ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet59c12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY736124.1| Triticum aestivum ADP-ribosylation factor mRNA, c... 131 1e-27
2gb|BT016553.1| Zea mays clone Contig386 mRNA sequence 101 1e-18
3gb|BT018602.1| Zea mays clone EL01N0449E02.d mRNA sequence 101 1e-18
4gb|BT017229.1| Zea mays clone EL01N0302G04.c mRNA sequence 101 1e-18
5gb|AY104152.1| Zea mays PCO085488 mRNA sequence 101 1e-18
6ref|XM_470055.1| Oryza sativa (japonica cultivar-group), mRNA 98 2e-17
7emb|X80042.1|ZMADPRF Z.mays mRNA for ADP-ribosylation factor 98 2e-17
8dbj|AK122007.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 2e-17
9dbj|AK105508.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 4e-15
10gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 84 3e-13
11gb|AC137507.3| Oryza sativa chromosome 3 BAC OSJNBb0033J23 genom... 84 3e-13
12dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
13gb|BT017034.1| Zea mays clone EL01N0202C08.c mRNA sequence 70 4e-09
14gb|AC002292.1|AC002292 Arabidopsis thaliana BAC F8A5, complete s... 62 1e-06
15ref|NM_186630.1| Oryza sativa (japonica cultivar-group), mRNA 58 2e-05
16dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
17dbj|AP005197.3| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
18dbj|AP003740.2| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
19gb|AF012896.1|AF012896 Oryza sativa ADP-ribosylation factor 1 (O... 58 2e-05
20ref|NM_186628.1| Oryza sativa (japonica cultivar-group), mRNA 54 2e-04
21emb|AJ421017.1|GHI421017 Gossypium hirsutum mRNA for ADP-ribosyl... 54 2e-04
22gb|AY217756.1| Gossypium hirsutum ADP-ribosylation factor 1 (ARF... 54 2e-04
23gb|AY217755.1| Gossypium hirsutum ARF1-like GTP-binding protein ... 54 2e-04
24gb|AY197496.1| Gossypium hirsutum ADP-ribosylation factor 1 (ARF... 54 2e-04
25gb|AY189719.1| Gossypium hirsutum ADP-ribosylation factor (ARF) ... 54 2e-04
26dbj|D29691.1|RICYK3 Oryza sativa mRNA, sequence homologous to AD... 54 2e-04
27gb|AC166090.23| Glycine max clone gmw1-103e11, complete sequence 52 0.001
28gb|AF005238.1|AF005238 Catharanthus roseus ADP-ribosylation fact... 50 0.004
29gb|U27120.1|CRU27120 Chlamydomonas reinhardtii ADP-ribosylation ... 50 0.004
30gb|AC097175.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.015
31dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.015
32dbj|AK120035.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.015
33dbj|AK067029.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.015
34dbj|AK061970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.015
35dbj|D17760.1|RICARF Oryza sativa (japonica cultivar-group) mRNA ... 48 0.015
36ref|NM_105717.2| Arabidopsis thaliana unknown protein AT1G70490 ... 44 0.24
37ref|NM_202391.1| Arabidopsis thaliana unknown protein AT1G70490 ... 44 0.24
38ref|NM_180644.1| Arabidopsis thaliana GTP binding AT1G70490 tran... 44 0.24
39ref|NM_187999.1| Oryza sativa (japonica cultivar-group), Ozsa841... 44 0.24
40ref|NM_191065.1| Oryza sativa (japonica cultivar-group), predic... 44 0.24
41gb|AY770746.1| Eucalyptus grandis x Eucalyptus nitens unknown mRNA 44 0.24
42gb|AY241176.1| Oryza sativa (japonica cultivar-group) ARF mRNA, ... 44 0.24
43ref|XM_617443.2| PREDICTED: Bos taurus similar to GTP-binding pr... 44 0.24
44ref|XM_865362.1| PREDICTED: Bos taurus similar to GTP-binding pr... 44 0.24
45gb|AY056341.1| Arabidopsis thaliana putative ADP-ribosylation fa... 44 0.24
46gb|AF360164.1| Arabidopsis thaliana putative ADP-ribosylation fa... 44 0.24
47dbj|AP003570.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
48dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
49gb|AC026433.4|AC026433 Homo sapiens chromosome 5 clone CTD-2239K... 44 0.24
50emb|BX816017.1|CNS0AEGE Arabidopsis thaliana Full-length cDNA Co... 44 0.24
51gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24... 44 0.24
52dbj|AP004331.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
53gb|AY087235.1| Arabidopsis thaliana clone 33126 mRNA, complete s... 44 0.24
54dbj|AP001383.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
55dbj|AP001080.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
56emb|AJ539045.1|NTA539045 Nicotiana tabacum cDNA-AFLP-fragment BT... 44 0.24
57emb|AJ539037.1|NTA539037 Nicotiana tabacum cDNA-AFLP-fragment BT... 44 0.24
58dbj|AP003247.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.24
59dbj|AK067217.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.24
60dbj|AK065370.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.24
61dbj|AK062251.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.24
62emb|AJ508228.2|HVU508228 Hordeum vulgare subsp. vulgare mRNA for... 44 0.24
63dbj|AB050957.1| Triticum aestivum arf mRNA for ADP-ribosylation ... 44 0.24
64gb|AY650309.1| Macaca fascicularis ADP-ribosylation factor 1 mRN... 42 0.94
65ref|XM_509036.1| PREDICTED: Pan troglodytes similar to ADP-ribos... 42 0.94
66ref|XM_513698.1| PREDICTED: Pan troglodytes similar to ADP-ribos... 42 0.94
67ref|NM_001659.1| Homo sapiens ADP-ribosylation factor 3 (ARF3), ... 42 0.94
68gb|BC007647.1| Homo sapiens ADP-ribosylation factor 3, mRNA (cDN... 42 0.94
69gb|BC014778.1| Mus musculus ADP-ribosylation factor 3, mRNA (cDN... 42 0.94
70gb|BC010429.1| Homo sapiens ADP-ribosylation factor 1, mRNA (cDN... 42 0.94
71gb|BC007762.2| Homo sapiens ADP-ribosylation factor 3, mRNA (cDN... 42 0.94
72gb|BC017565.2| Homo sapiens ADP-ribosylation factor 3, mRNA (cDN... 42 0.94
73ref|NM_001658.3| Homo sapiens ADP-ribosylation factor 1 (ARF1), ... 42 0.94
74ref|NM_001024227.1| Homo sapiens ADP-ribosylation factor 1 (ARF1... 42 0.94
75ref|NM_001024228.1| Homo sapiens ADP-ribosylation factor 1 (ARF1... 42 0.94
76ref|NM_001024226.1| Homo sapiens ADP-ribosylation factor 1 (ARF1... 42 0.94
77ref|XM_656883.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 0.94
78gb|AC161364.4| Mus musculus BAC clone RP24-353J16 from chromosom... 42 0.94
79gb|AY239296.1| Gossypium barbadense ADP-ribosylation factor (arf... 42 0.94
80ref|XM_857809.1| PREDICTED: Canis familiaris similar to ADP-ribo... 42 0.94
81ref|XM_543688.2| PREDICTED: Canis familiaris similar to ADP-ribo... 42 0.94
82gb|BC041066.1| Homo sapiens ADP-ribosylation factor 1, mRNA (cDN... 42 0.94
83ref|XM_537606.2| PREDICTED: Canis familiaris similar to ADP-ribo... 42 0.94
84ref|XM_855473.1| PREDICTED: Canis familiaris similar to ADP-ribo... 42 0.94
85ref|XM_844955.1| PREDICTED: Canis familiaris similar to ADP-ribo... 42 0.94
86gb|M88292.1|BOVRIB205 Bos taurus (clone 1) ADP-ribosylation fact... 42 0.94
87emb|CR387921.7| Zebrafish DNA sequence from clone CH211-84M6 in ... 42 0.94
88gb|BC024935.1| Mus musculus ADP-ribosylation factor 3, mRNA (cDN... 42 0.94
89gb|BC020999.1| Homo sapiens cDNA clone IMAGE:3925531, **** WARNI... 42 0.94
90emb|AL136379.19| Human DNA sequence from clone RP5-881P19 on chr... 42 0.94
91gb|AC158342.4| Mus musculus chromosome 1, clone RP23-12H12, comp... 42 0.94
92emb|CR860810.1| Pongo pygmaeus mRNA; cDNA DKFZp469P1914 (from cl... 42 0.94
93gb|BC028402.2| Homo sapiens ADP-ribosylation factor 3, mRNA (cDN... 42 0.94
94gb|BT008187.1| Synthetic construct Homo sapiens ADP-ribosylation... 42 0.94
95gb|BT007393.1| Homo sapiens ADP-ribosylation factor 1 mRNA, comp... 42 0.94
96gb|BT006670.1| Homo sapiens ADP-ribosylation factor 3 mRNA, comp... 42 0.94
97emb|CR615857.1| full-length cDNA clone CS0DI026YK18 of Placenta ... 42 0.94
98emb|CR615761.1| full-length cDNA clone CS0DI051YH13 of Placenta ... 42 0.94
99emb|CR614731.1| full-length cDNA clone CS0DI082YD01 of Placenta ... 42 0.94
100emb|CR626279.1| full-length cDNA clone CS0DI076YH06 of Placenta ... 42 0.94
101emb|CR625666.1| full-length cDNA clone CS0DI085YP13 of Placenta ... 42 0.94
102emb|CR623360.1| full-length cDNA clone CS0DF004YL07 of Fetal bra... 42 0.94
103emb|CR622881.1| full-length cDNA clone CS0CAP007YI16 of Thymus o... 42 0.94
104emb|CR622211.1| full-length cDNA clone CS0DI015YK23 of Placenta ... 42 0.94
105emb|CR621987.1| full-length cDNA clone CS0DI005YJ09 of Placenta ... 42 0.94
106emb|CR622091.1| full-length cDNA clone CS0DA011YJ13 of Neuroblas... 42 0.94
107emb|CR619973.1| full-length cDNA clone XCL0BB001ZG03 of Neurobla... 42 0.94
108emb|CR620094.1| full-length cDNA clone CS0DI067YE16 of Placenta ... 42 0.94
109emb|CR618870.1| full-length cDNA clone CS0DI062YD03 of Placenta ... 42 0.94
110emb|CR618777.1| full-length cDNA clone CS0DF021YH18 of Fetal bra... 42 0.94
111emb|CR618770.1| full-length cDNA clone CS0DM003YF06 of Fetal liv... 42 0.94
112emb|CR618135.1| full-length cDNA clone CS0DI037YO10 of Placenta ... 42 0.94
