ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet59d11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY612193.1| Hordeum vulgare beta-1,3-glucanase 2a mRNA, compl... 412 e-112
2gb|AF112967.1| Triticum aestivum beta-1,3-glucanase precursor (G... 66 5e-08
3gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9} [Zea mays=... 46 0.045
4gb|AY111675.1| Zea mays CL1243_1 mRNA sequence 46 0.045
5gb|DQ147119.1| Zea diploperennis isolate d8 pathogenesis-related... 46 0.045
6gb|DQ147118.1| Zea diploperennis isolate d7 pathogenesis-related... 46 0.045
7gb|DQ147116.1| Zea diploperennis isolate d5 pathogenesis-related... 46 0.045
8gb|DQ147115.1| Zea diploperennis isolate d4 pathogenesis-related... 46 0.045
9gb|DQ147114.1| Zea diploperennis isolate d3 pathogenesis-related... 46 0.045
10gb|DQ147113.1| Zea diploperennis isolate d2 pathogenesis-related... 46 0.045
11gb|DQ147112.1| Zea diploperennis isolate d1 pathogenesis-related... 46 0.045
12gb|DQ147111.1| Zea mays subsp. parviglumis isolate p15 pathogene... 46 0.045
13gb|DQ147110.1| Zea mays subsp. parviglumis isolate p14 pathogene... 46 0.045
14gb|DQ147109.1| Zea mays subsp. parviglumis isolate p13 pathogene... 46 0.045
15gb|DQ147108.1| Zea mays subsp. parviglumis isolate p12 pathogene... 46 0.045
16gb|DQ147107.1| Zea mays subsp. parviglumis isolate p11 pathogene... 46 0.045
17gb|DQ147105.1| Zea mays subsp. parviglumis isolate p9 pathogenes... 46 0.045
18gb|DQ147104.1| Zea mays subsp. parviglumis isolate p8 pathogenes... 46 0.045
19gb|DQ147103.1| Zea mays subsp. parviglumis isolate p6 pathogenes... 46 0.045
20gb|DQ147102.1| Zea mays subsp. parviglumis isolate p5 pathogenes... 46 0.045
21gb|DQ147101.1| Zea mays subsp. parviglumis isolate p4 pathogenes... 46 0.045
22gb|DQ147099.1| Zea mays subsp. parviglumis isolate p2 pathogenes... 46 0.045
23gb|DQ147098.1| Zea mays subsp. parviglumis isolate p1 pathogenes... 46 0.045
24emb|AL669937.11| Mouse DNA sequence from clone DN-358O3 on chrom... 42 0.71
25gb|AC087350.3| Homo sapiens chromosome 8, clone RP11-367C15, com... 42 0.71
26gb|AC104391.5| Homo sapiens chromosome 8, clone CTD-3071K10, com... 42 0.71
27emb|AL669872.8| Mouse DNA sequence from clone RP23-357D5 on chro... 42 0.71
28dbj|AP004074.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 0.71
29gb|AC118681.6| Mus musculus chromosome 16, clone RP23-473M11, co... 40 2.8
30gb|AC093479.13| Mus musculus chromosome 16, clone RP23-61K2, com... 40 2.8
31gb|AC005547.1|AC005547 Homo sapiens chromosome 19, cosmid R29228... 40 2.8
32gb|AC122293.3| Mus musculus BAC clone RP23-257O9 from 10, comple... 40 2.8
33dbj|AP006689.1| Lotus japonicus genomic DNA, chromosome 4, clone... 40 2.8

>gb|AY612193.1| Hordeum vulgare beta-1,3-glucanase 2a mRNA, complete cds
          Length = 1249

 Score =  412 bits (208), Expect = e-112
 Identities = 211/212 (99%)
 Strand = Plus / Minus

                                                                        
Query: 9    taatttgtctccattaaatagtttgagcttcttcaccatccatgcaaagcatgatgttcg 68
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1240 taatttgtctccattaaatagtttgagcttcttcaccatccatgcaaagcatgatgttcg 1181

