 Number of HSP's better than 10.0 without gapping: 210 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 62742 Number of HSP's gapped (non-prelim): 468 length of query: 198 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 176 effective length of database: 17,147,199,772 effective search space: 3017907159872 effective search space used: 3017907159872 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