113emb|CR617557.1| full-length cDNA clone CS0DI019YA06 of Placenta ... 42 0.94
114emb|CR616732.1| full-length cDNA clone CS0DI027YF10 of Placenta ... 42 0.94
115emb|CR614966.1| full-length cDNA clone CS0DI039YE09 of Placenta ... 42 0.94
116emb|CR614172.1| full-length cDNA clone CS0DI024YB11 of Placenta ... 42 0.94
117emb|CR609483.1| full-length cDNA clone CS0DI036YD21 of Placenta ... 42 0.94
118emb|CR613039.1| full-length cDNA clone CS0DA011YK04 of Neuroblas... 42 0.94
119emb|CR612960.1| full-length cDNA clone CS0DF007YE20 of Fetal bra... 42 0.94
120emb|CR612528.1| full-length cDNA clone CS0DI067YM24 of Placenta ... 42 0.94
121emb|CR612413.1| full-length cDNA clone CS0DI013YJ17 of Placenta ... 42 0.94
122emb|CR612002.1| full-length cDNA clone CS0DI069YN06 of Placenta ... 42 0.94
123emb|CR611972.1| full-length cDNA clone CS0DI033YJ05 of Placenta ... 42 0.94
124emb|CR611570.1| full-length cDNA clone CS0DK001YB12 of HeLa cell... 42 0.94
125emb|CR611072.1| full-length cDNA clone CS0DA011YA20 of Neuroblas... 42 0.94
126emb|CR609092.1| full-length cDNA clone CS0DI069YC08 of Placenta ... 42 0.94
127emb|CR609071.1| full-length cDNA clone CS0DI032YH20 of Placenta ... 42 0.94
128emb|CR608837.1| full-length cDNA clone CS0DI072YK15 of Placenta ... 42 0.94
129emb|CR608050.1| full-length cDNA clone CS0DI040YH19 of Placenta ... 42 0.94
130emb|CR607298.1| full-length cDNA clone CS0DI037YL03 of Placenta ... 42 0.94
131emb|CR605726.1| full-length cDNA clone CS0DI042YP20 of Placenta ... 42 0.94
132emb|CR605630.1| full-length cDNA clone CS0DE003YI19 of Placenta ... 42 0.94
133emb|CR605331.1| full-length cDNA clone CS0DI075YB12 of Placenta ... 42 0.94
134emb|CR605225.1| full-length cDNA clone CS0DH002YI07 of T cells (... 42 0.94
135emb|CR603926.1| full-length cDNA clone CS0DI022YD17 of Placenta ... 42 0.94
136emb|CR603771.1| full-length cDNA clone CS0DI039YG22 of Placenta ... 42 0.94
137emb|CR603607.1| full-length cDNA clone CS0DF001YH17 of Fetal bra... 42 0.94
138emb|CR603317.1| full-length cDNA clone CS0DI031YE24 of Placenta ... 42 0.94
139emb|CR603234.1| full-length cDNA clone CS0DI033YP05 of Placenta ... 42 0.94
140emb|CR601958.1| full-length cDNA clone CS0DI007YK16 of Placenta ... 42 0.94
141emb|CR600476.1| full-length cDNA clone CS0DA009YG03 of Neuroblas... 42 0.94
142emb|CR599498.1| full-length cDNA clone CS0DF003YO18 of Fetal bra... 42 0.94
143emb|CR598895.1| full-length cDNA clone CS0DI012YL05 of Placenta ... 42 0.94
144emb|CR598776.1| full-length cDNA clone CS0DG004YF13 of B cells (... 42 0.94
145emb|CR598062.1| full-length cDNA clone CS0DA004YK12 of Neuroblas... 42 0.94
146emb|CR596382.1| full-length cDNA clone CS0DI077YF02 of Placenta ... 42 0.94
147emb|CR596360.1| full-length cDNA clone CS0DI086YG15 of Placenta ... 42 0.94
148emb|CR595265.1| full-length cDNA clone CS0DI069YC14 of Placenta ... 42 0.94
149emb|CR594931.1| full-length cDNA clone CS0DF037YI19 of Fetal bra... 42 0.94
150emb|CR593577.1| full-length cDNA clone CS0DF006YF20 of Fetal bra... 42 0.94
151emb|CR593141.1| full-length cDNA clone CS0DI031YC11 of Placenta ... 42 0.94
152emb|CR592538.1| full-length cDNA clone CS0DI056YK23 of Placenta ... 42 0.94
153emb|CR592765.1| full-length cDNA clone CS0DE013YM14 of Placenta ... 42 0.94
154emb|CR592022.1| full-length cDNA clone CS0DI025YE13 of Placenta ... 42 0.94
155emb|CR591924.1| full-length cDNA clone CS0DI075YO10 of Placenta ... 42 0.94
156emb|CR589969.1| full-length cDNA clone CS0DF034YE14 of Fetal bra... 42 0.94
157dbj|AB220383.1| Macaca fascicularis mRNA, clone QbsB-11372: simi... 42 0.94
158gb|DP000063.1| Oryctolagus cuniculus target 117 genomic scaffold 42 0.94
159gb|AF493882.1| Homo sapiens ADP-ribosylation factor protein 3 (A... 42 0.94
160gb|AF493881.1| Homo sapiens ADP-ribosylation factor protein 1 (A... 42 0.94
161dbj|AK154948.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 0.94
162dbj|AK151296.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 42 0.94
163dbj|AK171354.1| Mus musculus B6-derived CD11 +ve dendritic cells... 42 0.94
164dbj|AK165176.1| Mus musculus 12 days embryo whole body cDNA, RIK... 42 0.94
165dbj|AB169501.1| Macaca fascicularis brain cDNA, clone: QccE-1171... 42 0.94
166ref|NM_174689.1| Bos taurus ADP-ribosylation factor 2 (ARF2), mRNA 42 0.94
167gb|AC025578.26| Homo sapiens 12 BAC RP11-340M11 (Roswell Park Ca... 42 0.94
168ref|NM_001015571.1| Bos taurus ADP-ribosylation factor 3 (ARF3),... 42 0.94
169gb|AC073610.17| Homo sapiens 12 BAC RP11-302B13 (Roswell Park Ca... 42 0.94
170dbj|AK213177.1| Mus musculus cDNA, clone:Y2G0127H02, strand:minu... 42 0.94
171gb|AY892678.1| Synthetic construct Homo sapiens clone FLH025273.... 42 0.94
172gb|AY892677.1| Synthetic construct Homo sapiens clone FLH025272.... 42 0.94
173gb|AY890303.1| Synthetic construct Homo sapiens clone FLH012504.... 42 0.94
174gb|AY890302.1| Synthetic construct Homo sapiens clone FLH012503.... 42 0.94
175gb|AY890190.1| Synthetic construct Homo sapiens clone FLH025277.... 42 0.94
176gb|AY890189.1| Synthetic construct Homo sapiens clone FLH025276.... 42 0.94
177dbj|AK000620.1| Homo sapiens cDNA FLJ20613 fis, clone KAT05486, ... 42 0.94
178dbj|AK057875.1| Homo sapiens cDNA FLJ25146 fis, clone CBR07332, ... 42 0.94
179dbj|AK057838.1| Homo sapiens cDNA FLJ25109 fis, clone CBR01561, ... 42 0.94
180dbj|AK130737.1| Homo sapiens cDNA FLJ27227 fis, clone SYN05501, ... 42 0.94
181gb|AC134788.10| Mus musculus chromosome 1, clone RP24-482A14, co... 42 0.94
182gb|BC011358.1| Homo sapiens ADP-ribosylation factor 1, mRNA (cDN... 42 0.94
183gb|BC009247.2| Homo sapiens ADP-ribosylation factor 1, mRNA (cDN... 42 0.94
184gb|BT020934.1| Bos taurus ADP-ribosylation factor 3 (ARF3), mRNA... 42 0.94
185gb|AF052179.1|AF052179 Homo sapiens clone 24537 ADP-ribosylation... 42 0.94
186gb|AF055002.1|AF055002 Homo sapiens clone 24614 ADP-ribosylation... 42 0.94
187ref|NM_007478.2| Mus musculus ADP-ribosylation factor 3 (Arf3), ... 42 0.94
188gb|M74491.1|HUMADPRF3A Human ADP-ribosylation factor 3 mRNA, com... 42 0.94
189gb|M33384.1|HUMARF1A Human ADP-ribosylation factor (ARF3) mRNA, ... 42 0.94
190gb|M74493.1|HUMADPRF02 Human ADP-ribosylation factor 3 gene, exo... 42 0.94
191gb|AC156543.10| Mus musculus chromosome 15, clone RP23-220F2, co... 42 0.94
192gb|M36340.1|HUMARF1BA Human ADP-ribosylation factor 1 (ARF1) mRN... 42 0.94
193gb|M84326.1|HUMADPRFIA Human ADP-ribosylation factor 1 mRNA, com... 42 0.94
194gb|M84332.1|HUMADPRF2 Human ADP-ribosylation factor 1 gene, exon... 42 0.94
195gb|M88287.1|BOVRIB2A Bos taurus ADP-ribosylation factor 2 mRNA, ... 42 0.94
196gb|J03794.1|BOVARF Bovine, ADP-ribosylation factor mRNA 42 0.94
197gb|AC025256.33| Homo sapiens 12 BAC RP11-437F8 (Roswell Park Can... 42 0.94
198dbj|D87900.1| Mus musculus mRNA for ARF3, complete cds 42 0.94
199gb|BT016788.1| Zea mays clone Contig621 mRNA sequence 40 3.7
200gb|AC107843.10| Mus musculus chromosome 1, clone RP23-306B14, co... 40 3.7
201gb|AC123616.11| Mus musculus chromosome 8, clone RP23-4F1, compl... 40 3.7
202ref|XM_421393.1| PREDICTED: Gallus gallus similar to hypothetica... 40 3.7
203gb|AC148334.3| Mus musculus BAC clone RP23-213L20 from chromosom... 40 3.7
204gb|AC122528.3| Mus musculus BAC clone RP24-506F15 from chromosom... 40 3.7
205gb|AC140492.3| Mus musculus BAC clone RP24-137B3 from chromosome... 40 3.7
206gb|AC127551.7| Mus musculus BAC clone RP24-547H23 from chromosom... 40 3.7
207gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 geno... 40 3.7
208gb|AY129558.1| Aeromonas hydrophila flg operon, complete sequence 40 3.7
209emb|AL929359.1|PFA929359 Plasmodium falciparum strain 3D7, chrom... 40 3.7
210emb|BX470197.17| Zebrafish DNA sequence from clone CH211-14P21 i... 40 3.7
211gb|AC120193.4| Homo sapiens chromosome 8, clone RP11-10H17, comp... 40 3.7
212emb|BX927397.10| Zebrafish DNA sequence from clone DKEY-87H7 in ... 40 3.7
213gb|AC044891.4| Homo sapiens chromosome 8, clone RP11-624C23, com... 40 3.7
214gb|AC131108.3| Mus musculus BAC clone RP23-351K24 from chromosom... 40 3.7
215dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7
216gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, com... 40 3.7
217gb|AY104231.1| Zea mays PCO085486 mRNA sequence 40 3.7
218gb|DQ306769.1| Hevea brasiliensis isolate SSH40 mRNA sequence 40 3.7
219gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 3.7
220gb|AC151995.2| Mus musculus BAC clone RP23-152L21 from 16, compl... 40 3.7
221gb|AC161499.2| Mus musculus chromosome 5, clone RP24-334E1, comp... 40 3.7
222dbj|D10859.1|RICORFA Oryza sativa (japonica cultivar-group) mRNA... 40 3.7

