ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet57b11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY498859.1| Arabidopsis thaliana microRNA 172a-2 (EAT) precur... 42 0.36
2gb|DQ063643.1| Arabidopsis thaliana MIR172b microRNA precursor t... 42 0.36
3emb|AL391716.1|ATF21E1 Arabidopsis thaliana DNA chromosome 5, BA... 42 0.36
4gb|AC083810.16| Homo sapiens 12 BAC RP11-809N1 (Roswell Park Can... 42 0.36
5gb|U29612.1| Caenorhabditis elegans cosmid C09B8, complete sequence 40 1.4
6gb|AC123732.9| Mus musculus chromosome 1, clone RP23-459I8, comp... 38 5.6
7gb|AC148759.2| Oryza sativa (japonica cultivar-group) chromosome... 38 5.6
8gb|AC102487.6| Mus musculus chromosome 5, clone RP24-496C22, com... 38 5.6
9gb|AC136378.4| Oryza sativa (japonica cultivar-group) chromosome... 38 5.6
10gb|AC118051.7| Mus musculus chromosome 1, clone RP24-430E15, com... 38 5.6
11gb|AC121830.3| Mus musculus BAC clone RP24-63N24 from chromosome... 38 5.6
12gb|DP000044.2| Callithrix jacchus target 106 genomic scaffold 38 5.6
13gb|AC146570.6| Medicago truncatula clone mth2-103j7, complete se... 38 5.6
14emb|AL158195.11| Human DNA sequence from clone RP11-48H1 on chro... 38 5.6
15emb|AL022329.9|HS407F11 Human DNA sequence from clone CTA-407F11... 38 5.6
16gb|AF440620.1|AF440620 Homo sapiens 13q14 chronic lymphocytic le... 38 5.6
17gb|AC008618.7| Homo sapiens chromosome 5 clone CTB-146E17, compl... 38 5.6
18gb|AC159808.2| Mus musculus BAC clone RP24-357G23 from chromosom... 38 5.6
19gb|AC005949.12| Homo sapiens chromosome 13 clone 468p13 map 13q1... 38 5.6
20gb|AC007696.5|AC007696 Drosophila melanogaster, chromosome 2L, r... 38 5.6
21dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 38 5.6
22gb|AC019055.6| Homo sapiens BAC clone RP11-111P18 from 2, comple... 38 5.6
23emb|CT009742.12| Mouse DNA sequence from clone RP23-306D19 on ch... 38 5.6
24gb|AE003620.3| Drosophila melanogaster chromosome 2L, section 29... 38 5.6
25gb|AC104153.2| Papio anubis clone RP41-431I4, complete sequence 38 5.6
26gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 38 5.6

>gb|AY498859.1| Arabidopsis thaliana microRNA 172a-2 (EAT) precursor RNA, complete
           sequence
          Length = 1417

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  taatttcttgctacacaaaat 63
           |||||||||||||||||||||
Sbjct: 481 taatttcttgctacacaaaat 461



to top

>gb|DQ063643.1| Arabidopsis thaliana MIR172b microRNA precursor transcript, partial
           sequence, alternatively spliced
          Length = 597

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  taatttcttgctacacaaaat 63
           |||||||||||||||||||||
Sbjct: 481 taatttcttgctacacaaaat 461



to top

>emb|AL391716.1|ATF21E1 Arabidopsis thaliana DNA chromosome 5, BAC clone F21E1 (ESSA project)
          Length = 97451

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 43    taatttcttgctacacaaaat 63
             |||||||||||||||||||||
Sbjct: 91983 taatttcttgctacacaaaat 92003



to top

>gb|AC083810.16| Homo sapiens 12 BAC RP11-809N1 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 95838

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 61   aatgaccaaatattacaaacc 81
            |||||||||||||||||||||
Sbjct: 3289 aatgaccaaatattacaaacc 3309



to top

>gb|U29612.1| Caenorhabditis elegans cosmid C09B8, complete sequence
          Length = 43046

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   caaaatgaccaaatattaca 77
            ||||||||||||||||||||
Sbjct: 1623 caaaatgaccaaatattaca 1642



to top

>gb|AC123732.9| Mus musculus chromosome 1, clone RP23-459I8, complete sequence
          Length = 158620

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 102    cacccactgacccgtgacc 120
              |||||||||||||||||||
Sbjct: 131297 cacccactgacccgtgacc 131279



to top

>gb|AC148759.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0030K09,
              complete sequence
          Length = 143355

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 53     ctacacaaaatgaccaaat 71
              |||||||||||||||||||
Sbjct: 109170 ctacacaaaatgaccaaat 109152



to top

>gb|AC102487.6| Mus musculus chromosome 5, clone RP24-496C22, complete sequence
          Length = 167936

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    tacacaaaatgaccaaata 72
             |||||||||||||||||||
Sbjct: 29289 tacacaaaatgaccaaata 29307



to top

>gb|AC136378.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0047D03, complete sequence
          Length = 126165

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    ctacacaaaatgaccaaat 71
             |||||||||||||||||||
Sbjct: 26556 ctacacaaaatgaccaaat 26538



to top

>gb|AC118051.7| Mus musculus chromosome 1, clone RP24-430E15, complete sequence
          Length = 180197

