ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet57d07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC096887.2| Homo sapiens chromosome 3 clone RP11-5O17, comple... 44 0.11
2gb|AC025039.7| Homo sapiens chromosome 10 clone RP11-457M15, com... 44 0.11
3dbj|AB194045.1| Leptotrombidium akamushi mitochondrial DNA, comp... 44 0.11
4gb|AC018508.9| Homo sapiens chromosome 10 clone RP11-123L21, com... 44 0.11
5gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 40 1.8
6gb|AC160765.4| Mus musculus BAC clone RP23-26O24 from chromosome... 40 1.8
7gb|U41748.1| Caenorhabditis elegans cosmid C31H2, complete sequence 40 1.8
8gb|AC005165.1| Homo sapiens BAC clone CTA-242H14 from 7, complet... 40 1.8
9gb|AE014075.1| Escherichia coli CFT073, complete genome 40 1.8
10gb|CP000243.1| Escherichia coli UTI89, complete genome 40 1.8
11gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 40 1.8
12emb|X68301.1|ECNUOO E.coli DNA sequence of nuo operon 40 1.8
13gb|AE008804.1| Salmonella typhimurium LT2, section 108 of 220 of... 40 1.8
14emb|AL627274.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 1.8
15dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 40 1.8
16ref|NM_171677.1| Caenorhabditis elegans C31H2.1a (C31H2.1) mRNA,... 40 1.8
17ref|NM_171949.3| Caenorhabditis elegans C31H2.1b (C31H2.1) mRNA,... 40 1.8
18gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 40 1.8
19gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 1.8
20gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 1.8
21gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 1.8
22dbj|AP000741.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 1.8
23gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 40 1.8
24dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 40 1.8
25gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 40 1.8
26gb|CP000036.1| Shigella boydii Sb227, complete genome 40 1.8
27gb|CP000038.1| Shigella sonnei Ss046, complete genome 40 1.8
28gb|L22504.1|STYNUOD Salmonella typhimurium NADH dehydrogenase su... 40 1.8
29gb|L25055.1|ECONUOD Escherichia coli NADH dehydrogenase (nuoD), ... 40 1.8
30gb|AC110895.14| Mus musculus chromosome 1, clone RP24-159G18, co... 38 6.9
31ref|XM_322438.1| Neurospora crassa OR74A predicted protein (NCU0... 38 6.9
32ref|XM_952731.1| Neurospora crassa OR74A hypothetical protein (N... 38 6.9
33gb|AY519420.1| Myrmecocystus cf. mendax DJCK-2004 cytochrome oxi... 38 6.9
34gb|AY519403.1| Myrmecocystus flaviceps cytochrome oxidase subuni... 38 6.9
35gb|AF287133.1| Schmidtea polychroa isolate Sp2co1hp31p44 cytochr... 38 6.9
36gb|AF287132.1| Schmidtea polychroa isolate Sp3co1hp30p34 cytochr... 38 6.9
37gb|AF287131.1| Schmidtea polychroa isolate Sp2co1hp29p03 cytochr... 38 6.9
38gb|AF287130.1| Schmidtea polychroa isolate Sp2co1hp28p05 cytochr... 38 6.9
39gb|AF287129.1| Schmidtea polychroa isolate Sp3co1hp27p30 cytochr... 38 6.9
40gb|AF287128.1| Schmidtea polychroa isolate Sp3co1hp26p11 cytochr... 38 6.9
41gb|AF287127.1| Schmidtea polychroa isolate Sp3co1hp25p08 cytochr... 38 6.9
42gb|AF287126.1| Schmidtea polychroa isolate Sp4co1hp24p22 cytochr... 38 6.9
43gb|AF287125.1| Schmidtea polychroa isolate Sp2co1hp23p14 cytochr... 38 6.9
44gb|AF287124.1| Schmidtea polychroa isolate Sp2co1hp22p02 cytochr... 38 6.9
45gb|AF287123.1| Schmidtea polychroa isolate Sp3co1hp21p27 cytochr... 38 6.9
46gb|AF287122.1| Schmidtea polychroa isolate Sp3co1hp21p26 cytochr... 38 6.9
47gb|AF287121.1| Schmidtea polychroa isolate Sp3co1hp20p29 cytochr... 38 6.9