>gb|AY736124.1| Triticum aestivum ADP-ribosylation factor mRNA, complete cds
          Length = 583

 Score =  131 bits (66), Expect = 1e-27
 Identities = 75/78 (96%)
 Strand = Plus / Minus

                                                                       
Query: 207 gaaaatttaggacttgttggcaatgttgctggacagccagtccaggccttcatacagtcc 266
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 579 gaaaatttaggacttgctggcaatgttgctggacagccagtccaggccttcatacagtcc 520

                             
Query: 267 ttcccctgttgtagcaca 284
            ||||||| |||||||||
Sbjct: 519 ctcccctgctgtagcaca 502



to top

>gb|BT016553.1| Zea mays clone Contig386 mRNA sequence
          Length = 634

 Score =  101 bits (51), Expect = 1e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 210 aatttaggacttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           ||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||| ||
Sbjct: 564 aatttaggacttggttgcaatgttgctggacagccagtccaggccttcatacaatccctc 505

                          
Query: 270 ccctgttgtagcaca 284
            || |||||||||||
Sbjct: 504 acccgttgtagcaca 490



to top

>gb|BT018602.1| Zea mays clone EL01N0449E02.d mRNA sequence
          Length = 1546

 Score =  101 bits (51), Expect = 1e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                        
Query: 210  aatttaggacttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
            ||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||| ||
Sbjct: 1277 aatttaggacttggttgcaatgttgctggacagccagtccaggccttcatacaatccctc 1218

                           
Query: 270  ccctgttgtagcaca 284
             || |||||||||||
Sbjct: 1217 acccgttgtagcaca 1203



to top

>gb|BT017229.1| Zea mays clone EL01N0302G04.c mRNA sequence
          Length = 909

 Score =  101 bits (51), Expect = 1e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 210 aatttaggacttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           ||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||| ||
Sbjct: 667 aatttaggacttggttgcaatgttgctggacagccagtccaggccttcatacaatccctc 608

                          
Query: 270 ccctgttgtagcaca 284
            || |||||||||||
Sbjct: 607 acccgttgtagcaca 593



to top

>gb|AY104152.1| Zea mays PCO085488 mRNA sequence
          Length = 1096

 Score =  101 bits (51), Expect = 1e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 210 aatttaggacttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           ||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||| ||
Sbjct: 781 aatttaggacttggttgcaatgttgctggacagccagtccaggccttcatacaatccctc 722

                          
Query: 270 ccctgttgtagcaca 284
            || |||||||||||
Sbjct: 721 acccgttgtagcaca 707



to top

>ref|XM_470055.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1050

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 102/117 (87%), Gaps = 2/117 (1%)
 Strand = Plus / Minus

                                                                       
Query: 168 atccatccaaagcgctcctagctctttcaaaatcttgatgaaaatttaggacttgttggc 227
           ||||||||||||| | ||||||| | |  |||||||| | |||||||||| |||| ||||
Sbjct: 719 atccatccaaagctcccctagct-tatgcaaatcttg-ttaaaatttaggccttgctggc 662

                                                                    
Query: 228 aatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           ||||||||||||||||||||||||||| || |||| ||| || ||||||||||||||
Sbjct: 661 aatgttgctggacagccagtccaggccctcgtacaatccctcacctgttgtagcaca 605



to top

>emb|X80042.1|ZMADPRF Z.mays mRNA for ADP-ribosylation factor
          Length = 695

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                       
Query: 212 tttaggacttgttggcaatgttgctggacagccagtccaggccttcatacagtccttccc 271
           ||||||||||| | ||||||||||||||||||||||||||||||||||||| ||| || |
Sbjct: 655 tttaggacttggttgcaatgttgctggacagccagtccaggccttcatacaatccctcac 596

                        
Query: 272 ctgttgtagcaca 284
           | |||||||||||
Sbjct: 595 ccgttgtagcaca 583



to top

>dbj|AK122007.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033111C09, full
           insert sequence
          Length = 897

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 102/117 (87%), Gaps = 2/117 (1%)
 Strand = Plus / Minus

                                                                       
Query: 168 atccatccaaagcgctcctagctctttcaaaatcttgatgaaaatttaggacttgttggc 227
           ||||||||||||| | ||||||| | |  |||||||| | |||||||||| |||| ||||
Sbjct: 712 atccatccaaagctcccctagct-tatgcaaatcttg-ttaaaatttaggccttgctggc 655

                                                                    
Query: 228 aatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           ||||||||||||||||||||||||||| || |||| ||| || ||||||||||||||
Sbjct: 654 aatgttgctggacagccagtccaggccctcgtacaatccctcacctgttgtagcaca 598



to top

>dbj|AK105508.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-E03, full
           insert sequence
          Length = 1445

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 101/117 (86%), Gaps = 2/117 (1%)
 Strand = Plus / Minus

                                                                       
Query: 168 atccatccaaagcgctcctagctctttcaaaatcttgatgaaaatttaggacttgttggc 227
           ||||||||||||| | ||||||| | |  |||||||| | |||||||||| | || ||||
Sbjct: 703 atccatccaaagctcccctagct-tatgcaaatcttg-ttaaaatttaggccctgctggc 646

                                                                    
Query: 228 aatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           ||||||||||||||||||||||||||| || |||| ||| || ||||||||||||||
Sbjct: 645 aatgttgctggacagccagtccaggccctcgtacaatccctcacctgttgtagcaca 589



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                            
Query: 219      cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
                |||| ||||||||||||||||||||||||||||||| || |||| ||| || ||||||||
Sbjct: 33705384 cttgctggcaatgttgctggacagccagtccaggccctcgtacaatccctcacctgttgt 33705325

                      
Query: 279      agcaca 284
                ||||||
Sbjct: 33705324 agcaca 33705319



to top

>gb|AC137507.3| Oryza sativa chromosome 3 BAC OSJNBb0033J23 genomic sequence, complete
             sequence
          Length = 126862

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                         
Query: 219   cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
             |||| ||||||||||||||||||||||||||||||| || |||| ||| || ||||||||
Sbjct: 76753 cttgctggcaatgttgctggacagccagtccaggccctcgtacaatccctcacctgttgt 76694

                   
Query: 279   agcaca 284
             ||||||
Sbjct: 76693 agcaca 76688



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                            
Query: 219      cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
                |||| ||||||||||||||||||||||||||||||| || |||| ||| || ||||||||
Sbjct: 33795856 cttgctggcaatgttgctggacagccagtccaggccctcgtacaatccctcacctgttgt 33795797

                      
Query: 279      agcaca 284
                ||||||
Sbjct: 33795796 agcaca 33795791



to top

>gb|BT017034.1| Zea mays clone EL01N0202C08.c mRNA sequence
          Length = 1135

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 226 gcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           ||||||||||||||||||||||||||||| |||||||| || || || ||||| |||||
Sbjct: 227 gcaatgttgctggacagccagtccaggccctcatacagaccctcgccagttgtggcaca 285



to top

>gb|AC002292.1|AC002292 Arabidopsis thaliana BAC F8A5, complete sequence
          Length = 120787

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 220  ttgttggcaatgttgctggacagccagtccaggccttcatacagtcc 266
            ||||| ||||||||| |||| ||||||||||||||||| ||||||||
Sbjct: 8363 ttgttagcaatgttgttggagagccagtccaggccttcgtacagtcc 8409



to top

>ref|NM_186630.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 546

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 226 gcaatgttgctggacagccagtccaggccttcataca 262
           |||||||||||||||||||| |||||||| |||||||
Sbjct: 533 gcaatgttgctggacagccaatccaggccctcataca 497



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                    
Query: 226     gcaatgttgctggacagccagtccaggccttcataca 262
               |||||||||||||||||||| |||||||| |||||||
Sbjct: 6857451 gcaatgttgctggacagccaatccaggccctcataca 6857415



 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                          
Query: 226     gcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
               |||||||||||||||||||| |||||||| || ||||| || || || ||||| |||||
Sbjct: 6844119 gcaatgttgctggacagccaatccaggccctcgtacagaccctcaccagttgtggcaca 6844061



to top

>dbj|AP005197.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0592C06
          Length = 160071

