| Clone Name | rbaet60c03 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_573584.1| PREDICTED: Rattus norvegicus similar to signal recognition particle,72 kDa subunit (LOC498351), mRNA Length = 1886 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 2 agaggtacaataagtaccag 21 |||||||||||||||||||| Sbjct: 866 agaggtacaataagtaccag 847
>gb|U14913.2|YSCH8167 Saccharomyces cerevisiae chromosome XII cosmid 8167 Length = 38870 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 47 tgctaaactatacatcaaa 65 ||||||||||||||||||| Sbjct: 1472 tgctaaactatacatcaaa 1454
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence Length = 2580084 Score = 38.2 bits (19), Expect = 9.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 174 aatatagggcaaagcacaactgt 196 |||| |||||||||||||||||| Sbjct: 8027 aatacagggcaaagcacaactgt 8049
>emb|CR381596.11| Zebrafish DNA sequence from clone DKEY-230M3 in linkage group 3, complete sequence Length = 157536 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 30 ttgcatcatcatcaacgtg 48 ||||||||||||||||||| Sbjct: 146073 ttgcatcatcatcaacgtg 146055
>ref|XM_763686.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_59_40657_37226) partial mRNA Length = 3432 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 119 aataggtaccaaacaaggg 137 ||||||||||||||||||| Sbjct: 186 aataggtaccaaacaaggg 168
>emb|AL157394.15| Human DNA sequence from clone RP11-399O19 on chromosome 10 Contains the 5' end of a novel gene (MGC22805), a novel pseudogene (FLJ12598), the gene for a novel Mov34/MPN/PAD-1 family domain containing protein (KIAA1373 FLJ35627 FLJ33359), a novel gene (FLJ36021), the ACTA2 gene for actin alpha 2 smooth muscle aorta, the TNFRSF6 gene for tumor necrosis factor receptor superfamily member 6 and two CpG islands, complete sequence Length = 187313 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 129 aaacaagggaaatgtatat 147 ||||||||||||||||||| Sbjct: 63441 aaacaagggaaatgtatat 63423
>emb|BX927156.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete genome; segment 9/10 Length = 349115 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 74 tccgtacaagctggcgata 92 ||||||||||||||||||| Sbjct: 79488 tccgtacaagctggcgata 79506
>gb|AC127346.4| Mus musculus BAC clone RP23-54F4 from chromosome 6, complete sequence Length = 203187 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 163 caagataccataatatagg 181 ||||||||||||||||||| Sbjct: 89835 caagataccataatatagg 89817
>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome Length = 3309401 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 74 tccgtacaagctggcgata 92 ||||||||||||||||||| Sbjct: 2899767 tccgtacaagctggcgata 2899785
>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome Length = 4969803 Score = 38.2 bits (19), Expect = 9.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 147 tagcgatgctagggtgcaagata 169 ||||||||||| ||||||||||| Sbjct: 3515490 tagcgatgctatggtgcaagata 3515468
>emb|AL929582.10| Zebrafish DNA sequence from clone CH211-117M12, complete sequence Length = 175577 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 107 ccatcaaaacacaataggt 125 ||||||||||||||||||| Sbjct: 123595 ccatcaaaacacaataggt 123613
>emb|AL806513.5| Mouse DNA sequence from clone RP23-480E16 on chromosome 4, complete sequence Length = 189780 Score = 38.2 bits (19), Expect = 9.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 13 aagtaccagtctgtttatt 31 ||||||||||||||||||| Sbjct: 18877 aagtaccagtctgtttatt 18859 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,594,382 Number of Sequences: 3902068 Number of extensions: 1594382 Number of successful extensions: 95555 Number of sequences better than 10.0: 12 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95463 Number of HSP's gapped (non-prelim): 92 length of query: 197 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 175 effective length of database: 17,147,199,772 effective search space: 3000759960100 effective search space used: 3000759960100 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)