48gb|AF287120.1| Schmidtea polychroa isolate Sp4co1hp19p13 cytochr... 38 6.9
49gb|AF287119.1| Schmidtea polychroa isolate Sp4co1hp19p14 cytochr... 38 6.9
50gb|AF287118.1| Schmidtea polychroa isolate Sp4co1hp19p15 cytochr... 38 6.9
51gb|AF287117.1| Schmidtea polychroa isolate Sp2co1hp18p15 cytochr... 38 6.9
52gb|AF287116.1| Schmidtea polychroa isolate Sp4co1hp17p07 cytochr... 38 6.9
53gb|AF287115.1| Schmidtea polychroa isolate Sp3co1hp17p07 cytochr... 38 6.9
54gb|AF287114.1| Schmidtea polychroa isolate Sp3co1hp17p18 cytochr... 38 6.9
55gb|AF287113.1| Schmidtea polychroa isolate Sp2co1hp16p03 cytochr... 38 6.9
56gb|AF287112.1| Schmidtea polychroa isolate Sp2co1hp15p01 cytochr... 38 6.9
57gb|AF287111.1| Schmidtea polychroa isolate Sp4co1hp14p06 cytochr... 38 6.9
58gb|AF287110.1| Schmidtea polychroa isolate Sp3co1hp14p06 cytochr... 38 6.9
59gb|AF287109.1| Schmidtea polychroa isolate Sp2co1hp14p06 cytochr... 38 6.9
60gb|AF287108.1| Schmidtea polychroa isolate Sp3co1hp14p01 cytochr... 38 6.9
61gb|AF287107.1| Schmidtea polychroa isolate Sp3co1hp13p27 cytochr... 38 6.9
62gb|AF287106.1| Schmidtea polychroa isolate Sp3co1hp12p27 cytochr... 38 6.9
63gb|AF287105.1| Schmidtea polychroa isolate Sp2co1hp11p05 cytochr... 38 6.9
64gb|AF287104.1| Schmidtea polychroa isolate Sp2co1hp10p05 cytochr... 38 6.9
65gb|AF287103.1| Schmidtea polychroa isolate Sp2co1hp09p40 cytochr... 38 6.9
66gb|AF287102.1| Schmidtea polychroa isolate Sp2co1hp09p38 cytochr... 38 6.9
67gb|AF287101.1| Schmidtea polychroa isolate Sp3co1hp08p33 cytochr... 38 6.9
68gb|AF287100.1| Schmidtea polychroa isolate Sp3co1hp08p35 cytochr... 38 6.9
69gb|AF287099.1| Schmidtea polychroa isolate Sp3co1hp08p27 cytochr... 38 6.9
70gb|AF287098.1| Schmidtea polychroa isolate Sp3co1hp08p21 cytochr... 38 6.9
71gb|AF287097.1| Schmidtea polychroa isolate Sp3co1hp08p18 cytochr... 38 6.9
72gb|AF287096.1| Schmidtea polychroa isolate Sp4co1hp07p01 cytochr... 38 6.9
73gb|AF287095.1| Schmidtea polychroa isolate Sp3co1hp07p01 cytochr... 38 6.9
74gb|AF287094.1| Schmidtea polychroa isolate Sp2co1hp07p01 cytochr... 38 6.9
75gb|AF287093.1| Schmidtea polychroa isolate Sp3co1hp06p07 cytochr... 38 6.9
76gb|AF287092.1| Schmidtea polychroa isolate Sp3co1hp06p08 cytochr... 38 6.9
77gb|AF287091.1| Schmidtea polychroa isolate Sp3co1hp06p11 cytochr... 38 6.9
78gb|AF287090.1| Schmidtea polychroa isolate Sp3co1hp06p10 cytochr... 38 6.9
79gb|AF287089.1| Schmidtea polychroa isolate Sp4co1hp06p01 cytochr... 38 6.9
80gb|AF287088.1| Schmidtea polychroa isolate Sp3co1hp06p01 cytochr... 38 6.9
81gb|AF287087.1| Schmidtea polychroa isolate Sp4co1hp06p12 cytochr... 38 6.9
82gb|AF287086.1| Schmidtea polychroa isolate Sp3co1hp05p10 cytochr... 38 6.9
83gb|AF287085.1| Schmidtea polychroa isolate Sp4co1hp04p24 cytochr... 38 6.9
84gb|AF287084.1| Schmidtea polychroa isolate Sp3co1hp04p24 cytochr... 38 6.9
85gb|AF287083.1| Schmidtea polychroa isolate Sp3co1hp04p26 cytochr... 38 6.9
86gb|AF287082.1| Schmidtea polychroa isolate Sp2co1hp03p03 cytochr... 38 6.9
87gb|AF287081.1| Schmidtea polychroa isolate Sp3co1hp03p24 cytochr... 38 6.9
88gb|AF287080.1| Schmidtea polychroa isolate Sp3co1hp03p03 cytochr... 38 6.9
89gb|AF287079.1| Schmidtea polychroa isolate Sp3co1hp03p23 cytochr... 38 6.9
90gb|AF287078.1| Schmidtea polychroa isolate Sp4co1hp03p33 cytochr... 38 6.9
91gb|AF287077.1| Schmidtea polychroa isolate Sp3co1hp03p33 cytochr... 38 6.9
92gb|AF287076.1| Schmidtea polychroa isolate Sp3co1hp03p43 cytochr... 38 6.9
93gb|AF287075.1| Schmidtea polychroa isolate Sp4co1hp03p32 cytochr... 38 6.9