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                   
Query: 226    gcaatgttgctggacagccagtccaggccttcataca 262
              |||||||||||||||||||| |||||||| |||||||
Sbjct: 151585 gcaatgttgctggacagccaatccaggccctcataca 151549



 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                         
Query: 226    gcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
              |||||||||||||||||||| |||||||| || ||||| || || || ||||| |||||
Sbjct: 138253 gcaatgttgctggacagccaatccaggccctcgtacagaccctcaccagttgtggcaca 138195



to top

>dbj|AP003740.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_B03
          Length = 108992

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                  
Query: 226   gcaatgttgctggacagccagtccaggccttcataca 262
             |||||||||||||||||||| |||||||| |||||||
Sbjct: 13706 gcaatgttgctggacagccaatccaggccctcataca 13670



 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 226 gcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           |||||||||||||||||||| |||||||| || ||||| || || || ||||| |||||
Sbjct: 374 gcaatgttgctggacagccaatccaggccctcgtacagaccctcaccagttgtggcaca 316



to top

>gb|AF012896.1|AF012896 Oryza sativa ADP-ribosylation factor 1 (Os-ARF1) mRNA, complete cds
          Length = 840

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 226 gcaatgttgctggacagccagtccaggccttcataca 262
           |||||||||||||||||||| |||||||| |||||||
Sbjct: 581 gcaatgttgctggacagccaatccaggccctcataca 545



to top

>ref|NM_186628.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 546

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 226 gcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           |||||||||||||||||||| |||||||| || ||||| || || || ||||| |||||
Sbjct: 533 gcaatgttgctggacagccaatccaggccctcgtacagaccctcaccagttgtggcaca 475



to top

>emb|AJ421017.1|GHI421017 Gossypium hirsutum mRNA for ADP-ribosylation factor (ARF1 gene)
          Length = 828

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           |||||| ||||||||| |||| ||||||||||| || |||||||| |||||
Sbjct: 670 cttgttagcaatgttgttggaaagccagtccagtccctcatacagcccttc 620



to top

>gb|AY217756.1| Gossypium hirsutum ADP-ribosylation factor 1 (ARF1) mRNA, complete
           cds
          Length = 1008

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           |||||| ||||||||| |||| ||||||||||| || |||||||| |||||
Sbjct: 786 cttgttagcaatgttgttggaaagccagtccagtccctcatacagcccttc 736



to top

>gb|AY217755.1| Gossypium hirsutum ARF1-like GTP-binding protein mRNA, complete cds
          Length = 1085

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           |||||| ||||||||| |||| ||||||||||| || |||||||| |||||
Sbjct: 862 cttgttagcaatgttgttggaaagccagtccagtccctcatacagcccttc 812



to top

>gb|AY197496.1| Gossypium hirsutum ADP-ribosylation factor 1 (ARF1) mRNA, complete
           cds
          Length = 1150

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           |||||| ||||||||| |||| ||||||||||| || |||||||| |||||
Sbjct: 990 cttgttagcaatgttgttggaaagccagtccagtccctcatacagcccttc 940



to top

>gb|AY189719.1| Gossypium hirsutum ADP-ribosylation factor (ARF) gene, exons 1
            through 7 and complete cds
          Length = 4356

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 219  cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttc 269
            |||||| ||||||||| |||| ||||||||||| || |||||||| |||||
Sbjct: 4060 cttgttagcaatgttgttggaaagccagtccagtccctcatacagcccttc 4010



to top

>dbj|D29691.1|RICYK3 Oryza sativa mRNA, sequence homologous to ADP-ribosylation factor
           gene
          Length = 391

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 226 gcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           |||||||||||||||||||| |||||||| || ||||| || || || ||||| |||||
Sbjct: 136 gcaatgttgctggacagccaatccaggccctcgtacagaccctcaccagttgtggcaca 78



to top

>gb|AC166090.23| Glycine max clone gmw1-103e11, complete sequence
          Length = 89397

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                   
Query: 219   cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccc 272
             |||||| || || ||| |||| ||||||||||| |||||||| |||||||||||
Sbjct: 87960 cttgttagctatattgttggagagccagtccagcccttcatatagtccttcccc 88013



to top

>gb|AF005238.1|AF005238 Catharanthus roseus ADP-ribosylation factor 1 (ARF1) mRNA, complete
           cds
          Length = 816

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 214 taggacttgttggcaatgttgctggacagccagtcca 250
           |||| |||||||||||||||| |||| ||||||||||
Sbjct: 578 taggccttgttggcaatgttgttggagagccagtcca 542



to top

>gb|U27120.1|CRU27120 Chlamydomonas reinhardtii ADP-ribosylation factor (ARF) mRNA,
           complete cds
          Length = 875

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 211 atttaggacttgttggcaatgttgctggacagccagtccag 251
           ||||||| ||||||||| | |||| ||||||||||||||||
Sbjct: 549 atttaggtcttgttggccaggttgttggacagccagtccag 509



to top

>gb|AC097175.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1119_H02,
              complete sequence
          Length = 138584

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 219    cttgttggcaatgttgctggacagccagtccaggccttcataca 262
              |||||||||||||||| |||| |||||||| || || |||||||
Sbjct: 116466 cttgttggcaatgttgttggaaagccagtcaagcccctcataca 116509



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 219      cttgttggcaatgttgctggacagccagtccaggccttcataca 262
                |||||||||||||||| |||| |||||||| || || |||||||
Sbjct: 23912631 cttgttggcaatgttgttggaaagccagtcaagcccctcataca 23912674



to top

>dbj|AK120035.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-C08, full
           insert sequence
          Length = 1004

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcataca 262
           |||||||||||||||| |||| |||||||| || || |||||||
Sbjct: 685 cttgttggcaatgttgttggaaagccagtcaagcccctcataca 642



to top

>dbj|AK067029.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092P04, full
           insert sequence
          Length = 1294

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcataca 262
           |||||||||||||||| |||| |||||||| || || |||||||
Sbjct: 720 cttgttggcaatgttgttggaaagccagtcaagcccctcataca 677



to top

>dbj|AK061970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-H06, full
           insert sequence
          Length = 976

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcataca 262
           |||||||||||||||| |||| |||||||| || || |||||||
Sbjct: 725 cttgttggcaatgttgttggaaagccagtcaagcccctcataca 682



to top

>dbj|D17760.1|RICARF Oryza sativa (japonica cultivar-group) mRNA for ADP-ribosylation
           factor, complete cds
          Length = 1064

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcataca 262
           |||||||||||||||| |||| |||||||| || || |||||||
Sbjct: 707 cttgttggcaatgttgttggaaagccagtcaagcccctcataca 664



to top

>ref|NM_105717.2| Arabidopsis thaliana unknown protein AT1G70490 transcript variant
           AT1G70490.2 mRNA, complete cds
          Length = 890

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
           |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 639 atgttgttggagagccagtccagaccttcataaagcccttcacctg 594



to top

>ref|NM_202391.1| Arabidopsis thaliana unknown protein AT1G70490 transcript variant
           AT1G70490.3 mRNA, complete cds
          Length = 994

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
           |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 743 atgttgttggagagccagtccagaccttcataaagcccttcacctg 698



to top

>ref|NM_180644.1| Arabidopsis thaliana GTP binding AT1G70490 transcript variant
           AT1G70490.1 mRNA, complete cds
          Length = 913

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
           |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 662 atgttgttggagagccagtccagaccttcataaagcccttcacctg 617



to top

>ref|NM_187999.1| Oryza sativa (japonica cultivar-group), Ozsa8419 predicted mRNA
          Length = 546

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcata 260
           |||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 540 cttgtttgcaatgttgctcgagagccagtcaaggccctcata 499



to top

>ref|NM_191065.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1131

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                        
Query: 219  cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
            |||| ||||||||||| |||| |||||||| || || |||||||  ||||| || | |||
Sbjct: 1074 cttgctggcaatgttgttggaaagccagtcaagaccctcatacaacccttcaccagatgt 1015

                  
Query: 279  agcaca 284
            ||||||
Sbjct: 1014 agcaca 1009



to top

>gb|AY770746.1| Eucalyptus grandis x Eucalyptus nitens unknown mRNA
          Length = 413

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcata 260
           |||||||||||| ||| |||| ||||||||||| || |||||
Sbjct: 265 cttgttggcaatattgttggaaagccagtccagaccctcata 224



to top

>gb|AY241176.1| Oryza sativa (japonica cultivar-group) ARF mRNA, complete cds
          Length = 956

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcata 260
           |||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 678 cttgtttgcaatgttgctcgagagccagtcaaggccctcata 637



to top

>ref|XM_617443.2| PREDICTED: Bos taurus similar to GTP-binding protein ARD-1
            (ADP-ribosylation factor domain protein 1) (Tripartite
            motif protein 23), transcript variant 1 (LOC537285), mRNA
          Length = 1664

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 241  agccagtccaggccttcatacagtcc 266
            ||||||||||| ||||||||||||||
Sbjct: 1523 agccagtccagtccttcatacagtcc 1498



to top

>ref|XM_865362.1| PREDICTED: Bos taurus similar to GTP-binding protein ARD-1
            (ADP-ribosylation factor domain protein 1) (Tripartite
            motif protein 23), transcript variant 2 (LOC537285), mRNA
          Length = 1847

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 241  agccagtccaggccttcatacagtcc 266
            ||||||||||| ||||||||||||||
Sbjct: 1706 agccagtccagtccttcatacagtcc 1681



to top

>gb|AY056341.1| Arabidopsis thaliana putative ADP-ribosylation factor 1 (At1g70490)
           mRNA, complete cds
          Length = 577

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
           |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 530 atgttgttggagagccagtccagaccttcataaagcccttcacctg 485



to top

>gb|AF360164.1| Arabidopsis thaliana putative ADP-ribosylation factor 1 (At1g70490)
           mRNA, complete cds
          Length = 877

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
           |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 613 atgttgttggagagccagtccagaccttcataaagcccttcacctg 568



to top

>dbj|AP003570.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0432B10
          Length = 131918

