>ref|XM_740064.1| Plasmodium chabaudi chabaudi RNA helicase (PC000480.02.0) partial
           mRNA
          Length = 1443

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 29  attacaaaaaatataccatcga 50
           ||||||||||||||||||||||
Sbjct: 332 attacaaaaaatataccatcga 311

>emb|BX571947.8| Zebrafish DNA sequence from clone DKEY-162F21 in linkage group 10,
              complete sequence
          Length = 269153

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 95     ggaattgcacatgtgcacatg 115
              |||||||||||||||||||||
Sbjct: 257430 ggaattgcacatgtgcacatg 257450

>gb|AC105254.3| Homo sapiens BAC clone RP11-647P12 from 4, complete sequence
          Length = 176840

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 27    ggattacaaaaaatataccat 47
             |||||||||||||||||||||
Sbjct: 59243 ggattacaaaaaatataccat 59263

>gb|AC147383.4| Pan troglodytes BAC clone RP43-157C2 from 7, complete sequence
          Length = 190266

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   aaactttaggaatgaatgaa 235
             ||||||||||||||||||||
Sbjct: 94511 aaactttaggaatgaatgaa 94492

>gb|AC002540.1| Homo sapiens BAC clone GS1-25M2 from 7, complete sequence
          Length = 70851

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   aaactttaggaatgaatgaa 235
             ||||||||||||||||||||
Sbjct: 15179 aaactttaggaatgaatgaa 15160

>ref|XM_719267.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04107)
           partial mRNA
          Length = 1290

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 29  attacaaaaaatataccatc 48
           ||||||||||||||||||||
Sbjct: 179 attacaaaaaatataccatc 160

>ref|XM_665838.1| Plasmodium berghei strain ANKA ATP-dependant helicase
           (PB301452.00.0) partial mRNA
          Length = 741

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 29  attacaaaaaatataccatc 48
           ||||||||||||||||||||
Sbjct: 554 attacaaaaaatataccatc 535

>emb|AL354685.17| Human DNA sequence from clone RP13-75G22 on chromosome Xq21.33-22.2
             Contains the gene for a novel protein similar to envelope
             protein (LOC139302), a pseuodgene similar to part of
             NCK-associated protein 1 (NCKAP1) and a CpG island,
             complete sequence
          Length = 155166

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 220   tttaggaatgaatgaaaaga 239
             ||||||||||||||||||||
Sbjct: 95296 tttaggaatgaatgaaaaga 95277

>gb|AC091430.3| Homo sapiens chromosome 5 clone CTD-2207A17, complete sequence
          Length = 84143

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   ctttaggaatgaatgaaaag 238
             ||||||||||||||||||||
Sbjct: 74735 ctttaggaatgaatgaaaag 74754

>ref|XM_674424.1| Plasmodium berghei strain ANKA RNA helicase (PB001029.02.0), partial
            mRNA
          Length = 3489

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 29   attacaaaaaatataccatc 48
            ||||||||||||||||||||
Sbjct: 2378 attacaaaaaatataccatc 2359

>gb|AC169811.2| Rhesus Macaque CHR7 BAC CH250-119C16 (Children's Hospital Oakland
              Research Institute Rhesus macaque Adult Male BAC Library)
              complete sequence
          Length = 166377

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    aaactttaggaatgaatgaa 235
              ||||||||||||||||||||
Sbjct: 137651 aaactttaggaatgaatgaa 137670


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,631,620
Number of Sequences: 3902068
Number of extensions: 2631620
Number of successful extensions: 47242
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47229
Number of HSP's gapped (non-prelim): 13
length of query: 245
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 223
effective length of database: 17,147,199,772
effective search space: 3823825549156
effective search space used: 3823825549156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)