94gb|AF287074.1| Schmidtea polychroa isolate Sp3co1hp03p32 cytochr... 38 6.9
95gb|AF287073.1| Schmidtea polychroa isolate Sp3co1hp03p25 cytochr... 38 6.9
96gb|AF287072.1| Schmidtea polychroa isolate Sp3co1hp03p09 cytochr... 38 6.9
97gb|AF287071.1| Schmidtea polychroa isolate Sp4co1hp03p08 cytochr... 38 6.9
98gb|AF287070.1| Schmidtea polychroa isolate Sp3co1hp03p08 cytochr... 38 6.9
99gb|AF287069.1| Schmidtea polychroa isolate Sp2co1hp03p05 cytochr... 38 6.9
100gb|AF287068.1| Schmidtea polychroa isolate Sp3co1hp03p10 cytochr... 38 6.9
101gb|AF287067.1| Schmidtea polychroa isolate Sp4co1hp03p06 cytochr... 38 6.9
102gb|AF287066.1| Schmidtea polychroa isolate Sp3co1hp03p06 cytochr... 38 6.9
103gb|AF287065.1| Schmidtea polychroa isolate Sp2co1hp03p06 cytochr... 38 6.9
104gb|AF287064.1| Schmidtea polychroa isolate Sp2co1hp03p28 cytochr... 38 6.9
105gb|AF287063.1| Schmidtea polychroa isolate Sp4co1hp03p21 cytochr... 38 6.9
106gb|AF287062.1| Schmidtea polychroa isolate Sp3co1hp03p21 cytochr... 38 6.9
107gb|AF287061.1| Schmidtea polychroa isolate Sp3co1hp03p19 cytochr... 38 6.9
108gb|AF287060.1| Schmidtea polychroa isolate Sp3co1hp03p18 cytochr... 38 6.9
109gb|AF287059.1| Schmidtea polychroa isolate Sp2co1hp02p17 cytochr... 38 6.9
110gb|AF287058.1| Schmidtea polychroa isolate Sp2co1hp02p16 cytochr... 38 6.9
111gb|AF287057.1| Schmidtea polychroa isolate Sp2co1hp01p03 cytochr... 38 6.9
112gb|AF287056.1| Schmidtea polychroa isolate Sp2co1hp01p04 cytochr... 38 6.9
113gb|AF287055.1| Schmidtea polychroa isolate Sp2co1hp01p02 cytochr... 38 6.9
114gb|AF287054.1| Schmidtea polychroa isolate Sp3co1hp01p01 cytochr... 38 6.9
115gb|AF287053.1| Schmidtea polychroa isolate Sp2co1hp01p01 cytochr... 38 6.9
116gb|AF287052.1| Schmidtea polychroa isolate Sp2co1hp01p12 cytochr... 38 6.9
117gb|AC073927.9| Homo sapiens BAC clone RP11-604B16 from 7, comple... 38 6.9
118gb|AC109213.6| Mus musculus chromosome 16, clone RP23-345L20, co... 38 6.9
119emb|AL354855.26| Human DNA sequence from clone RP11-643E14 on ch... 38 6.9
120gb|AY131110.1| Scyphophorus yuccae cytochrome oxidase subunit I ... 38 6.9
121emb|AL136109.11| Human DNA sequence from clone RP5-924G13 on chr... 38 6.9
122gb|AC158773.6| Mus musculus chromosome 1, clone RP23-324F10, com... 38 6.9
123emb|AL163972.1|ATT5P19 Arabidopsis thaliana DNA chromosome 3, BA... 38 6.9
124gb|AY118535.1| Drosophila melanogaster LD26789 full insert cDNA 38 6.9
125ref|NM_134495.2| Drosophila melanogaster Ranbp21 CG12234-RA (Ran... 38 6.9
126gb|AC008361.8|AC008361 Drosophila melanogaster, chromosome 3R, r... 38 6.9
127gb|AC010671.8|AC010671 Drosophila melanogaster, chromosome X, re... 38 6.9
128dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 38 6.9
129gb|AF178323.1|AF178323 Dugesia polychroa cytochrome oxidase C su... 38 6.9
130gb|AF239221.1|AF239221 Stemonitis flavogenita cytochrome c oxida... 38 6.9
131gb|AF222746.1| Drosophila melanogaster RanBP21 mRNA, complete cds 38 6.9
132dbj|AP004583.3| Oryza sativa (japonica cultivar-group) genomic D... 38 6.9
133gb|AE003720.3| Drosophila melanogaster chromosome 3R, section 58... 38 6.9
134gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 ... 38 6.9
135emb|AL772205.12| Mouse DNA sequence from clone RP23-162C3 on chr... 38 6.9
136gb|AY510617.1| Pogonomyrmex imberbiculus isolate Pimberbicu cyto... 38 6.9
137gb|AY510616.1| Pogonomyrmex imberbiculus isolate Eimberbicu cyto... 38 6.9
138gb|AY510615.1| Pogonomyrmex imberbiculus isolate Eimberb313 cyto... 38 6.9