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                         
Query: 219   cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
             |||| ||||||||||| |||| |||||||| || || |||||||  ||||| || | |||
Sbjct: 73619 cttgctggcaatgttgttggaaagccagtcaagaccctcatacaacccttcaccagatgt 73560

                   
Query: 279   agcaca 284
             ||||||
Sbjct: 73559 agcaca 73554



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                            
Query: 219      cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
                |||| ||||||||||| |||| |||||||| || || |||||||  ||||| || | |||
Sbjct: 34576325 cttgctggcaatgttgttggaaagccagtcaagaccctcatacaacccttcaccagatgt 34576266

                      
Query: 279      agcaca 284
                ||||||
Sbjct: 34576265 agcaca 34576260



 Score = 44.1 bits (22), Expect = 0.24
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                         
Query: 219     cttgttggcaatgttgctggacagccagtccaggccttcata 260
               |||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 9019525 cttgtttgcaatgttgctcgagagccagtcaaggccctcata 9019566



to top

>gb|AC026433.4|AC026433 Homo sapiens chromosome 5 clone CTD-2239K20, complete sequence
          Length = 96951

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 190   tctttcaaaatcttgatgaaaa 211
             ||||||||||||||||||||||
Sbjct: 46353 tctttcaaaatcttgatgaaaa 46374



to top

>emb|BX816017.1|CNS0AEGE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZA08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 615

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
           |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 365 atgttgttggagagccagtccagaccttcataaagcccttcacctg 320



to top

>gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24J13 genomic sequence, complete
             sequence
          Length = 87400

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 229   atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
             |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 14198 atgttgttggagagccagtccagaccttcataaagcccttcacctg 14243



to top

>dbj|AP004331.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0085D07
          Length = 172483

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                         
Query: 219   cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
             |||| ||||||||||| |||| |||||||| || || |||||||  ||||| || | |||
Sbjct: 28342 cttgctggcaatgttgttggaaagccagtcaagaccctcatacaacccttcaccagatgt 28283

                   
Query: 279   agcaca 284
             ||||||
Sbjct: 28282 agcaca 28277



to top

>gb|AY087235.1| Arabidopsis thaliana clone 33126 mRNA, complete sequence
          Length = 911

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctg 274
           |||||| |||| ||||||||||| |||||||| || ||||| ||||
Sbjct: 662 atgttgttggagagccagtccagaccttcataaagcccttcacctg 617



to top

>dbj|AP001383.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              clone:P0453A06
          Length = 154378

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 219    cttgttggcaatgttgctggacagccagtccaggccttcata 260
              |||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 127280 cttgtttgcaatgttgctcgagagccagtcaaggccctcata 127321



to top

>dbj|AP001080.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0499C11
          Length = 151369

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 219   cttgttggcaatgttgctggacagccagtccaggccttcata 260
             |||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 48532 cttgtttgcaatgttgctcgagagccagtcaaggccctcata 48573



to top

>emb|AJ539045.1|NTA539045 Nicotiana tabacum cDNA-AFLP-fragment BT4-M33-019
          Length = 262

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 213 ttaggacttgttggcaatgttg 234
           ||||||||||||||||||||||
Sbjct: 140 ttaggacttgttggcaatgttg 119



to top

>emb|AJ539037.1|NTA539037 Nicotiana tabacum cDNA-AFLP-fragment BT4-M33-003
          Length = 278

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 213 ttaggacttgttggcaatgttg 234
           ||||||||||||||||||||||
Sbjct: 121 ttaggacttgttggcaatgttg 142



to top

>dbj|AP003247.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0425G02
          Length = 155432

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                          
Query: 219    cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
              |||| ||||||||||| |||| |||||||| || || |||||||  ||||| || | |||
Sbjct: 152044 cttgctggcaatgttgttggaaagccagtcaagaccctcatacaacccttcaccagatgt 151985

                    
Query: 279    agcaca 284
              ||||||
Sbjct: 151984 agcaca 151979



to top

>dbj|AK067217.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098K24, full
           insert sequence
          Length = 882

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcata 260
           |||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 606 cttgtttgcaatgttgctcgagagccagtcaaggccctcata 565



to top

>dbj|AK065370.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013022G24, full
           insert sequence
          Length = 1008

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
           |||| ||||||||||| |||| |||||||| || || |||||||  ||||| || | |||
Sbjct: 753 cttgctggcaatgttgttggaaagccagtcaagaccctcatacaacccttcaccagatgt 694

                 
Query: 279 agcaca 284
           ||||||
Sbjct: 693 agcaca 688



to top

>dbj|AK062251.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-G02, full
           insert sequence
          Length = 1005

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcatacagtccttcccctgttgt 278
           |||| ||||||||||| |||| |||||||| || || |||||||  ||||| || | |||
Sbjct: 750 cttgctggcaatgttgttggaaagccagtcaagaccctcatacaacccttcaccagatgt 691

                 
Query: 279 agcaca 284
           ||||||
Sbjct: 690 agcaca 685



to top

>emb|AJ508228.2|HVU508228 Hordeum vulgare subsp. vulgare mRNA for ADP-ribosylation factor
           1-like protein
          Length = 934

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 219 cttgttggcaatgttgctggacagccagtc 248
           |||||||||||||||| |||| ||||||||
Sbjct: 675 cttgttggcaatgttgttggagagccagtc 646



to top

>dbj|AB050957.1| Triticum aestivum arf mRNA for ADP-ribosylation factor, complete
           cds
          Length = 972

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 219 cttgttggcaatgttgctggacagccagtc 248
           |||||||||||||||| |||| ||||||||
Sbjct: 652 cttgttggcaatgttgttggagagccagtc 623



to top

>gb|AY650309.1| Macaca fascicularis ADP-ribosylation factor 1 mRNA, partial cds
          Length = 516

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 493 tggacagccagtccagtccttcata 469



to top

>ref|XM_509036.1| PREDICTED: Pan troglodytes similar to ADP-ribosylation factor 3
           (LOC451869), mRNA
          Length = 879

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 716 cagccagtccaggccttcgtacagcccgtcccc 684



to top

>ref|XM_513698.1| PREDICTED: Pan troglodytes similar to ADP-ribosylation factor 1
           (LOC457177), mRNA
          Length = 681

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 502 tggacagccagtccagtccttcata 478



to top

>ref|NM_001659.1| Homo sapiens ADP-ribosylation factor 3 (ARF3), mRNA
          Length = 3595

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 830 cagccagtccaggccttcgtacagcccgtcccc 798



to top

>gb|BC007647.1| Homo sapiens ADP-ribosylation factor 3, mRNA (cDNA clone MGC:15946
           IMAGE:3537965), complete cds
          Length = 3518

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 727 cagccagtccaggccttcgtacagcccgtcccc 695



to top

>gb|BC014778.1| Mus musculus ADP-ribosylation factor 3, mRNA (cDNA clone MGC:6687
           IMAGE:3582243), complete cds
          Length = 3490

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 747 cagccagtccaagccttcatacagcccgtcccc 715



to top

>gb|BC010429.1| Homo sapiens ADP-ribosylation factor 1, mRNA (cDNA clone MGC:15747
           IMAGE:3356859), complete cds
          Length = 1841

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>gb|BC007762.2| Homo sapiens ADP-ribosylation factor 3, mRNA (cDNA clone MGC:12839
           IMAGE:4126378), complete cds
          Length = 1031

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 747 cagccagtccaggccttcgtacagcccgtcccc 715



to top

>gb|BC017565.2| Homo sapiens ADP-ribosylation factor 3, mRNA (cDNA clone MGC:1802
           IMAGE:2967578), complete cds
          Length = 3436

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 650 cagccagtccaggccttcgtacagcccgtcccc 618



to top

>ref|NM_001658.3| Homo sapiens ADP-ribosylation factor 1 (ARF1), transcript variant
           4, mRNA
          Length = 1901

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 666 tggacagccagtccagtccttcata 642



to top

>ref|NM_001024227.1| Homo sapiens ADP-ribosylation factor 1 (ARF1), transcript variant
           1, mRNA
          Length = 2020

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 785 tggacagccagtccagtccttcata 761



to top

>ref|NM_001024228.1| Homo sapiens ADP-ribosylation factor 1 (ARF1), transcript variant
           2, mRNA
          Length = 1998

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 763 tggacagccagtccagtccttcata 739



to top

>ref|NM_001024226.1| Homo sapiens ADP-ribosylation factor 1 (ARF1), transcript variant
           3, mRNA
          Length = 1986

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 751 tggacagccagtccagtccttcata 727



to top

>ref|XM_656883.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4371.2), mRNA
          Length = 1959

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 120  agcaccatcccatcccaacac 140
            |||||||||||||||||||||
Sbjct: 1847 agcaccatcccatcccaacac 1827



to top

>gb|AC161364.4| Mus musculus BAC clone RP24-353J16 from chromosome 6, complete sequence
          Length = 182872

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 122   caccatcccatcccaacacaa 142
             |||||||||||||||||||||
Sbjct: 83465 caccatcccatcccaacacaa 83485



to top

>gb|AY239296.1| Gossypium barbadense ADP-ribosylation factor (arf1) mRNA, partial
           cds
          Length = 407

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 219 cttgttggcaatgttgctggacagccagtccag 251
           |||||| ||||||||| |||| |||||||||||
Sbjct: 374 cttgttagcaatgttgttggaaagccagtccag 342



to top

>ref|XM_857809.1| PREDICTED: Canis familiaris similar to ADP-ribosylation factor 3,
           transcript variant 2 (LOC486562), mRNA
          Length = 1077

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 811 cagccagtccaggccttcgtacagcccgtcccc 779



to top

>ref|XM_543688.2| PREDICTED: Canis familiaris similar to ADP-ribosylation factor 3,
           transcript variant 1 (LOC486562), mRNA
          Length = 1059

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 793 cagccagtccaggccttcgtacagcccgtcccc 761



to top

>gb|BC041066.1| Homo sapiens ADP-ribosylation factor 1, mRNA (cDNA clone
            IMAGE:5471927), **** WARNING: chimeric clone ****
          Length = 2328

