ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet57d01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC161808.8| Mus musculus chromosome 5, clone RP24-386J15, com... 42 0.34
2emb|AL591970.10| Mouse DNA sequence from clone RP23-190L21 on ch... 40 1.3
3gb|AC123060.4| Mus musculus chromosome 6 clone RP23-214M22, comp... 38 5.3
4gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosom... 38 5.3
5emb|CT009506.5| Pig DNA sequence from clone CH242-216I3 on chrom... 38 5.3
6emb|AL157714.8| Human DNA sequence from clone RP11-541H12 on chr... 38 5.3
7emb|AL645727.16| Mouse DNA sequence from clone RP23-20G7 on chro... 38 5.3
8emb|AL627261.10| Zebrafish DNA sequence from clone RP71-1N11 in ... 38 5.3
9ref|XM_392340.2| PREDICTED: Apis mellifera similar to guanine nu... 38 5.3
10gb|AC019044.6| Homo sapiens BAC clone RP11-12F4 from 2, complete... 38 5.3
11gb|AC149608.4| Mus musculus BAC clone RP23-436E6 from 8, complet... 38 5.3

>gb|AC161808.8| Mus musculus chromosome 5, clone RP24-386J15, complete sequence
          Length = 184815

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 25    tgaaccatctgtgcttcttcctata 49
             ||||||||||||||||||| |||||
Sbjct: 88850 tgaaccatctgtgcttctttctata 88874



to top

>emb|AL591970.10| Mouse DNA sequence from clone RP23-190L21 on chromosome 2, complete
             sequence
          Length = 165908

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    tcatgaaccatctgtgcttc 41
             ||||||||||||||||||||
Sbjct: 97688 tcatgaaccatctgtgcttc 97707



to top

>gb|AC123060.4| Mus musculus chromosome 6 clone RP23-214M22, complete sequence
          Length = 210248

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 91    ggagtacaccgccaccacc 109
             |||||||||||||||||||
Sbjct: 51040 ggagtacaccgccaccacc 51022



to top

>gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosome 6, complete sequence
          Length = 211910

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 91     ggagtacaccgccaccacc 109
              |||||||||||||||||||
Sbjct: 208912 ggagtacaccgccaccacc 208894



to top

>emb|CT009506.5| Pig DNA sequence from clone CH242-216I3 on chromosome 17, complete
             sequence
          Length = 108192

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    cacatccacgccctctgga 78
             |||||||||||||||||||
Sbjct: 48451 cacatccacgccctctgga 48469



to top

>emb|AL157714.8| Human DNA sequence from clone RP11-541H12 on chromosome 1q22-23.3
             Contains the part of a novel gene (FLJ35813), a px19-like
             protein (PX19) pseudogene and the gene for a novel protein
             (FLJ25811), complete sequence
          Length = 80457

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 36    tgcttcttcctatagctgt 54
             |||||||||||||||||||
Sbjct: 23341 tgcttcttcctatagctgt 23323



to top

>emb|AL645727.16| Mouse DNA sequence from clone RP23-20G7 on chromosome 1 Contains a
              cytochrome c oxidase subunit Vb (Cox5b) pseudogene, a
              ribosomal protein S2 (Rps2) pseudogene, the 5' end of the
              Nrp2 gene for neuropilin 2, the 3' end of the gene for an
              ortholog of human amyotrophic lateral sclerosis 2
              (juvenile) chromosome region candidate 19 (ALS2CR19) and
              two CpG islands, complete sequence
          Length = 218427

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     agctgtttagacacatcca 67
              |||||||||||||||||||
Sbjct: 135144 agctgtttagacacatcca 135162



to top

>emb|AL627261.10| Zebrafish DNA sequence from clone RP71-1N11 in linkage group 9 Contains
              three CpG islands, complete sequence
          Length = 147392

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 14     tcacaacctcatgaaccat 32
              |||||||||||||||||||
Sbjct: 123278 tcacaacctcatgaaccat 123296



to top

>ref|XM_392340.2| PREDICTED: Apis mellifera similar to guanine nucleotide exchange
            factor (LOC408810), mRNA
          Length = 3495

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 26   gaaccatctgtgcttcttc 44
            |||||||||||||||||||
Sbjct: 2941 gaaccatctgtgcttcttc 2923



to top

>gb|AC019044.6| Homo sapiens BAC clone RP11-12F4 from 2, complete sequence
          Length = 126497

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 24    atgaaccatctgtgcttcttcct 46
             ||||||||||||||||| |||||
Sbjct: 60021 atgaaccatctgtgcttattcct 60043



to top

>gb|AC149608.4| Mus musculus BAC clone RP23-436E6 from 8, complete sequence
          Length = 196473

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 29     ccatctgtgcttcttccta 47
              |||||||||||||||||||
Sbjct: 171423 ccatctgtgcttcttccta 171441


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 905,135
Number of Sequences: 3902068
Number of extensions: 905135
Number of successful extensions: 63646
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63628
Number of HSP's gapped (non-prelim): 18
length of query: 115
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 94
effective length of database: 17,151,101,840
effective search space: 1612203572960
effective search space used: 1612203572960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top