ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet57c03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 66 3e-08
2ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 66 3e-08
3ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 66 3e-08
4ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 66 3e-08
5gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 66 3e-08
6emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 66 3e-08
7gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 66 3e-08
8gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 66 3e-08
9gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 66 3e-08
10gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 66 3e-08
11gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 66 3e-08
12gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 66 3e-08
13gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 66 3e-08
14gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 66 3e-08
15gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 66 3e-08
16gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 66 3e-08
17gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 66 3e-08
18gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 66 3e-08
19gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 66 3e-08
20emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 66 3e-08
21emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 66 3e-08
22emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 66 3e-08
23emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 66 3e-08
24emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 66 3e-08
25emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 66 3e-08
26emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 66 3e-08
27gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 62 5e-07
28gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 62 5e-07
29gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 62 5e-07
30emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 58 7e-06
31gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 58 7e-06
32emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 58 7e-06
33gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 56 3e-05
34dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 56 3e-05
35ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 54 1e-04
36ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 54 1e-04
37emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 54 1e-04
38emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 54 1e-04
39gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 54 1e-04
40gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 54 1e-04
41dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 54 1e-04
42dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 54 1e-04
43dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 54 1e-04
44dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
45dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
46emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 54 1e-04
47emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 54 1e-04
48emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 54 1e-04
49emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 54 1e-04
50emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 54 1e-04
51dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
52dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
53dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
54dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
55dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
56dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 1e-04
57gb|AY109324.1| Zea mays CL187_1 mRNA sequence 54 1e-04
58ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 52 5e-04
59gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 52 5e-04
60gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 52 5e-04
61gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 52 5e-04
62gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 52 5e-04
63gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 52 5e-04
64gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 52 5e-04
65emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 52 5e-04
66emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 52 5e-04
67gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 52 5e-04
68gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 52 5e-04
69emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 52 5e-04
70ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 50 0.002
71gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 50 0.002
72gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 50 0.002
73gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 50 0.002
74gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 50 0.002
75gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 50 0.002
76gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 50 0.002
77emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 50 0.002
78emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 50 0.002
79gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 50 0.002
80emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 50 0.002
81emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 50 0.002
82gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 50 0.002
83dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 50 0.002
84dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 48 0.007
85gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 48 0.007
86gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 46 0.028
87gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.028
88emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 46 0.028
89dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.028
90dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.028
91dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 46 0.028
92dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 46 0.028
93dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.028
94dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.028
95emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 46 0.028
96emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 46 0.028
97dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.028
98dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.028
99dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.028
100dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.028
101dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.028
102dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.028
103dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.028
104gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 46 0.028
105gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 46 0.028
106gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 46 0.028
107gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 46 0.028
108gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 46 0.028
109dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 46 0.028
110ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 44 0.11
111ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 44 0.11
112gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 44 0.11
113gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 44 0.11
114gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 44 0.11
115gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.11
116gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.11
117gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.11
118gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.11
119gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 44 0.11
120gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 44 0.11
121gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 44 0.11
122gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 44 0.11
123gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 44 0.11
124emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 44 0.11
125emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 44 0.11
126emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 44 0.11
127ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 40 1.7
128gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence 40 1.7
129gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome... 40 1.7
130gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, comple... 40 1.7
131gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 40 1.7
132gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 40 1.7
133gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 40 1.7
134emb|BX470077.5| Zebrafish DNA sequence from clone CH211-136P17 i... 40 1.7
135gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 40 1.7
136gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 40 1.7
137dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.7
138gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 40 1.7
139gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 40 1.7
140dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 1.7
141dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 40 1.7
142gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complet... 40 1.7
143gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 40 1.7
144gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 40 1.7
145dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 40 1.7
146dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 40 1.7
147gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, com... 38 6.8
148gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome... 38 6.8
149gb|AC125213.3| Mus musculus BAC clone RP23-136A14 from 7, comple... 38 6.8
150gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete ... 38 6.8
151emb|AL365321.16| Human DNA sequence from clone RP11-324J2 on chr... 38 6.8
152gb|BC056343.1| Mus musculus sortilin 1, mRNA (cDNA clone MGC:739... 38 6.8
153dbj|AK147442.1| Mus musculus adult male brain UNDEFINED_CELL_LIN... 38 6.8
154gb|AC018929.12| Oryza sativa chromosome 10 BAC OSJNBa0027L23 gen... 38 6.8
155gb|BC034129.1| Mus musculus sortilin 1, mRNA (cDNA clone IMAGE:4... 38 6.8
156dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 6.8
157dbj|AK177805.1| Mus musculus cDNA, clone:Y0G0104F07, strand:minu... 38 6.8
158emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 38 6.8
159gb|AF175279.1|AF175279 Mus musculus neurotensin receptor 3 mRNA,... 38 6.8
160gb|AC172744.2| Medicago truncatula chromosome 2 BAC clone mth2-3... 38 6.8
161gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 6.8
162ref|NM_019972.2| Mus musculus sortilin 1 (Sort1), mRNA 38 6.8
163emb|AL954144.6| Zebrafish DNA sequence from clone CH211-206L15, ... 38 6.8
164gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 38 6.8
165emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chr... 38 6.8
166emb|AL663032.9| Mouse DNA sequence from clone RP23-27I6 on chrom... 38 6.8
167dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 38 6.8