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 236  tggacagccagtccaggccttcata 260
            |||||||||||||||| ||||||||
Sbjct: 1088 tggacagccagtccagtccttcata 1064



to top

>ref|XM_537606.2| PREDICTED: Canis familiaris similar to ADP-ribosylation factor 2,
           transcript variant 1 (LOC480487), mRNA
          Length = 2273

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||| ||||||||||||||||||||
Sbjct: 575 tggagagccagtccaggccttcata 551



to top

>ref|XM_855473.1| PREDICTED: Canis familiaris similar to ADP-ribosylation factor 2,
           transcript variant 3 (LOC480487), mRNA
          Length = 2239

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||| ||||||||||||||||||||
Sbjct: 541 tggagagccagtccaggccttcata 517



to top

>ref|XM_844955.1| PREDICTED: Canis familiaris similar to ADP-ribosylation factor 2,
           transcript variant 2 (LOC480487), mRNA
          Length = 2473

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||| ||||||||||||||||||||
Sbjct: 775 tggagagccagtccaggccttcata 751



to top

>gb|M88292.1|BOVRIB205 Bos taurus (clone 1) ADP-ribosylation factor 141895, exon 5 and
           complete cds
          Length = 1906

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||| ||||||||||||||||||||
Sbjct: 178 tggagagccagtccaggccttcata 154



to top

>emb|CR387921.7| Zebrafish DNA sequence from clone CH211-84M6 in linkage group 17,
             complete sequence
          Length = 187568

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    caaaatacaataaaacaatag 43
             |||||||||||||||||||||
Sbjct: 52494 caaaatacaataaaacaatag 52514



to top

>gb|BC024935.1| Mus musculus ADP-ribosylation factor 3, mRNA (cDNA clone MGC:28115
           IMAGE:3969152), complete cds
          Length = 3421

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 792 cagccagtccaagccttcatacagcccgtcccc 760



to top

>gb|BC020999.1| Homo sapiens cDNA clone IMAGE:3925531, **** WARNING: chimeric clone
            ****
          Length = 3864

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 240  cagccagtccaggccttcatacagtccttcccc 272
            |||||||||||||||||| ||||| || |||||
Sbjct: 3583 cagccagtccaggccttcgtacagcccgtcccc 3551



to top

>emb|AL136379.19| Human DNA sequence from clone RP5-881P19 on chromosome 1q42.11-42.3
             Contains the WNT3A gene for wingless-type MMTV integration
             site family member 3A protein, a novel protein, the ARF1
             gene for ADP-ribosylation factor 1 protein, a C1orf35 gene
             for chromosome 1 open reading frame 35, the MRPL55 gene
             for  mitochondrial ribosomal protein L55, a novel
             processed pseudogene and six CpG islands, complete
             sequence
          Length = 127816

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 236   tggacagccagtccaggccttcata 260
             |||||||||||||||| ||||||||
Sbjct: 22939 tggacagccagtccagtccttcata 22963



to top

>gb|AC158342.4| Mus musculus chromosome 1, clone RP23-12H12, complete sequence
          Length = 224295

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 183   tcctagctctttcaaaatctt 203
             |||||||||||||||||||||
Sbjct: 95167 tcctagctctttcaaaatctt 95187



to top

>emb|CR860810.1| Pongo pygmaeus mRNA; cDNA DKFZp469P1914 (from clone DKFZp469P1914)
          Length = 3605

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 806 cagccagtccaggccttcgtacagcccgtcccc 774



to top

>gb|BC028402.2| Homo sapiens ADP-ribosylation factor 3, mRNA (cDNA clone MGC:33515
           IMAGE:4817874), complete cds
          Length = 3550

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 768 cagccagtccaggccttcgtacagcccgtcccc 736



to top

>gb|BT008187.1| Synthetic construct Homo sapiens ADP-ribosylation factor 3 mRNA,
           partial cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 519 cagccagtccaggccttcgtacagcccgtcccc 487



to top

>gb|BT007393.1| Homo sapiens ADP-ribosylation factor 1 mRNA, complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 523 tggacagccagtccagtccttcata 499



to top

>gb|BT006670.1| Homo sapiens ADP-ribosylation factor 3 mRNA, complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 519 cagccagtccaggccttcgtacagcccgtcccc 487



to top

>emb|CR615857.1| full-length cDNA clone CS0DI026YK18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1268

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 135 tggacagccagtccagtccttcata 111



to top

>emb|CR615761.1| full-length cDNA clone CS0DI051YH13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1773

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR614731.1| full-length cDNA clone CS0DI082YD01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1766

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 580 tggacagccagtccagtccttcata 556



to top

>emb|CR626279.1| full-length cDNA clone CS0DI076YH06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1137

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 35  tggacagccagtccagtccttcata 11



to top

>emb|CR625666.1| full-length cDNA clone CS0DI085YP13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1646

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 580 tggacagccagtccagtccttcata 556



to top

>emb|CR623360.1| full-length cDNA clone CS0DF004YL07 of Fetal brain of Homo sapiens
           (human)
          Length = 1786

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 580 tggacagccagtccagtccttcata 556



to top

>emb|CR622881.1| full-length cDNA clone CS0CAP007YI16 of Thymus of Homo sapiens
           (human)
          Length = 1727

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 622 tggacagccagtccagtccttcata 598



to top

>emb|CR622211.1| full-length cDNA clone CS0DI015YK23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1690

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 592 tggacagccagtccagtccttcata 568



to top

>emb|CR621987.1| full-length cDNA clone CS0DI005YJ09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1790

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 604 tggacagccagtccagtccttcata 580



to top

>emb|CR622091.1| full-length cDNA clone CS0DA011YJ13 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1790

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 592 tggacagccagtccagtccttcata 568



to top

>emb|CR619973.1| full-length cDNA clone XCL0BB001ZG03 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1703

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 568 tggacagccagtccagtccttcata 544



to top

>emb|CR620094.1| full-length cDNA clone CS0DI067YE16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1796

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 605 tggacagccagtccagtccttcata 581



to top

>emb|CR618870.1| full-length cDNA clone CS0DI062YD03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1782

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 602 tggacagccagtccagtccttcata 578



to top

>emb|CR618777.1| full-length cDNA clone CS0DF021YH18 of Fetal brain of Homo sapiens
           (human)
          Length = 1664

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 602 tggacagccagtccagtccttcata 578



to top

>emb|CR618770.1| full-length cDNA clone CS0DM003YF06 of Fetal liver of Homo sapiens
           (human)
          Length = 1737

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 580 tggacagccagtccagtccttcata 556



to top

>emb|CR618135.1| full-length cDNA clone CS0DI037YO10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1790

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 580 tggacagccagtccagtccttcata 556



to top

>emb|CR617557.1| full-length cDNA clone CS0DI019YA06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1784

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 617 tggacagccagtccagtccttcata 593



to top

>emb|CR616732.1| full-length cDNA clone CS0DI027YF10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1791

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 605 tggacagccagtccagtccttcata 581



to top

>emb|CR614966.1| full-length cDNA clone CS0DI039YE09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1798

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 593 tggacagccagtccagtccttcata 569



to top

>emb|CR614172.1| full-length cDNA clone CS0DI024YB11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1760

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 580 tggacagccagtccagtccttcata 556



to top

>emb|CR609483.1| full-length cDNA clone CS0DI036YD21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1697

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 599 tggacagccagtccagtccttcata 575



to top

>emb|CR613039.1| full-length cDNA clone CS0DA011YK04 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1779

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 582 tggacagccagtccagtccttcata 558



to top

>emb|CR612960.1| full-length cDNA clone CS0DF007YE20 of Fetal brain of Homo sapiens
           (human)
          Length = 1807

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 592 tggacagccagtccagtccttcata 568



to top

>emb|CR612528.1| full-length cDNA clone CS0DI067YM24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1711

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 606 tggacagccagtccagtccttcata 582



to top

>emb|CR612413.1| full-length cDNA clone CS0DI013YJ17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1796

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR612002.1| full-length cDNA clone CS0DI069YN06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1800

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 613 tggacagccagtccagtccttcata 589



to top

>emb|CR611972.1| full-length cDNA clone CS0DI033YJ05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1732

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 629 tggacagccagtccagtccttcata 605



to top

>emb|CR611570.1| full-length cDNA clone CS0DK001YB12 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1783

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 595 tggacagccagtccagtccttcata 571



to top

>emb|CR611072.1| full-length cDNA clone CS0DA011YA20 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1790

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 590 tggacagccagtccagtccttcata 566



to top

>emb|CR609092.1| full-length cDNA clone CS0DI069YC08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1770

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 580 tggacagccagtccagtccttcata 556



to top

>emb|CR609071.1| full-length cDNA clone CS0DI032YH20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1756

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 568 tggacagccagtccagtccttcata 544



to top

>emb|CR608837.1| full-length cDNA clone CS0DI072YK15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1784

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR608050.1| full-length cDNA clone CS0DI040YH19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1756

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 633 tggacagccagtccagtccttcata 609



to top

>emb|CR607298.1| full-length cDNA clone CS0DI037YL03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1578

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 372 tggacagccagtccagtccttcata 348



to top

>emb|CR605726.1| full-length cDNA clone CS0DI042YP20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1782

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR605630.1| full-length cDNA clone CS0DE003YI19 of Placenta of Homo sapiens
           (human)
          Length = 1713

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 553 tggacagccagtccagtccttcata 529



to top

>emb|CR605331.1| full-length cDNA clone CS0DI075YB12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1754

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 592 tggacagccagtccagtccttcata 568



to top

>emb|CR605225.1| full-length cDNA clone CS0DH002YI07 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1714

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 592 tggacagccagtccagtccttcata 568



to top

>emb|CR603926.1| full-length cDNA clone CS0DI022YD17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1625

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 434 tggacagccagtccagtccttcata 410



to top

>emb|CR603771.1| full-length cDNA clone CS0DI039YG22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1777

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR603607.1| full-length cDNA clone CS0DF001YH17 of Fetal brain of Homo sapiens
           (human)
          Length = 1827

