>ref|XM_310533.2| Anopheles gambiae str. PEST ENSANGP00000017306
           (ENSANGG00000014817), partial mRNA
          Length = 3432

 Score = 42.1 bits (21), Expect = 0.68
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 gtgtcgccgccggcctccgtg 145
           |||||||||||||||||||||
Sbjct: 761 gtgtcgccgccggcctccgtg 741

>emb|X74791.1|SVBCAG S.venezuelae bca gene
          Length = 2216

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 132 cgccggcctccgtggtgagc 151
           ||||||||||||||||||||
Sbjct: 685 cgccggcctccgtggtgagc 666

>emb|X83872.1|HVDNACREB H.vulgaris mRNA for cAMP response element binding protein
          Length = 1483

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 60   atcatcatcatatggtacag 79
            ||||||||||||||||||||
Sbjct: 1282 atcatcatcatatggtacag 1263

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 93      gcagtttaccaaagcaatgc 112
               ||||||||||||||||||||
Sbjct: 1816974 gcagtttaccaaagcaatgc 1816993


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,560,599
Number of Sequences: 3902068
Number of extensions: 1560599
Number of successful extensions: 106823
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 106799
Number of HSP's gapped (non-prelim): 24
length of query: 213
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 191
effective length of database: 17,147,199,772
effective search space: 3275115156452
effective search space used: 3275115156452
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)