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 2530



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 2530



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 808



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 806 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 766



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 627 ttccggggacgaagttggtggcgaaggcccatgcgttgttg 587



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 2371 ttccggggacgaagttggtggcgaaggcccatgcgttgttg 2331



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 753



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 808



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                      
Query: 103   ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 93208 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 93248



 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 103   ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 96100 ttccggggacgaagttggtagcgaaggcccatgcattgttg 96060



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                      
Query: 103   ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 80994 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 80954



 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 103   ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 78102 ttccggggacgaagttggtagcgaaggcccatgcattgttg 78142



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 753



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 753



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 753



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 804



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 804



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 804



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 804



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 804



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 804



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 785



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 164 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 124



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 785



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 828 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 788



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 91  ttccggggacgaagttggtggcgaaggcccaagcgttgttg 131



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 2372 ttccggggacgaagttggtggcgaaggcccatgcgttgttg 2332



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| |||||||||||||||||||||| |||||||||
Sbjct: 1093 ttccggggacgaagttggtggcgaaggcccaagcgttgttg 1053



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||||||||||| |||||||||
Sbjct: 864 ccggggacgaagttggtggcgaaggcccaggcgttgttg 826



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||||||||||| |||||||||
Sbjct: 1188 ccggggacgaagttggtggcgaaggcccaggcgttgttg 1150



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||||||||||| |||||||||
Sbjct: 1527 ccggggacgaagttggtggcgaaggcccaggcgttgttg 1489



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 58.0 bits (29), Expect = 7e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||| ||||||| |||||||||
Sbjct: 835 ttccggggacgaagttggtggcggaggcccaagcgttgttg 795



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 58.0 bits (29), Expect = 7e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||||||| ||||||| |||||||||
Sbjct: 845 ttccggggacgaagttggtggcgtaggcccaggcgttgttg 805



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 58.0 bits (29), Expect = 7e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| |||||||||
Sbjct: 370 ttccggggacgaagttggtagcgaaggcccatgcgttgttg 330



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 112 cgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||||| |||||||||
Sbjct: 850 cgaagttggtggcgaaggcccaggcgttgttg 819



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 112 cgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||||| |||||||||
Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttg 664



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 791 ccggggacgaagttggtggcgtaggcccatgcgttgttg 753



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 779 ccggggacgaagttggtggcgtaggcccaggcgttgttg 741



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttg 1765



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 1240 ccggggacgaagttggtggcgtaggcccaggcgttgttg 1202



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 105   ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 13883 ccggggacgaagttggtggcgtaggcccatgcgttgttg 13921



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 857 ccggggacgaagttggtggcgtaggcccaggcgttgttg 819



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                       
Query: 105      ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
                |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 30025128 ccggggacgaagttggtggcgtaggcccatgcgttgttg 30025090



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                       
Query: 105      ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
                |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 23604322 ccggggacgaagttggtggcgtaggcccaggcgttgttg 23604284



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 105   ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 21118 ccggggacgaagttggtggcgtaggcccatgcgttgttg 21080