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 645 tggacagccagtccagtccttcata 621



to top

>emb|CR603317.1| full-length cDNA clone CS0DI031YE24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1356

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 171 tggacagccagtccagtccttcata 147



to top

>emb|CR603234.1| full-length cDNA clone CS0DI033YP05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1706

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 629 tggacagccagtccagtccttcata 605



to top

>emb|CR601958.1| full-length cDNA clone CS0DI007YK16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1779

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 602 tggacagccagtccagtccttcata 578



to top

>emb|CR600476.1| full-length cDNA clone CS0DA009YG03 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1797

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR599498.1| full-length cDNA clone CS0DF003YO18 of Fetal brain of Homo sapiens
           (human)
          Length = 1670

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 602 tggacagccagtccagtccttcata 578



to top

>emb|CR598895.1| full-length cDNA clone CS0DI012YL05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1783

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 592 tggacagccagtccagtccttcata 568



to top

>emb|CR598776.1| full-length cDNA clone CS0DG004YF13 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1807

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 602 tggacagccagtccagtccttcata 578



to top

>emb|CR598062.1| full-length cDNA clone CS0DA004YK12 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1722

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 603 tggacagccagtccagtccttcata 579



to top

>emb|CR596382.1| full-length cDNA clone CS0DI077YF02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1737

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 622 tggacagccagtccagtccttcata 598



to top

>emb|CR596360.1| full-length cDNA clone CS0DI086YG15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1757

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 553 tggacagccagtccagtccttcata 529



to top

>emb|CR595265.1| full-length cDNA clone CS0DI069YC14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1782

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR594931.1| full-length cDNA clone CS0DF037YI19 of Fetal brain of Homo sapiens
           (human)
          Length = 1770

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR593577.1| full-length cDNA clone CS0DF006YF20 of Fetal brain of Homo sapiens
           (human)
          Length = 1768

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 568 tggacagccagtccagtccttcata 544



to top

>emb|CR593141.1| full-length cDNA clone CS0DI031YC11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1805

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 599 tggacagccagtccagtccttcata 575



to top

>emb|CR592538.1| full-length cDNA clone CS0DI056YK23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1459

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 355 tggacagccagtccagtccttcata 331



to top

>emb|CR592765.1| full-length cDNA clone CS0DE013YM14 of Placenta of Homo sapiens
           (human)
          Length = 1294

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 93  tggacagccagtccagtccttcata 69



to top

>emb|CR592022.1| full-length cDNA clone CS0DI025YE13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1796

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>emb|CR591924.1| full-length cDNA clone CS0DI075YO10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1744

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 554 tggacagccagtccagtccttcata 530



to top

>emb|CR589969.1| full-length cDNA clone CS0DF034YE14 of Fetal brain of Homo sapiens
           (human)
          Length = 1772

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 591 tggacagccagtccagtccttcata 567



to top

>dbj|AB220383.1| Macaca fascicularis mRNA, clone QbsB-11372: similar to Homo sapiens
           ADP-ribosylation factor 3(ARF3), mRNA, NM_001659.1
          Length = 1082

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 768 cagccagtccaggccttcgtacagcccgtcccc 736



to top

>gb|DP000063.1| Oryctolagus cuniculus target 117 genomic scaffold
          Length = 489372

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 236   tggacagccagtccaggccttcata 260
             |||| ||||||||||||||||||||
Sbjct: 19482 tggagagccagtccaggccttcata 19458



to top

>gb|AF493882.1| Homo sapiens ADP-ribosylation factor protein 3 (ARF3) mRNA,
           complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 519 cagccagtccaggccttcgtacagcccgtcccc 487



to top

>gb|AF493881.1| Homo sapiens ADP-ribosylation factor protein 1 (ARF1) mRNA,
           complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 523 tggacagccagtccagtccttcata 499



to top

>dbj|AK154948.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630112I17
           product:ADP-ribosylation factor 3, full insert sequence
          Length = 3529

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 795 cagccagtccaagccttcatacagcccgtcccc 763



to top

>dbj|AK151296.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830027M12
           product:ADP-ribosylation factor 3, full insert sequence
          Length = 3568

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 841 cagccagtccaagccttcatacagcccgtcccc 809



to top

>dbj|AK171354.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730032M15
           product:ADP-ribosylation factor 3, full insert sequence
          Length = 4560

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 791 cagccagtccaagccttcatacagcccgtcccc 759



to top

>dbj|AK165176.1| Mus musculus 12 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:E970001F24
           product:ADP-ribosylation factor 3, full insert sequence
          Length = 3538

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 802 cagccagtccaagccttcatacagcccgtcccc 770



to top

>dbj|AB169501.1| Macaca fascicularis brain cDNA, clone: QccE-11717, similar to human
           ADP-ribosylation factor 1 (ARF1), mRNA, RefSeq:
           NM_001658.2
          Length = 1862

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 718 tggacagccagtccagtccttcata 694



to top

>ref|NM_174689.1| Bos taurus ADP-ribosylation factor 2 (ARF2), mRNA
          Length = 2269

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||| ||||||||||||||||||||
Sbjct: 609 tggagagccagtccaggccttcata 585



to top

>gb|AC025578.26| Homo sapiens 12 BAC RP11-340M11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 115528

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 235   ctggacagccagtccaggccttcat 259
             ||||||||||||||||| |||||||
Sbjct: 93814 ctggacagccagtccagtccttcat 93838



to top

>ref|NM_001015571.1| Bos taurus ADP-ribosylation factor 3 (ARF3), mRNA
          Length = 854

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 607 cagccagtccaggccttcgtacagcccgtcccc 575



to top

>gb|AC073610.17| Homo sapiens 12 BAC RP11-302B13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 104593

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 240   cagccagtccaggccttcatacagtccttcccc 272
             |||||||||||||||||| ||||| || |||||
Sbjct: 57046 cagccagtccaggccttcgtacagcccgtcccc 57078



to top

>dbj|AK213177.1| Mus musculus cDNA, clone:Y2G0127H02, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000063347, based on BLAT search
          Length = 216

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 34  cagccagtccaagccttcatacagcccgtcccc 2



to top

>gb|AY892678.1| Synthetic construct Homo sapiens clone FLH025273.01L
           ADP-ribosylation factor 3 (ARF3) mRNA, partial cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 519 cagccagtccaggccttcgtacagcccgtcccc 487



to top

>gb|AY892677.1| Synthetic construct Homo sapiens clone FLH025272.01L
           ADP-ribosylation factor 3 (ARF3) mRNA, partial cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 519 cagccagtccaggccttcgtacagcccgtcccc 487



to top

>gb|AY890303.1| Synthetic construct Homo sapiens clone FLH012504.01X
           ADP-ribosylation factor 1 (ARF1) mRNA, complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 523 tggacagccagtccagtccttcata 499



to top

>gb|AY890302.1| Synthetic construct Homo sapiens clone FLH012503.01X
           ADP-ribosylation factor 1 (ARF1) mRNA, complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 523 tggacagccagtccagtccttcata 499



to top

>gb|AY890190.1| Synthetic construct Homo sapiens clone FLH025277.01X
           ADP-ribosylation factor 3 (ARF3) mRNA, complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 519 cagccagtccaggccttcgtacagcccgtcccc 487



to top

>gb|AY890189.1| Synthetic construct Homo sapiens clone FLH025276.01X
           ADP-ribosylation factor 3 (ARF3) mRNA, complete cds
          Length = 546

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 519 cagccagtccaggccttcgtacagcccgtcccc 487



to top

>dbj|AK000620.1| Homo sapiens cDNA FLJ20613 fis, clone KAT05486, highly similar to
           M36340 Human ADP-ribosylation factor 1
          Length = 1911

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 666 tggacagccagtccagtccttcata 642



to top

>dbj|AK057875.1| Homo sapiens cDNA FLJ25146 fis, clone CBR07332, highly similar to
           ADP-RIBOSYLATION FACTOR 1
          Length = 1823

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 604 tggacagccagtccagtccttcata 580



to top

>dbj|AK057838.1| Homo sapiens cDNA FLJ25109 fis, clone CBR01561, highly similar to
           ADP-RIBOSYLATION FACTOR 1
          Length = 1727

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 594 tggacagccagtccagtccttcata 570



to top

>dbj|AK130737.1| Homo sapiens cDNA FLJ27227 fis, clone SYN05501, highly similar to
           ADP-ribosylation factor 1
          Length = 1815

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 596 tggacagccagtccagtccttcata 572



to top

>gb|AC134788.10| Mus musculus chromosome 1, clone RP24-482A14, complete sequence
          Length = 157535

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 183    tcctagctctttcaaaatctt 203
              |||||||||||||||||||||
Sbjct: 128865 tcctagctctttcaaaatctt 128845



to top

>gb|BC011358.1| Homo sapiens ADP-ribosylation factor 1, mRNA (cDNA clone MGC:9347
           IMAGE:3463523), complete cds
          Length = 1854

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 617 tggacagccagtccagtccttcata 593



to top

>gb|BC009247.2| Homo sapiens ADP-ribosylation factor 1, mRNA (cDNA clone MGC:3958
           IMAGE:2963635), complete cds
          Length = 1815

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 578 tggacagccagtccagtccttcata 554



to top

>gb|BT020934.1| Bos taurus ADP-ribosylation factor 3 (ARF3), mRNA, complete cds
          Length = 854

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 607 cagccagtccaggccttcgtacagcccgtcccc 575



to top

>gb|AF052179.1|AF052179 Homo sapiens clone 24537 ADP-ribosylation factor 1 mRNA, complete
           cds
          Length = 1757

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 598 tggacagccagtccagtccttcata 574



to top

>gb|AF055002.1|AF055002 Homo sapiens clone 24614 ADP-ribosylation factor 1 mRNA, complete
           cds
          Length = 1753

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 595 tggacagccagtccagtccttcata 571



to top

>ref|NM_007478.2| Mus musculus ADP-ribosylation factor 3 (Arf3), mRNA
          Length = 3490

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 747 cagccagtccaagccttcatacagcccgtcccc 715



to top

>gb|M74491.1|HUMADPRF3A Human ADP-ribosylation factor 3 mRNA, complete cds
          Length = 3595