>gb|AC096887.2| Homo sapiens chromosome 3 clone RP11-5O17, complete sequence
          Length = 171289

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 50     tagggggatccaaccatggagc 71
              ||||||||||||||||||||||
Sbjct: 130238 tagggggatccaaccatggagc 130259



to top

>gb|AC025039.7| Homo sapiens chromosome 10 clone RP11-457M15, complete sequence
          Length = 172790

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 2     caaaatcaacaatgacagtaga 23
             ||||||||||||||||||||||
Sbjct: 23962 caaaatcaacaatgacagtaga 23983



to top

>dbj|AB194045.1| Leptotrombidium akamushi mitochondrial DNA, complete genome
          Length = 13698

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 110  tgttgattctcgtgcatacttt 131
            ||||||||||||||||||||||
Sbjct: 1892 tgttgattctcgtgcatacttt 1913



to top

>gb|AC018508.9| Homo sapiens chromosome 10 clone RP11-123L21, complete sequence
          Length = 149901

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 2     caaaatcaacaatgacagtaga 23
             ||||||||||||||||||||||
Sbjct: 52068 caaaatcaacaatgacagtaga 52047



to top

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2410147 gttgttgattctcgtgcata 2410166



to top

>gb|AC160765.4| Mus musculus BAC clone RP23-26O24 from chromosome 13, complete sequence
          Length = 234761

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 61     aaccatggagccagccaacc 80
              ||||||||||||||||||||
Sbjct: 187964 aaccatggagccagccaacc 187945



to top

>gb|U41748.1| Caenorhabditis elegans cosmid C31H2, complete sequence
          Length = 40553

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    gacgaagttacatctcgtcc 48
             ||||||||||||||||||||
Sbjct: 23285 gacgaagttacatctcgtcc 23304



to top

>gb|AC005165.1| Homo sapiens BAC clone CTA-242H14 from 7, complete sequence
          Length = 155164

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     caaaatcaacaatgacagta 21
             ||||||||||||||||||||
Sbjct: 47611 caaaatcaacaatgacagta 47592



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2684539 gttgttgattctcgtgcata 2684558



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2534176 gttgttgattctcgtgcata 2534195



to top

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2400056 gttgttgattctcgtgcata 2400075



to top

>emb|X68301.1|ECNUOO E.coli DNA sequence of nuo operon
          Length = 15865

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  gttgttgattctcgtgcata 127
            ||||||||||||||||||||
Sbjct: 3407 gttgttgattctcgtgcata 3388



to top

>gb|AE008804.1| Salmonella typhimurium LT2, section 108 of 220 of the complete genome
          Length = 20092