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 105   ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 67021 ccggggacgaagttggtggcgtaggcccaggcgttgttg 66983



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 850 ccggggacgaagttggtggcgtaggcccaggcgttgttg 812



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 849 ccggggacgaagttggtggcgtaggcccaggcgttgttg 811



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 855 ccggggacgaagttggtggcgtaggcccaagcgttgttg 817



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 1279 ccggggacgaagttggtggcgtaggcccaggcgttgttg 1241



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 1673 ccggggacgaagttggtggcgtaggcccatgcgttgttg 1635



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 866 ccggggacgaagttggtggcgtaggcccaggcgttgttg 828



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||||||||||| || ||||||
Sbjct: 968 ccggggacgaagttggtggcgaaggcccaggcattgttg 930



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttg 834



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttg 834



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttg 836



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 379 ccggggacgaagttggtggcgtaggcccaggcgttgttg 341



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 857 ccggggacgaagttggtggcgtaggcccatgcgttgttg 819



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttg 836



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||| ||||||| |||||||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttg 1765



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttg 825



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 616 aagttggtggcgaaggcccatgcgttgttg 587



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 788 aagttggtggcgaaggcccatgcgttgttg 759



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttg 825



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttg 825



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttg 825



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttg 825



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 158 aagttggtggcgaaggcccatgcgttgttg 129



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 823 aagttggtggcgaaggcccatgcgttgttg 794



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||| |||||||||
Sbjct: 734 aagttggtggcgaaggcccatgcgttgttg 705



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 114   aagttggtggcgaaggcccacgcgttgttg 143
             |||||||||||||||||||| |||||||||
Sbjct: 16127 aagttggtggcgaaggcccatgcgttgttg 16156



 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 114   aagttggtggcgaaggcccacgcgttgttg 143
             |||||||| ||||||||||| |||||||||
Sbjct: 22526 aagttggttgcgaaggcccatgcgttgttg 22497



 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 114   aagttggtggcgaaggcccacgcgttgttg 143
             ||||||||||| |||||||| |||||||||
Sbjct: 19880 aagttggtggcaaaggcccaagcgttgttg 19851



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 114  aagttggtggcgaaggcccacgcgttgttg 143
            |||||||||||||||||||| |||||||||
Sbjct: 1005 aagttggtggcgaaggcccatgcgttgttg 976



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttg 818



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| | ||||| |||||||||||||| |||||||||
Sbjct: 8576 ttccggggacaaagtttgtggcgaaggcccaagcgttgttg 8616



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttg 756



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttg 818



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttg 818



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| ||||||||||||| |||||||| || ||||||
Sbjct: 838 ttccggggacgaagttggtggcaaaggcccatgcattgttg 798



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 864 ttccggggacgaagttggtagcgaaggcccatgcattgttg 824



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 516 ttccggggacgaagttggtagcgaaggcccatgcattgttg 476



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||| ||||||||||||||||| |||||||||
Sbjct: 827 ttccggggacgaa-ttggtggcgaaggcccaagcgttgttg 788



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttg 818



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 1096 ttccggggacgaagttggtagcgaaggcccatgcattgttg 1056



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||| |||||||||||||  ||||||| |||||||||
Sbjct: 1037 ttccggggacgaagttggtggcataggcccaggcgttgttg 997



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||| |||||||||| ||||||||||| || ||||||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttg 756



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||  |||||||||||||| ||||||| |||||||||
Sbjct: 841 ttccgggaacgaagttggtggcgtaggcccaggcgttgttg 801



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 112  cgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||||||||| ||||||| |||||||||
Sbjct: 3010 cgaagttggtggcgtaggcccatgcgttgttg 2979



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 112 cgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||||||||||| || ||||||
Sbjct: 814 cgaagttggtggcgaaggcccaagcattgttg 783



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 105   ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 78979 ccggggacgaagttggtggcgtatgcccaggcgttgttg 79017



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 105      ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
                |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 21808837 ccggggacgaagttggtggcgtatgcccaggcgttgttg 21808799



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||  ||||||| |||||||||
Sbjct: 881 ccggggacgaagttggtggcataggcccaggcgttgttg 843



