ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet57g03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 96 2e-17
2gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 1.1
3gb|AC171129.2| Helobdella robusta clone CH306-1A11, complete seq... 40 1.1
4emb|Z69792.1|CEF40E10 Caenorhabditis elegans Cosmid F40E10, comp... 40 1.1
5gb|AC091455.12| Mus musculus chromosome 1, clone RP23-23O9, comp... 38 4.5
6gb|AC132322.3| Mus musculus BAC clone RP24-262F3 from chromosome... 38 4.5
7gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete seq... 38 4.5
8gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete se... 38 4.5
9emb|AL357032.13| Human DNA sequence from clone RP11-432M2 on chr... 38 4.5
10gb|AC162866.5| Mus musculus chromosome 1, clone RP23-90B23, comp... 38 4.5
11emb|AL161511.2|ATCHRIV23 Arabidopsis thaliana DNA chromosome 4, ... 38 4.5
12emb|AL080252.2|ATT12G13 Arabidopsis thaliana DNA chromosome 4, B... 38 4.5
13emb|AL683804.15| Mouse DNA sequence from clone RP23-17F2 on chro... 38 4.5
14gb|AC128684.4| Homo sapiens 3 BAC RP11-117K16 (Roswell Park Canc... 38 4.5
15gb|AC006194.4| Arabidopsis thaliana chromosome 2 clone T17A11 ma... 38 4.5
16gb|AC109928.4| Homo sapiens BAC clone RP11-755F21 from 4, comple... 38 4.5
17gb|AC093694.4| Homo sapiens BAC clone RP11-769N3 from 4, complet... 38 4.5
18dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 4.5
19dbj|AP000836.1| Oryza sativa (japonica cultivar-group) genomic D... 38 4.5

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 66/72 (91%)
 Strand = Plus / Minus

                                                                        
Query: 9    gcacacaattctcataatttacatgttggtgttacaattcatctcacactcacatacaac 68
            |||||||||||||||| |||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 1082 gcacacaattctcatagtttacatgttggtgttacaattcaactgacactcacatacaat 1023

                        
Query: 69   tcgcattcatca 80
            | |||| |||||
Sbjct: 1022 ttgcatccatca 1011



to top

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
              sequence
          Length = 1783081

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     acaattctcataatttacat 32
              ||||||||||||||||||||
Sbjct: 675772 acaattctcataatttacat 675753



to top

>gb|AC171129.2| Helobdella robusta clone CH306-1A11, complete sequence
          Length = 90526

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    acacaattctcataatttac 30
             ||||||||||||||||||||
Sbjct: 69053 acacaattctcataatttac 69034



to top

>emb|Z69792.1|CEF40E10 Caenorhabditis elegans Cosmid F40E10, complete sequence
          Length = 27016

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 7    tcgcacacaattctcataatttac 30
            ||||||||| ||||||||||||||
Sbjct: 5764 tcgcacacatttctcataatttac 5787



to top

>gb|AC091455.12| Mus musculus chromosome 1, clone RP23-23O9, complete sequence
          Length = 257924

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 10    cacacaattctcataatttacat 32
             ||||||||||| |||||||||||
Sbjct: 67216 cacacaattctaataatttacat 67238



to top

>gb|AC132322.3| Mus musculus BAC clone RP24-262F3 from chromosome 13, complete sequence
          Length = 155179

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     cacaattctcataatttac 30
              |||||||||||||||||||
Sbjct: 140195 cacaattctcataatttac 140213



to top

>gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete sequence
          Length = 121648

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 28    tacatgttggtgttacaattcat 50
             ||||||||||| |||||||||||
Sbjct: 65456 tacatgttggttttacaattcat 65434



to top

>gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete sequence
          Length = 114519

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 28    tacatgttggtgttacaattcat 50
             ||||||||||| |||||||||||
Sbjct: 54433 tacatgttggttttacaattcat 54455



to top

>emb|AL357032.13| Human DNA sequence from clone RP11-432M2 on chromosome 9 Contains a
             novel gene, complete sequence
          Length = 115438

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    ctcacactcacatacaact 69
             |||||||||||||||||||
Sbjct: 57723 ctcacactcacatacaact 57741



to top

>gb|AC162866.5| Mus musculus chromosome 1, clone RP23-90B23, complete sequence
          Length = 230597

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 10   cacacaattctcataatttacat 32
            ||||||||||| |||||||||||
Sbjct: 6549 cacacaattctaataatttacat 6527



to top

>emb|AL161511.2|ATCHRIV23 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 23
          Length = 197306

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    acaattctcataatttaca 31
             |||||||||||||||||||
Sbjct: 12062 acaattctcataatttaca 12080



to top

>emb|AL080252.2|ATT12G13 Arabidopsis thaliana DNA chromosome 4, BAC clone T12G13, partial
             sequence (ESSA project)
          Length = 91226

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    acaattctcataatttaca 31
             |||||||||||||||||||
Sbjct: 76290 acaattctcataatttaca 76308



to top

>emb|AL683804.15| Mouse DNA sequence from clone RP23-17F2 on chromosome 1 Contains  a SEC61
              gamma subunit (Sec61g) pseudogene, a limb expression 1
              homolog (chicken) (Lix1) pseudogene, a novel pseudogene,
              the 5' end of the gene for an ortholog of human Ras
              association (RalGDS/AF-6) and pleckstrin homology domains 1
              RAPH1 and a CpG island, complete sequence
          Length = 198631

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 74     ttcatcactcctgtcttac 92
              |||||||||||||||||||
Sbjct: 132871 ttcatcactcctgtcttac 132889



to top

>gb|AC128684.4| Homo sapiens 3 BAC RP11-117K16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 80307

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 10    cacacaattctcataatttacat 32
             |||||||||| ||||||||||||
Sbjct: 40404 cacacaattcacataatttacat 40382



to top

>gb|AC006194.4| Arabidopsis thaliana chromosome 2 clone T17A11 map GPC6, complete
             sequence
          Length = 92260

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    acaattctcataatttaca 31
             |||||||||||||||||||
Sbjct: 69394 acaattctcataatttaca 69376



to top

>gb|AC109928.4| Homo sapiens BAC clone RP11-755F21 from 4, complete sequence
          Length = 112353

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    ttctcataatttacatgtt 35
             |||||||||||||||||||
Sbjct: 75641 ttctcataatttacatgtt 75623



to top

>gb|AC093694.4| Homo sapiens BAC clone RP11-769N3 from 4, complete sequence
          Length = 158566

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 17     ttctcataatttacatgtt 35
              |||||||||||||||||||
Sbjct: 147596 ttctcataatttacatgtt 147578



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                          
Query: 13      acaattctcataatttacatgttggtg 39
               |||||||||||||| |||| |||||||
Sbjct: 9684838 acaattctcataatctacaagttggtg 9684812



to top

>dbj|AP000836.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              clone:P0038F12
          Length = 190014

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 13     acaattctcataatttacatgttggtg 39
              |||||||||||||| |||| |||||||
Sbjct: 122841 acaattctcataatctacaagttggtg 122815


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 936,784
Number of Sequences: 3902068
Number of extensions: 936784
Number of successful extensions: 71679
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71624
Number of HSP's gapped (non-prelim): 55
length of query: 102
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 81
effective length of database: 17,151,101,840
effective search space: 1389239249040
effective search space used: 1389239249040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top