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   gttgttgattctcgtgcata 127
             ||||||||||||||||||||
Sbjct: 12582 gttgttgattctcgtgcata 12601



to top

>emb|AL627274.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
             complete chromosome; segment 10/20
          Length = 256050

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   gttgttgattctcgtgcata 127
             ||||||||||||||||||||
Sbjct: 90492 gttgttgattctcgtgcata 90511



to top

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2406704 gttgttgattctcgtgcata 2406723



to top

>ref|NM_171677.1| Caenorhabditis elegans C31H2.1a (C31H2.1) mRNA, complete cds
          Length = 2091

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 29   gacgaagttacatctcgtcc 48
            ||||||||||||||||||||
Sbjct: 1468 gacgaagttacatctcgtcc 1487



to top

>ref|NM_171949.3| Caenorhabditis elegans C31H2.1b (C31H2.1) mRNA, complete cds
          Length = 2398

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 29   gacgaagttacatctcgtcc 48
            ||||||||||||||||||||
Sbjct: 1323 gacgaagttacatctcgtcc 1342



to top

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2389604 gttgttgattctcgtgcata 2389623



to top

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 108    gttgttgattctcgtgcata 127
              ||||||||||||||||||||
Sbjct: 611452 gttgttgattctcgtgcata 611433



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 108    gttgttgattctcgtgcata 127
              ||||||||||||||||||||
Sbjct: 613220 gttgttgattctcgtgcata 613201



to top

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2450863 gttgttgattctcgtgcata 2450882



to top

>dbj|AP000741.4| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-63O14, complete
              sequence
          Length = 156136

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 66     tggagccagccaaccagccc 85
              ||||||||||||||||||||
Sbjct: 133637 tggagccagccaaccagccc 133618



to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 3198160 gttgttgattctcgtgcata 3198179



to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 3128204 gttgttgattctcgtgcata 3128223



to top

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2281789 gttgttgattctcgtgcata 2281808



to top

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2308852 gttgttgattctcgtgcata 2308871



to top

>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gttgttgattctcgtgcata 127
               ||||||||||||||||||||
Sbjct: 2473034 gttgttgattctcgtgcata 2473053



to top

>gb|L22504.1|STYNUOD Salmonella typhimurium NADH dehydrogenase subunits nuoD, nuoG and
           nuoE, nuoF (nuo) genes, complete cds
          Length = 3950

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 108 gttgttgattctcgtgcata 127
           ||||||||||||||||||||
Sbjct: 267 gttgttgattctcgtgcata 248



to top

>gb|L25055.1|ECONUOD Escherichia coli NADH dehydrogenase (nuoD), (nuoE), (nuoF), (nuoG)
            gene, complete cds
          Length = 3667

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  gttgttgattctcgtgcata 127
            ||||||||||||||||||||
Sbjct: 1290 gttgttgattctcgtgcata 1271



to top

>gb|AC110895.14| Mus musculus chromosome 1, clone RP24-159G18, complete sequence
          Length = 186137

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    ccatggagccagccaacca 81
             |||||||||||||||||||
Sbjct: 53518 ccatggagccagccaacca 53536



to top

>ref|XM_322438.1| Neurospora crassa OR74A predicted protein (NCU00353.1) partial mRNA
          Length = 534

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 68  gagccagccaaccagcccg 86
           |||||||||||||||||||
Sbjct: 346 gagccagccaaccagcccg 364



to top

>ref|XM_952731.1| Neurospora crassa OR74A hypothetical protein (NCU00353.1) partial
           mRNA
          Length = 534

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 68  gagccagccaaccagcccg 86
           |||||||||||||||||||
Sbjct: 346 gagccagccaaccagcccg 364



to top

>gb|AY519420.1| Myrmecocystus cf. mendax DJCK-2004 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 360

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||| ||||||||||||||
Sbjct: 148 ttagatgttgatactcgtgcatacttt 174



to top

>gb|AY519403.1| Myrmecocystus flaviceps cytochrome oxidase subunit I (COI) gene,
           partial cds; mitochondrial
          Length = 363