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 105      ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
                |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 10793775 ccggggacgaagttggtggcgtacgcccaggcgttgttg 10793737



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 105      ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
                |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 21801866 ccggggacgaagttggtggcgtatgcccaggcgttgttg 21801828



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| || ||||||
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttg 854



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            ||||||| ||||||||||||| | ||||| |||||||||
Sbjct: 1387 ccgggggtgaagttggtggcgtaagcccaggcgttgttg 1349



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 105   ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
             |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 17498 ccggggacgaagttggtggcgtacgcccaggcgttgttg 17460



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                     
Query: 105    ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
              |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 130393 ccggggacgaagttggtggcgtacgcccaggcgttgttg 130355



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 2714 ccggggacgaagttggtggcgtaagcccaggcgttgttg 2676



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 105  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
            |||||| |||||||||||||  ||||||| |||||||||
Sbjct: 1959 ccggggacgaagttggtggcataggcccaggcgttgttg 1921



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 843 ccggggacgaagttggtggcgtacgcccaggcgttgttg 805



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttg 810



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 850 ccggggacgaagttggtggcgtacgcccaggcgttgttg 812



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 836 ccggggacgaagttggtggcgtatgcccaggcgttgttg 798



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttg 810



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 411 ccggggacgaagttggtggcgtatgcccaggcgttgttg 373



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttg 810



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 571 ccggggacgaagttggtggcgtaagcccaggcgttgttg 533



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 825 ccggggacgaagttggtggcgtatgcccaggcgttgttg 787



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| | |||||||||||| ||||||| |||||||||
Sbjct: 833 ccggggacaaagttggtggcgtaggcccatgcgttgttg 795



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttg 351



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| ||||||| || ||||||
Sbjct: 816 ccggggacgaagttggtggcgtaggcccaggcattgttg 778



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 46.1 bits (23), Expect = 0.028
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 829 ccggggacgaagttggtggcgtacgcccaggcgttgttg 791



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||| ||||||||||| |||||||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttg 812



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttg 826



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 746 aagttggtggcaaaggcccaagcgttgttg 717



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttg 812



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttg 812



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||| ||||||||||| |||||||||
Sbjct: 788 aagttggttgcgaaggcccatgcgttgttg 759



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttg 759



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||| ||||||||||| |||||||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttg 812



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttg 811



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttg 759



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 834 aagttggtggcaaaggcccaagcgttgttg 805



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttg 811



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttg 826



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||| ||||||| |||||||||
Sbjct: 835 aagttggtggcgtaggcccaggcgttgttg 806



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||| ||||||||||| |||||||||
Sbjct: 994 aagttggttgcgaaggcccatgcgttgttg 965



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           ||||||||||| |||||||| |||||||||
Sbjct: 933 aagttggtggcaaaggcccaagcgttgttg 904



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 114 aagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||| ||||||| |||||||||
Sbjct: 822 aagttggtggcgtaggcccaggcgttgttg 793



to top

>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690
           (LHCB2:4) mRNA, complete cds
          Length = 946

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 851 ttccggggacgaagttggtggcgtaagcccaagcattgtt 812



to top

>gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence
          Length = 510

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 404 ttccggggacgaagttggtggcgtaagcccaagcattgtt 365



to top

>gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
              OSJNBa0082F22, complete sequence
          Length = 176038

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 66     ccgatggacagacggatggc 85
              ||||||||||||||||||||
Sbjct: 109238 ccgatggacagacggatggc 109219



 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 66     ccgatggacagacggatggc 85
              ||||||||||||||||||||
Sbjct: 106454 ccgatggacagacggatggc 106435



to top

>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence
          Length = 202733

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    gtacaagtacacatgcatat 60
             ||||||||||||||||||||
Sbjct: 22438 gtacaagtacacatgcatat 22419



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 107 gggggcgaagttggtggcgaaggcccacgcgttgtt 142
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 782 gggggtgaacttggtggcgaaggcgaacgcgttgtt 747



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 107 gggggcgaagttggtggcgaaggcccacgcgttgtt 142
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 783 gggggtgaacttggtggcgaaggcgaacgcgttgtt 748