                                                                        
Query: 69   cattctacagtatagagacaacttattcaagcccagttgaggacattaactataataagc 128
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1180 cattctacagtatagagacaacttattcaagcccagttgaggacattaactataataagc 1121

                                                                        
Query: 129  aagctaatgttgattatcttgctatatgtaaatgtaacgtatgaacgtatcgatgtgccc 188
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1120 aagctaatgttgattatcttgctatatgtaaatgtaacgtatgaacgtatcgatgtgccc 1061

                                            
Query: 189  ggtctagaaactgatggggtacgccggcgatt 220
            ||||||||||||||||||||| ||||||||||
Sbjct: 1060 ggtctagaaactgatggggtaggccggcgatt 1029



to top

>gb|AF112967.1| Triticum aestivum beta-1,3-glucanase precursor (Glb3) mRNA, complete
            cds
          Length = 1439

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                 
Query: 44   ccatccatgcaaagcatgatgttcgcattctacagta 80
            ||||||||||||||||||||| |||||||||||||||
Sbjct: 1225 ccatccatgcaaagcatgatgctcgcattctacagta 1189



 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                        
Query: 193  tagaaactgatggggtacgccggcgatt 220
            ||||||||||||||||||||||||||||
Sbjct: 1079 tagaaactgatggggtacgccggcgatt 1052



to top

>gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9} [Zea mays=maize, cv. INRA
            258, mercuric chloride-treated, leaves, mRNA Partial,
            1243 nt]
          Length = 1243

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1054 agaaattgatggggtacgccggcgatt 1028



to top

>gb|AY111675.1| Zea mays CL1243_1 mRNA sequence
          Length = 1272

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1075 agaaattgatggggtacgccggcgatt 1049



to top

>gb|DQ147119.1| Zea diploperennis isolate d8 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1178

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1134 agaaattgatggggtacgccggcgatt 1108



to top

>gb|DQ147118.1| Zea diploperennis isolate d7 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1137 agaaattgatggggtacgccggcgatt 1111



to top

>gb|DQ147116.1| Zea diploperennis isolate d5 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1137 agaaattgatggggtacgccggcgatt 1111



to top

>gb|DQ147115.1| Zea diploperennis isolate d4 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1137 agaaattgatggggtacgccggcgatt 1111



to top

>gb|DQ147114.1| Zea diploperennis isolate d3 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1137 agaaattgatggggtacgccggcgatt 1111



to top

>gb|DQ147113.1| Zea diploperennis isolate d2 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1189

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1145 agaaattgatggggtacgccggcgatt 1119



to top

>gb|DQ147112.1| Zea diploperennis isolate d1 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1137 agaaattgatggggtacgccggcgatt 1111



to top

>gb|DQ147111.1| Zea mays subsp. parviglumis isolate p15 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1138 agaaattgatggggtacgccggcgatt 1112



to top

>gb|DQ147110.1| Zea mays subsp. parviglumis isolate p14 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1137 agaaattgatggggtacgccggcgatt 1111



to top

>gb|DQ147109.1| Zea mays subsp. parviglumis isolate p13 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1137 agaaattgatggggtacgccggcgatt 1111



to top

>gb|DQ147108.1| Zea mays subsp. parviglumis isolate p12 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1185

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1141 agaaattgatggggtacgccggcgatt 1115



to top

>gb|DQ147107.1| Zea mays subsp. parviglumis isolate p11 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1186

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1142 agaaattgatggggtacgccggcgatt 1116



to top

>gb|DQ147105.1| Zea mays subsp. parviglumis isolate p9 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1141 agaaattgatggggtacgccggcgatt 1115



to top

>gb|DQ147104.1| Zea mays subsp. parviglumis isolate p8 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1138 agaaattgatggggtacgccggcgatt 1112



to top

>gb|DQ147103.1| Zea mays subsp. parviglumis isolate p6 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1138 agaaattgatggggtacgccggcgatt 1112



to top

>gb|DQ147102.1| Zea mays subsp. parviglumis isolate p5 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1141 agaaattgatggggtacgccggcgatt 1115