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||| ||||||||||||||
Sbjct: 151 ttagatgttgatactcgtgcatacttt 177



to top

>gb|AF287133.1| Schmidtea polychroa isolate Sp2co1hp31p44 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287132.1| Schmidtea polychroa isolate Sp3co1hp30p34 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287131.1| Schmidtea polychroa isolate Sp2co1hp29p03 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287130.1| Schmidtea polychroa isolate Sp2co1hp28p05 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287129.1| Schmidtea polychroa isolate Sp3co1hp27p30 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287128.1| Schmidtea polychroa isolate Sp3co1hp26p11 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287127.1| Schmidtea polychroa isolate Sp3co1hp25p08 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287126.1| Schmidtea polychroa isolate Sp4co1hp24p22 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287125.1| Schmidtea polychroa isolate Sp2co1hp23p14 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287124.1| Schmidtea polychroa isolate Sp2co1hp22p02 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287123.1| Schmidtea polychroa isolate Sp3co1hp21p27 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287122.1| Schmidtea polychroa isolate Sp3co1hp21p26 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287121.1| Schmidtea polychroa isolate Sp3co1hp20p29 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287120.1| Schmidtea polychroa isolate Sp4co1hp19p13 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287119.1| Schmidtea polychroa isolate Sp4co1hp19p14 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287118.1| Schmidtea polychroa isolate Sp4co1hp19p15 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287117.1| Schmidtea polychroa isolate Sp2co1hp18p15 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287116.1| Schmidtea polychroa isolate Sp4co1hp17p07 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287115.1| Schmidtea polychroa isolate Sp3co1hp17p07 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287114.1| Schmidtea polychroa isolate Sp3co1hp17p18 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287113.1| Schmidtea polychroa isolate Sp2co1hp16p03 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287112.1| Schmidtea polychroa isolate Sp2co1hp15p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287111.1| Schmidtea polychroa isolate Sp4co1hp14p06 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287110.1| Schmidtea polychroa isolate Sp3co1hp14p06 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287109.1| Schmidtea polychroa isolate Sp2co1hp14p06 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287108.1| Schmidtea polychroa isolate Sp3co1hp14p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287107.1| Schmidtea polychroa isolate Sp3co1hp13p27 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287106.1| Schmidtea polychroa isolate Sp3co1hp12p27 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287105.1| Schmidtea polychroa isolate Sp2co1hp11p05 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287104.1| Schmidtea polychroa isolate Sp2co1hp10p05 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287103.1| Schmidtea polychroa isolate Sp2co1hp09p40 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287102.1| Schmidtea polychroa isolate Sp2co1hp09p38 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287101.1| Schmidtea polychroa isolate Sp3co1hp08p33 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287100.1| Schmidtea polychroa isolate Sp3co1hp08p35 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287099.1| Schmidtea polychroa isolate Sp3co1hp08p27 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287098.1| Schmidtea polychroa isolate Sp3co1hp08p21 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287097.1| Schmidtea polychroa isolate Sp3co1hp08p18 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287096.1| Schmidtea polychroa isolate Sp4co1hp07p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287095.1| Schmidtea polychroa isolate Sp3co1hp07p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287094.1| Schmidtea polychroa isolate Sp2co1hp07p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287093.1| Schmidtea polychroa isolate Sp3co1hp06p07 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287092.1| Schmidtea polychroa isolate Sp3co1hp06p08 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287091.1| Schmidtea polychroa isolate Sp3co1hp06p11 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287090.1| Schmidtea polychroa isolate Sp3co1hp06p10 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287089.1| Schmidtea polychroa isolate Sp4co1hp06p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287088.1| Schmidtea polychroa isolate Sp3co1hp06p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287087.1| Schmidtea polychroa isolate Sp4co1hp06p12 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287086.1| Schmidtea polychroa isolate Sp3co1hp05p10 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287085.1| Schmidtea polychroa isolate Sp4co1hp04p24 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287084.1| Schmidtea polychroa isolate Sp3co1hp04p24 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287083.1| Schmidtea polychroa isolate Sp3co1hp04p26 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287082.1| Schmidtea polychroa isolate Sp2co1hp03p03 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287081.1| Schmidtea polychroa isolate Sp3co1hp03p24 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287080.1| Schmidtea polychroa isolate Sp3co1hp03p03 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287079.1| Schmidtea polychroa isolate Sp3co1hp03p23 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287078.1| Schmidtea polychroa isolate Sp4co1hp03p33 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287077.1| Schmidtea polychroa isolate Sp3co1hp03p33 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287076.1| Schmidtea polychroa isolate Sp3co1hp03p43 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287075.1| Schmidtea polychroa isolate Sp4co1hp03p32 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287074.1| Schmidtea polychroa isolate Sp3co1hp03p32 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287073.1| Schmidtea polychroa isolate Sp3co1hp03p25 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287072.1| Schmidtea polychroa isolate Sp3co1hp03p09 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287071.1| Schmidtea polychroa isolate Sp4co1hp03p08 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287070.1| Schmidtea polychroa isolate Sp3co1hp03p08 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287069.1| Schmidtea polychroa isolate Sp2co1hp03p05 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287068.1| Schmidtea polychroa isolate Sp3co1hp03p10 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287067.1| Schmidtea polychroa isolate Sp4co1hp03p06 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287066.1| Schmidtea polychroa isolate Sp3co1hp03p06 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287065.1| Schmidtea polychroa isolate Sp2co1hp03p06 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287064.1| Schmidtea polychroa isolate Sp2co1hp03p28 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287063.1| Schmidtea polychroa isolate Sp4co1hp03p21 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287062.1| Schmidtea polychroa isolate Sp3co1hp03p21 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287061.1| Schmidtea polychroa isolate Sp3co1hp03p19 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287060.1| Schmidtea polychroa isolate Sp3co1hp03p18 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287059.1| Schmidtea polychroa isolate Sp2co1hp02p17 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287058.1| Schmidtea polychroa isolate Sp2co1hp02p16 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287057.1| Schmidtea polychroa isolate Sp2co1hp01p03 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287056.1| Schmidtea polychroa isolate Sp2co1hp01p04 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287055.1| Schmidtea polychroa isolate Sp2co1hp01p02 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287054.1| Schmidtea polychroa isolate Sp3co1hp01p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287053.1| Schmidtea polychroa isolate Sp2co1hp01p01 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AF287052.1| Schmidtea polychroa isolate Sp2co1hp01p12 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 385