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 107 gggggcgaagttggtggcgaaggcccacgcgttgtt 142
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 777 gggggtgaacttggtggcgaaggcgaacgcgttgtt 742



to top

>emb|BX470077.5| Zebrafish DNA sequence from clone CH211-136P17 in linkage group 5,
              complete sequence
          Length = 165851

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     gctgctaaacacatttaact 103
              ||||||||||||||||||||
Sbjct: 103691 gctgctaaacacatttaact 103672



to top

>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds
          Length = 801

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 796 ttccggggacgaagttggtggcgtaagcccaagcattgtt 757



to top

>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding
           protein (MGF10.9) mRNA, complete cds
          Length = 917

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 845 ttccggggacgaagttggtggcgtaagcccaagcattgtt 806



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 66       ccgatggacagacggatggc 85
                ||||||||||||||||||||
Sbjct: 13146461 ccgatggacagacggatggc 13146442



 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 66       ccgatggacagacggatggc 85
                ||||||||||||||||||||
Sbjct: 13143677 ccgatggacagacggatggc 13143658



to top

>gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete sequence
          Length = 917

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 845 ttccggggacgaagttggtggcgtaagcccaagcattgtt 806



to top

>gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA, complete cds
          Length = 897

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 103 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 801 ttccggggacgaagttggtggcgtaagcccaagcattgtt 762



to top

>dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGF10
          Length = 84702

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 103   ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
             |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 31777 ttccggggacgaagttggtggcgtaagcccaagcattgtt 31738



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 112  cgaagttggtggcgaaggcccacgcgttgttg 143
            |||||||||||||| | ||||| |||||||||
Sbjct: 1838 cgaagttggtggcgtatgcccatgcgttgttg 1807



to top

>gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complete sequence
          Length = 205880

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     gtacaagtacacatgcatat 60
              ||||||||||||||||||||
Sbjct: 125910 gtacaagtacacatgcatat 125891



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 112 cgaagttggtggcgaaggcccacgcgttgttg 143
           |||||||||||||  ||||||| |||||||||
Sbjct: 275 cgaagttggtggcataggcccaggcgttgttg 244



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 103  ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 142
            |||||||| | ||||| |||||||||||||| || |||||
Sbjct: 1001 ttccggggacaaagtttgtggcgaaggcccaagcattgtt 962



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 107 gggggcgaagttggtggcgaaggcccacgcgttgtt 142
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 811 gggggtgaacttggtggcgaaggcgaacgcgttgtt 776



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 107  gggggcgaagttggtggcgaaggcccacgcgttgtt 142
            ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 1653 gggggtgaacttggtggcgaaggcgaacgcgttgtt 1618



to top

>gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, complete sequence
          Length = 236143

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     ggacagacggatggctgct 89
              |||||||||||||||||||
Sbjct: 115211 ggacagacggatggctgct 115193



to top

>gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome 5, complete sequence
          Length = 224181

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    tacaagtacacatgcatat 60
             |||||||||||||||||||
Sbjct: 52160 tacaagtacacatgcatat 52142



to top

>gb|AC125213.3| Mus musculus BAC clone RP23-136A14 from 7, complete sequence
          Length = 194309

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 42    tacaagtacacatgcatat 60
             |||||||||||||||||||
Sbjct: 94097 tacaagtacacatgcatat 94115



to top

>gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete sequence
          Length = 206570

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     tacaagtacacatgcatat 60
              |||||||||||||||||||
Sbjct: 109745 tacaagtacacatgcatat 109763



to top

>emb|AL365321.16| Human DNA sequence from clone RP11-324J2 on chromosome 1 Contains the
             5' end of the PHTF1 gene for putative homeodomain
             transcription factor 1,  the 3' end of the gene for a
             novel protein (FLJ11220 and FLJ12104) and a CpG island,
             complete sequence
          Length = 40891

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    ctaaacacatttaacttcc 106
             |||||||||||||||||||
Sbjct: 30781 ctaaacacatttaacttcc 30799



to top

>gb|BC056343.1| Mus musculus sortilin 1, mRNA (cDNA clone MGC:73925 IMAGE:5704346),
            complete cds
          Length = 6804