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 830 cagccagtccaggccttcgtacagcccgtcccc 798



to top

>gb|M33384.1|HUMARF1A Human ADP-ribosylation factor (ARF3) mRNA, complete cds
          Length = 1058

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           |||||||||||||||||| ||||| || |||||
Sbjct: 943 cagccagtccaggccttcgtacagcccgtcccc 911



to top

>gb|M74493.1|HUMADPRF02 Human ADP-ribosylation factor 3 gene, exons 2-5
          Length = 5167

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 240  cagccagtccaggccttcatacagtccttcccc 272
            |||||||||||||||||| ||||| || |||||
Sbjct: 2327 cagccagtccaggccttcgtacagcccgtcccc 2295



to top

>gb|AC156543.10| Mus musculus chromosome 15, clone RP23-220F2, complete sequence
          Length = 199715

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 240    cagccagtccaggccttcatacagtccttcccc 272
              ||||||||||| |||||||||||| || |||||
Sbjct: 139630 cagccagtccaagccttcatacagcccgtcccc 139662



to top

>gb|M36340.1|HUMARF1BA Human ADP-ribosylation factor 1 (ARF1) mRNA, complete cds
          Length = 1816

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 600 tggacagccagtccagtccttcata 576



to top

>gb|M84326.1|HUMADPRFIA Human ADP-ribosylation factor 1 mRNA, complete cds
          Length = 1815

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||||||||||||||| ||||||||
Sbjct: 595 tggacagccagtccagtccttcata 571



to top

>gb|M84332.1|HUMADPRF2 Human ADP-ribosylation factor 1 gene, exons 2-5
          Length = 2558

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 236  tggacagccagtccaggccttcata 260
            |||||||||||||||| ||||||||
Sbjct: 1226 tggacagccagtccagtccttcata 1202



to top

>gb|M88287.1|BOVRIB2A Bos taurus ADP-ribosylation factor 2 mRNA, complete cds
          Length = 2268

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||| ||||||||||||||||||||
Sbjct: 608 tggagagccagtccaggccttcata 584



to top

>gb|J03794.1|BOVARF Bovine, ADP-ribosylation factor mRNA
          Length = 664

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 236 tggacagccagtccaggccttcata 260
           |||| ||||||||||||||||||||
Sbjct: 530 tggagagccagtccaggccttcata 506



to top

>gb|AC025256.33| Homo sapiens 12 BAC RP11-437F8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 53829

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 240   cagccagtccaggccttcatacagtccttcccc 272
             |||||||||||||||||| ||||| || |||||
Sbjct: 47518 cagccagtccaggccttcgtacagcccgtcccc 47486



to top

>dbj|D87900.1| Mus musculus mRNA for ARF3, complete cds
          Length = 775

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 240 cagccagtccaggccttcatacagtccttcccc 272
           ||||||||||| |||||||||||| || |||||
Sbjct: 716 cagccagtccaagccttcatacagcccgtcccc 684



to top

>gb|BT016788.1| Zea mays clone Contig621 mRNA sequence
          Length = 976

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           ||||||||||| |||||||| || || |||||||  ||||| || | |||||||||
Sbjct: 655 atgttgctggaaagccagtcaagcccctcatacaacccttcaccagatgtagcaca 600



to top

>gb|AC107843.10| Mus musculus chromosome 1, clone RP23-306B14, complete sequence
          Length = 180315

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      ttcagaaacatcttagggct 22
              ||||||||||||||||||||
Sbjct: 137193 ttcagaaacatcttagggct 137212



to top

>gb|AC123616.11| Mus musculus chromosome 8, clone RP23-4F1, complete sequence
          Length = 228851

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 132  tcccaacacaatccctaggt 151
            ||||||||||||||||||||
Sbjct: 3561 tcccaacacaatccctaggt 3542



to top

>ref|XM_421393.1| PREDICTED: Gallus gallus similar to hypothetical protein (LOC423488),
            mRNA
          Length = 6844

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 177  aagcgctcctagctctttca 196
            ||||||||||||||||||||
Sbjct: 1356 aagcgctcctagctctttca 1337



to top

>gb|AC148334.3| Mus musculus BAC clone RP23-213L20 from chromosome 13, complete sequence
          Length = 207106

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 80     ttgatctcaggaaaatacacagta 103
              |||||| |||||||||||||||||
Sbjct: 139092 ttgatcccaggaaaatacacagta 139115



to top

>gb|AC122528.3| Mus musculus BAC clone RP24-506F15 from chromosome 9, complete sequence
          Length = 142071

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   ttgctggacagccagtccag 251
             ||||||||||||||||||||
Sbjct: 53273 ttgctggacagccagtccag 53254



to top

>gb|AC140492.3| Mus musculus BAC clone RP24-137B3 from chromosome 5, complete sequence
          Length = 157199

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   ttgctggacagccagtccag 251
             ||||||||||||||||||||
Sbjct: 35234 ttgctggacagccagtccag 35215



to top

>gb|AC127551.7| Mus musculus BAC clone RP24-547H23 from chromosome 8, complete sequence
          Length = 204342

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   tcccaacacaatccctaggt 151
             ||||||||||||||||||||
Sbjct: 97605 tcccaacacaatccctaggt 97586



to top

>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete
             sequence
          Length = 131984

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 196   aaaatcttgatgaaaatttaggac 219
             ||||||||| ||||||||||||||
Sbjct: 99847 aaaatcttggtgaaaatttaggac 99824



to top

>gb|AY129558.1| Aeromonas hydrophila flg operon, complete sequence
          Length = 16829

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 222  gttggcaatgttgctggaca 241
            ||||||||||||||||||||
Sbjct: 3562 gttggcaatgttgctggaca 3543



to top

>emb|AL929359.1|PFA929359 Plasmodium falciparum strain 3D7, chromosome 9; segment 5/5
          Length = 281723

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   caaaatacaataaaacaata 42
            ||||||||||||||||||||
Sbjct: 6230 caaaatacaataaaacaata 6249



to top

>emb|BX470197.17| Zebrafish DNA sequence from clone CH211-14P21 in linkage group 2,
              complete sequence
          Length = 175989

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     aaaatacaataaaacaatag 43
              ||||||||||||||||||||
Sbjct: 129516 aaaatacaataaaacaatag 129497



to top

>gb|AC120193.4| Homo sapiens chromosome 8, clone RP11-10H17, complete sequence
          Length = 174556

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 21   ctcaaaatacaataaaacaa 40
            ||||||||||||||||||||
Sbjct: 2098 ctcaaaatacaataaaacaa 2117



to top

>emb|BX927397.10| Zebrafish DNA sequence from clone DKEY-87H7 in linkage group 7,
             complete sequence
          Length = 187890

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 22    tcaaaatacaataaaacaatagta 45
             ||||| ||||||||||||||||||
Sbjct: 65994 tcaaattacaataaaacaatagta 65971



to top

>gb|AC044891.4| Homo sapiens chromosome 8, clone RP11-624C23, complete sequence
          Length = 183651

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     ctcaaaatacaataaaacaa 40
              ||||||||||||||||||||
Sbjct: 152013 ctcaaaatacaataaaacaa 152032



to top

>gb|AC131108.3| Mus musculus BAC clone RP23-351K24 from chromosome 16, complete sequence
          Length = 175409

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 24     aaaatacaataaaacaatag 43
              ||||||||||||||||||||
Sbjct: 101597 aaaatacaataaaacaatag 101616



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 196      aaaatcttgatgaaaatttaggac 219
                ||||||||| ||||||||||||||
Sbjct: 18113281 aaaatcttggtgaaaatttaggac 18113304



to top

>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      ttcagaaacatcttagggct 22
              ||||||||||||||||||||
Sbjct: 194418 ttcagaaacatcttagggct 194399



to top

>gb|AY104231.1| Zea mays PCO085486 mRNA sequence
          Length = 993

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 atgttgctggacagccagtccaggccttcatacagtccttcccctgttgtagcaca 284
           ||||||||||| |||||||| || || |||||||  ||||| || | |||||||||
Sbjct: 676 atgttgctggaaagccagtcaagcccctcatacaacccttcaccagatgtagcaca 621



to top

>gb|DQ306769.1| Hevea brasiliensis isolate SSH40 mRNA sequence
          Length = 190

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 226 gcaatgttgctggacagccagtccaggccttcatacagtccttc 269
           ||||||||| | || ||||||| ||| || ||||||||||||||
Sbjct: 73  gcaatgttgtttgagagccagttcagtccctcatacagtccttc 30



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 196      aaaatcttgatgaaaatttaggac 219
                ||||||||| ||||||||||||||
Sbjct: 18122534 aaaatcttggtgaaaatttaggac 18122557



to top

>gb|AC151995.2| Mus musculus BAC clone RP23-152L21 from 16, complete sequence
          Length = 186505

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     aaaatacaataaaacaatag 43
              ||||||||||||||||||||
Sbjct: 171784 aaaatacaataaaacaatag 171765



to top

>gb|AC161499.2| Mus musculus chromosome 5, clone RP24-334E1, complete sequence
          Length = 163642

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   ttgctggacagccagtccag 251
             ||||||||||||||||||||
Sbjct: 43556 ttgctggacagccagtccag 43537



to top

>dbj|D10859.1|RICORFA Oryza sativa (japonica cultivar-group) mRNA for chilling tolerance
           related protein, complete cds, clone:pBC121
          Length = 455

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 219 cttgttggcaatgttgctggacagccagtccaggccttcataca 262
           |||| ||||||||||| |||| |||||||| || || |||||||
Sbjct: 167 cttgctggcaatgttgttggaaagccagtcaagaccctcataca 124


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,881,358
Number of Sequences: 3902068
Number of extensions: 2881358
Number of successful extensions: 77584
Number of sequences better than 10.0: 222
Number of HSP's better than 10.0 without gapping: 223
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77164
Number of HSP's gapped (non-prelim): 420
length of query: 284
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 262
effective length of database: 17,147,199,772
effective search space: 4492566340264
effective search space used: 4492566340264
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top