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 161 ttagatgttgattctcgtgcttacttt 187



to top

>gb|AC073927.9| Homo sapiens BAC clone RP11-604B16 from 7, complete sequence
          Length = 185676

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     aacaatgacagtagatatt 27
             |||||||||||||||||||
Sbjct: 53285 aacaatgacagtagatatt 53267



to top

>gb|AC109213.6| Mus musculus chromosome 16, clone RP23-345L20, complete sequence
          Length = 244558

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     acagtagatattagacgaa 34
              |||||||||||||||||||
Sbjct: 150657 acagtagatattagacgaa 150639



to top

>emb|AL354855.26| Human DNA sequence from clone RP11-643E14 on chromosome 9 Contains a
            novel gene (MGC12921), the 5' end of a novel gene
            (KIAA0515) and three CpG islands, complete sequence
          Length = 112849

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 58   tccaaccatggagccagcc 76
            |||||||||||||||||||
Sbjct: 3723 tccaaccatggagccagcc 3705



to top

>gb|AY131110.1| Scyphophorus yuccae cytochrome oxidase subunit I (COI) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1326

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||| ||||||||||||||
Sbjct: 870 ttagatgttgatactcgtgcatacttt 896



to top

>emb|AL136109.11| Human DNA sequence from clone RP5-924G13 on chromosome 1 Contains a
             novel gene (KIAA1221) and a ribosomal protein L5 (RPL5)
             pseudogene, complete sequence
          Length = 126367

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 2     caaaatcaacaatgacagt 20
             |||||||||||||||||||
Sbjct: 66540 caaaatcaacaatgacagt 66558



to top

>gb|AC158773.6| Mus musculus chromosome 1, clone RP23-324F10, complete sequence
          Length = 230988

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    ccatggagccagccaacca 81
             |||||||||||||||||||
Sbjct: 43032 ccatggagccagccaacca 43014



to top

>emb|AL163972.1|ATT5P19 Arabidopsis thaliana DNA chromosome 3, BAC clone T5P19
          Length = 101539

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     acaaaatcaacaatgacag 19
             |||||||||||||||||||
Sbjct: 92495 acaaaatcaacaatgacag 92477



to top

>gb|AY118535.1| Drosophila melanogaster LD26789 full insert cDNA
          Length = 5135

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  tggagccagccaaccagcc 84
           |||||||||||||||||||
Sbjct: 288 tggagccagccaaccagcc 270



to top

>ref|NM_134495.2| Drosophila melanogaster Ranbp21 CG12234-RA (Ranbp21), mRNA
          Length = 5257