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   ggacagacggatggctgct 89
            |||||||||||||||||||
Sbjct: 2003 ggacagacggatggctgct 1985



to top

>dbj|AK147442.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN
            full-length enriched library, clone:M5C1042I07
            product:sortilin 1, full insert sequence
          Length = 6837

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   ggacagacggatggctgct 89
            |||||||||||||||||||
Sbjct: 2054 ggacagacggatggctgct 2036



to top

>gb|AC018929.12| Oryza sativa chromosome 10 BAC OSJNBa0027L23 genomic sequence, complete
             sequence
          Length = 143961

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 113   gaagttggtggcgaaggcccacg 135
             |||| ||||||||||||||||||
Sbjct: 18054 gaaggtggtggcgaaggcccacg 18032



to top

>gb|BC034129.1| Mus musculus sortilin 1, mRNA (cDNA clone IMAGE:4920258), partial cds
          Length = 2810

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   ggacagacggatggctgct 89
            |||||||||||||||||||
Sbjct: 1504 ggacagacggatggctgct 1486



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 113      gaagttggtggcgaaggcccacg 135
                |||| ||||||||||||||||||
Sbjct: 22366031 gaaggtggtggcgaaggcccacg 22366009



to top

>dbj|AK177805.1| Mus musculus cDNA, clone:Y0G0104F07, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000016188, based on BLAT search
          Length = 230

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 71  ggacagacggatggctgct 89
           |||||||||||||||||||
Sbjct: 145 ggacagacggatggctgct 127



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                          
Query: 112 cgaagttggtggcgaaggcccacgcgttgtt 142
           ||||||||||||| |||||||| || |||||
Sbjct: 859 cgaagttggtggcaaaggcccaggcattgtt 829



to top

>gb|AF175279.1|AF175279 Mus musculus neurotensin receptor 3 mRNA, complete cds
          Length = 2484

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   ggacagacggatggctgct 89
            |||||||||||||||||||
Sbjct: 2000 ggacagacggatggctgct 1982



to top

>gb|AC172744.2| Medicago truncatula chromosome 2 BAC clone mth2-33p17, complete
             sequence
          Length = 116124

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    acgtacaagtacacatgca 57
             |||||||||||||||||||
Sbjct: 23399 acgtacaagtacacatgca 23417



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 113      gaagttggtggcgaaggcccacg 135
                |||| ||||||||||||||||||
Sbjct: 22378099 gaaggtggtggcgaaggcccacg 22378077



to top

>ref|NM_019972.2| Mus musculus sortilin 1 (Sort1), mRNA
          Length = 6804

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   ggacagacggatggctgct 89
            |||||||||||||||||||
Sbjct: 2003 ggacagacggatggctgct 1985



to top

>emb|AL954144.6| Zebrafish DNA sequence from clone CH211-206L15, complete sequence
          Length = 156893

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    ccgatggacagacggatgg 84
             |||||||||||||||||||
Sbjct: 91971 ccgatggacagacggatgg 91989



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| | |||||||||||||| ||||| || ||||||
Sbjct: 803 ccggggacaaagttggtggcgaatgcccatgcattgttg 765



to top

>emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chromosome 3, complete
             sequence
          Length = 132775

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    ggacagacggatggctgct 89
             |||||||||||||||||||
Sbjct: 86844 ggacagacggatggctgct 86826



to top

>emb|AL663032.9| Mouse DNA sequence from clone RP23-27I6 on chromosome X, complete
              sequence
          Length = 162995

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 79     ggatggctgctaaacacatttaa 101
              |||||||||| ||||||||||||
Sbjct: 101941 ggatggctgccaaacacatttaa 101919



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 105 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 143
           |||||| |||||||||||||| | | ||| |||||||||
Sbjct: 817 ccggggacgaagttggtggcgtatgaccaggcgttgttg 779


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 975,632
Number of Sequences: 3902068
Number of extensions: 975632
Number of successful extensions: 57724
Number of sequences better than 10.0: 167
Number of HSP's better than 10.0 without gapping: 168
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57313
Number of HSP's gapped (non-prelim): 411
length of query: 143
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 122
effective length of database: 17,151,101,840
effective search space: 2092434424480
effective search space used: 2092434424480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top