to top

>gb|DQ147101.1| Zea mays subsp. parviglumis isolate p4 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1141 agaaattgatggggtacgccggcgatt 1115



to top

>gb|DQ147099.1| Zea mays subsp. parviglumis isolate p2 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1138 agaaattgatggggtacgccggcgatt 1112



to top

>gb|DQ147098.1| Zea mays subsp. parviglumis isolate p1 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 194  agaaactgatggggtacgccggcgatt 220
            ||||| |||||||||||||||||||||
Sbjct: 1141 agaaattgatggggtacgccggcgatt 1115



to top

>emb|AL669937.11| Mouse DNA sequence from clone DN-358O3 on chromosome 3 Contains the
             Trim45 gene for tripartite motif-containing 45, the Ttf2
             gene for transcription termination factor RNA polymerase
             II, the ortholog of human immunoglobulin superfamily
             member 2 IGSF2 (Gm1016 genemodel 1016 (NCBI)) and the 3'
             end of the Ptgfrn gene for prostaglandin F2 receptor
             negative regulator, complete sequence
          Length = 163674

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 28    agtttgagcttcttcaccatc 48
             |||||||||||||||||||||
Sbjct: 66340 agtttgagcttcttcaccatc 66320



to top

>gb|AC087350.3| Homo sapiens chromosome 8, clone RP11-367C15, complete sequence
          Length = 193364

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 21    attaaatagtttgagcttctt 41
             |||||||||||||||||||||
Sbjct: 67647 attaaatagtttgagcttctt 67667



to top

>gb|AC104391.5| Homo sapiens chromosome 8, clone CTD-3071K10, complete sequence
          Length = 148386

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 21     attaaatagtttgagcttctt 41
              |||||||||||||||||||||
Sbjct: 104400 attaaatagtttgagcttctt 104420



to top

>emb|AL669872.8| Mouse DNA sequence from clone RP23-357D5 on chromosome 3, complete
              sequence
          Length = 199673

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 28     agtttgagcttcttcaccatc 48
              |||||||||||||||||||||
Sbjct: 121003 agtttgagcttcttcaccatc 120983



to top

>dbj|AP004074.1| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1266F9, complete
             sequence
          Length = 156441

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 21    attaaatagtttgagcttctt 41
             |||||||||||||||||||||
Sbjct: 52798 attaaatagtttgagcttctt 52778



to top

>gb|AC118681.6| Mus musculus chromosome 16, clone RP23-473M11, complete sequence
          Length = 279112

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   attctacagtatagagacaa 89
            ||||||||||||||||||||
Sbjct: 3348 attctacagtatagagacaa 3367



to top

>gb|AC093479.13| Mus musculus chromosome 16, clone RP23-61K2, complete sequence
          Length = 243771

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    attctacagtatagagacaa 89
             ||||||||||||||||||||
Sbjct: 56282 attctacagtatagagacaa 56263



to top

>gb|AC005547.1|AC005547 Homo sapiens chromosome 19, cosmid R29228, complete sequence
          Length = 46127

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 147   ttgctatatgtaaatgtaacgtat 170
             ||||||||| ||||||||||||||
Sbjct: 43748 ttgctatatataaatgtaacgtat 43771



to top

>gb|AC122293.3| Mus musculus BAC clone RP23-257O9 from 10, complete sequence
          Length = 209942

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    tttgagcttcttcaccatcc 49
             ||||||||||||||||||||
Sbjct: 62928 tttgagcttcttcaccatcc 62909



to top

>dbj|AP006689.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT27F14, TM0387,
             complete sequence
          Length = 96031

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 146   cttgctatatgtaaatgtaa 165
             ||||||||||||||||||||
Sbjct: 33535 cttgctatatgtaaatgtaa 33554


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,849,497
Number of Sequences: 3902068
Number of extensions: 1849497
Number of successful extensions: 128299
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 128251
Number of HSP's gapped (non-prelim): 48
length of query: 220
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 198
effective length of database: 17,147,199,772
effective search space: 3395145554856
effective search space used: 3395145554856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top