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  tggagccagccaaccagcc 84
           |||||||||||||||||||
Sbjct: 424 tggagccagccaaccagcc 406



to top

>gb|AC008361.8|AC008361 Drosophila melanogaster, chromosome 3R, region 90D-90D, BAC clone
             BACR35E22, complete sequence
          Length = 177471

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 9     aacaatgacagtagatatt 27
             |||||||||||||||||||
Sbjct: 46566 aacaatgacagtagatatt 46584



to top

>gb|AC010671.8|AC010671 Drosophila melanogaster, chromosome X, region 18E-18F, BAC clone
             BACR33M08, complete sequence
          Length = 180263

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tggagccagccaaccagcc 84
             |||||||||||||||||||
Sbjct: 48505 tggagccagccaaccagcc 48523



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 126      tactttcctgatctctgtt 144
                |||||||||||||||||||
Sbjct: 11716549 tactttcctgatctctgtt 11716567



to top

>gb|AF178323.1|AF178323 Dugesia polychroa cytochrome oxidase C subunit I (COI) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 384

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||||||||||| ||||||
Sbjct: 160 ttagatgttgattctcgtgcttacttt 186



to top

>gb|AF239221.1|AF239221 Stemonitis flavogenita cytochrome c oxidase subunit 1 (COI) mRNA,
            complete cds; mitochondrial gene for mitochondrial
            product
          Length = 1858

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 105  ttagttgttgattctcgtgcatacttt 131
            |||| ||||||| ||||||||||||||
Sbjct: 989  ttagatgttgatactcgtgcatacttt 1015



to top

>gb|AF222746.1| Drosophila melanogaster RanBP21 mRNA, complete cds
          Length = 5145

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  tggagccagccaaccagcc 84
           |||||||||||||||||||
Sbjct: 297 tggagccagccaaccagcc 279



to top

>dbj|AP004583.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0005N06
          Length = 140639

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 126   tactttcctgatctctgtt 144
             |||||||||||||||||||
Sbjct: 65091 tactttcctgatctctgtt 65109



to top

>gb|AE003720.3| Drosophila melanogaster chromosome 3R, section 58 of 118 of the
             complete sequence
          Length = 228842

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 9     aacaatgacagtagatatt 27
             |||||||||||||||||||
Sbjct: 31442 aacaatgacagtagatatt 31460



to top

>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete
              sequence
          Length = 346474

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     tggagccagccaaccagcc 84
              |||||||||||||||||||
Sbjct: 298418 tggagccagccaaccagcc 298436



to top

>emb|AL772205.12| Mouse DNA sequence from clone RP23-162C3 on chromosome 2, complete
             sequence
          Length = 142565

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 124   catactttcctgatctctg 142
             |||||||||||||||||||
Sbjct: 49837 catactttcctgatctctg 49855



to top

>gb|AY510617.1| Pogonomyrmex imberbiculus isolate Pimberbicu cytochrome c oxidase
           subunit I (coxI) gene, partial cds; mitochondrial
          Length = 369

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||| ||||||||||||||
Sbjct: 164 ttagatgttgatactcgtgcatacttt 190



to top

>gb|AY510616.1| Pogonomyrmex imberbiculus isolate Eimberbicu cytochrome c oxidase
           subunit I (coxI) gene, partial cds; mitochondrial
          Length = 1054

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||| ||||||||||||||
Sbjct: 842 ttagatgttgatactcgtgcatacttt 868



to top

>gb|AY510615.1| Pogonomyrmex imberbiculus isolate Eimberb313 cytochrome c oxidase
           subunit I (coxI) gene, partial cds; mitochondrial
          Length = 1047

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 105 ttagttgttgattctcgtgcatacttt 131
           |||| ||||||| ||||||||||||||
Sbjct: 840 ttagatgttgatactcgtgcatacttt 866


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 953,683
Number of Sequences: 3902068
Number of extensions: 953683
Number of successful extensions: 64543
Number of sequences better than 10.0: 138
Number of HSP's better than 10.0 without gapping: 138
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64221
Number of HSP's gapped (non-prelim): 322
length of query: 145
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 124
effective length of database: 17,151,101,840
effective search space: 2126736628160
effective search space used: 2126736628160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top