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 102    cacccactgacccgtgacc 120
              |||||||||||||||||||
Sbjct: 172074 cacccactgacccgtgacc 172092



to top

>gb|AC121830.3| Mus musculus BAC clone RP24-63N24 from chromosome 7, complete sequence
          Length = 211478

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     atttcttgctacacaaaat 63
              |||||||||||||||||||
Sbjct: 159837 atttcttgctacacaaaat 159819



to top

>gb|DP000044.2| Callithrix jacchus target 106 genomic scaffold
          Length = 574594

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     aatattacaaacctgggtt 87
              |||||||||||||||||||
Sbjct: 171716 aatattacaaacctgggtt 171734



to top

>gb|AC146570.6| Medicago truncatula clone mth2-103j7, complete sequence
          Length = 122623

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    aaatgaccaaatattacaa 78
             |||||||||||||||||||
Sbjct: 84449 aaatgaccaaatattacaa 84467



to top

>emb|AL158195.11| Human DNA sequence from clone RP11-48H1 on chromosome 13 Contains part
             of the DLEU1 gene for deleted in lymphocytic leukemia 1
             (BCMS LEU1), complete sequence
          Length = 123209

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    taatttcttgctacacaaa 61
             |||||||||||||||||||
Sbjct: 92408 taatttcttgctacacaaa 92426



to top

>emb|AL022329.9|HS407F11 Human DNA sequence from clone CTA-407F11 on chromosome 22q12 Contains
              ADRBK2 gene for adrenergic beta receptor kinase 2, the YESP
              (v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1)
              pseudogene, ESTs, a ca repeat polymorphism, genomic marker
              D22S421, STSs, GSSs and two putative CpG Islands, complete
              sequence
          Length = 221507

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 50     ttgctacacaaaatgaccaaatattac 76
              ||||||||||| |||||||| ||||||
Sbjct: 190742 ttgctacacaagatgaccaagtattac 190716



to top

>gb|AF440620.1|AF440620 Homo sapiens 13q14 chronic lymphocytic leukemia suppressor locus section
              2 of 2
          Length = 440917

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 43     taatttcttgctacacaaa 61
              |||||||||||||||||||
Sbjct: 171109 taatttcttgctacacaaa 171127



to top

>gb|AC008618.7| Homo sapiens chromosome 5 clone CTB-146E17, complete sequence
          Length = 139029

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 29    tgattcatacatagtaatttcttgcta 55
             |||||||||||||| | ||||||||||
Sbjct: 46677 tgattcatacatagcactttcttgcta 46703



to top

>gb|AC159808.2| Mus musculus BAC clone RP24-357G23 from chromosome 12, complete sequence
          Length = 155139

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 62     atgaccaaatattacaaac 80
              |||||||||||||||||||
Sbjct: 131954 atgaccaaatattacaaac 131972



to top

>gb|AC005949.12| Homo sapiens chromosome 13 clone 468p13 map 13q14, complete sequence
          Length = 143107

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 43    taatttcttgctacacaaa 61
             |||||||||||||||||||
Sbjct: 48679 taatttcttgctacacaaa 48661



to top

>gb|AC007696.5|AC007696 Drosophila melanogaster, chromosome 2L, region 28B, BAC clone
             BACR14I17, complete sequence
          Length = 157948

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 101   acacccactgacccgtgac 119
             |||||||||||||||||||
Sbjct: 57194 acacccactgacccgtgac 57212



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 53       ctacacaaaatgaccaaat 71
                |||||||||||||||||||
Sbjct: 16605576 ctacacaaaatgaccaaat 16605594



to top

>gb|AC019055.6| Homo sapiens BAC clone RP11-111P18 from 2, complete sequence
          Length = 176383

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 56     cacaaaatgaccaaatatt 74
              |||||||||||||||||||
Sbjct: 160521 cacaaaatgaccaaatatt 160503



to top

>emb|CT009742.12| Mouse DNA sequence from clone RP23-306D19 on chromosome 12, complete
             sequence
          Length = 163039

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 62    atgaccaaatattacaaac 80
             |||||||||||||||||||
Sbjct: 87163 atgaccaaatattacaaac 87181



to top

>gb|AE003620.3| Drosophila melanogaster chromosome 2L, section 29 of 83 of the complete
             sequence
          Length = 251142

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 101   acacccactgacccgtgac 119
             |||||||||||||||||||
Sbjct: 34926 acacccactgacccgtgac 34944



to top

>gb|AC104153.2| Papio anubis clone RP41-431I4, complete sequence
          Length = 191465

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     gaaatactttgcacttgat 21
             |||||||||||||||||||
Sbjct: 33090 gaaatactttgcacttgat 33072



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 53       ctacacaaaatgaccaaat 71
                |||||||||||||||||||
Sbjct: 16739265 ctacacaaaatgaccaaat 16739247


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,012,327
Number of Sequences: 3902068
Number of extensions: 1012327
Number of successful extensions: 91344
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91221
Number of HSP's gapped (non-prelim): 123
length of query: 121
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 100
effective length of database: 17,151,101,840
effective search space: 1715110184000
effective search space used: 1715110184000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top