ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet57a04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL669859.5| Mouse DNA sequence from clone RP23-167D6 on chro... 44 0.084
2gb|AY569234.1| Adelotettix gigas 16S ribosomal RNA gene, partial... 40 1.3
3gb|AC093830.3| Homo sapiens BAC clone RP11-401G24 from 4, comple... 40 1.3
4emb|AL592225.17| Mouse DNA sequence from clone RP23-278M14 on ch... 40 1.3
5gb|AC093198.3| Drosophila melanogaster clone BACR03G24, complete... 38 5.2
6gb|AC093440.2| Drosophila melanogaster clone BACR34H03, complete... 38 5.2
7gb|AC006402.12| Drosophila melanogaster clone BACR08D17, complet... 38 5.2
8gb|AC091680.7| Oryza sativa chromosome 10 BAC OSJNBa0034L04 geno... 38 5.2
9gb|AC113948.5| Oryza sativa chromosome 10 BAC OSJNBb0038A07 geno... 38 5.2
10emb|CR848717.7| Zebrafish DNA sequence from clone DKEY-148B12 in... 38 5.2
11gb|AC106857.8| Homo sapiens chromosome 8, clone RP11-262O21, com... 38 5.2
12gb|AC022666.14| Homo sapiens, clone RP11-30K7, complete sequence 38 5.2
13tpg|BK003577.1| TPA: TPA_inf: Drosophila melanogaster HDC03425 (... 38 5.2
14gb|AF038110.1|AF038110 HIV-1 isolate TZB0060 from Tanzania, gp12... 38 5.2
15gb|AY619849.1| HIV-1 isolate C4.8D clone 8 from Sweden envelope ... 38 5.2
16gb|AY619846.1| HIV-1 isolate C4.53D clone 53 from Sweden envelop... 38 5.2
17gb|AY619844.1| HIV-1 isolate C4.51D clone 51 from Sweden envelop... 38 5.2
18gb|AY619840.1| HIV-1 isolate C4.43D clone 43 from Sweden envelop... 38 5.2
19gb|AY619834.1| HIV-1 isolate C4.3D clone 3 from Sweden envelope ... 38 5.2
20gb|AY619825.1| HIV-1 isolate C4.12bD clone 12 from Sweden envelo... 38 5.2
21gb|AY619824.1| HIV-1 isolate C4.12aD clone 12 from Sweden envelo... 38 5.2
22gb|AY619821.1| HIV-1 isolate C4.1D clone 1 from Sweden envelope ... 38 5.2
23gb|AY619808.1| HIV-1 isolate C2.6D clone 6 from Sweden envelope ... 38 5.2
24gb|AY619807.1| HIV-1 isolate C2.51D clone 51 from Sweden envelop... 38 5.2
25gb|AY619776.1| HIV-1 isolate M3.31D clone 31 from Sweden envelop... 38 5.2
26dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 5.2
27gb|AF201804.1|AF201804 HIV-1 clone H35-10 from Uganda, envelope ... 38 5.2
28gb|AF201803.1|AF201803 HIV-1 clone H35-9 from Uganda, envelope g... 38 5.2
29gb|AF201802.1|AF201802 HIV-1 clone H35-8 from Uganda, envelope g... 38 5.2
30gb|AF201800.1|AF201800 HIV-1 clone H35-6 from Uganda, envelope g... 38 5.2
31gb|AF201799.1|AF201799 HIV-1 clone H35-5 from Uganda, envelope g... 38 5.2
32gb|AF201798.1|AF201798 HIV-1 clone H35-4 from Uganda, envelope g... 38 5.2
33gb|AF201797.1|AF201797 HIV-1 clone H35-3 from Uganda, envelope g... 38 5.2
34gb|AF201796.1|AF201796 HIV-1 clone H35-2 from Uganda, envelope g... 38 5.2
35gb|AF201795.1|AF201795 HIV-1 clone H35-1 from Uganda, envelope g... 38 5.2
36gb|AE003666.6| Drosophila melanogaster chromosome 2L, section 75... 38 5.2
37gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 5.2
38gb|AC002442.1|AC002442 Drosophila melanogaster DNA sequence (P1 ... 38 5.2
39gb|U16042.1|HIV1U16042 Human immunodeficiency virus type 1 clone... 38 5.2 
>emb|AL669859.5| Mouse DNA sequence from clone RP23-167D6 on chromosome 11, complete
             sequence
          Length = 155196

 Score = 44.1 bits (22), Expect = 0.084
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 73    agttttatattagggtttaatg 94
             ||||||||||||||||||||||
Sbjct: 54624 agttttatattagggtttaatg 54603
to top
>gb|AY569234.1| Adelotettix gigas 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 509

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 75  ttttatattagggtttaatg 94
           ||||||||||||||||||||
Sbjct: 257 ttttatattagggtttaatg 276
to top
>gb|AC093830.3| Homo sapiens BAC clone RP11-401G24 from 4, complete sequence
          Length = 153887

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     catgggataagttttatatt 83
              ||||||||||||||||||||
Sbjct: 114094 catgggataagttttatatt 114113
to top
>emb|AL592225.17| Mouse DNA sequence from clone RP23-278M14 on chromosome 1, complete
              sequence
          Length = 183397

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     cacatgggataagttttata 81
              ||||||||||||||||||||
Sbjct: 130608 cacatgggataagttttata 130627
to top
>gb|AC093198.3| Drosophila melanogaster clone BACR03G24, complete sequence
          Length = 182901

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 4      tccccatgttgcacacaat 22
              |||||||||||||||||||
Sbjct: 159317 tccccatgttgcacacaat 159335
to top
>gb|AC093440.2| Drosophila melanogaster clone BACR34H03, complete sequence
          Length = 192132

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     tccccatgttgcacacaat 22
             |||||||||||||||||||
Sbjct: 23835 tccccatgttgcacacaat 23853
to top
>gb|AC006402.12| Drosophila melanogaster clone BACR08D17, complete sequence
          Length = 174735

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 4     tccccatgttgcacacaat 22
             |||||||||||||||||||
Sbjct: 98027 tccccatgttgcacacaat 98045
to top
>gb|AC091680.7| Oryza sativa chromosome 10 BAC OSJNBa0034L04 genomic sequence, complete
             sequence
          Length = 148611

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    tttacatccgtatgttgcc 61
             |||||||||||||||||||
Sbjct: 50553 tttacatccgtatgttgcc 50571
to top
>gb|AC113948.5| Oryza sativa chromosome 10 BAC OSJNBb0038A07 genomic sequence, complete
              sequence
          Length = 132900

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 43     tttacatccgtatgttgcc 61
              |||||||||||||||||||
Sbjct: 108854 tttacatccgtatgttgcc 108872
to top
>emb|CR848717.7| Zebrafish DNA sequence from clone DKEY-148B12 in linkage group 5,
             complete sequence
          Length = 207800

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 65    atgggataagttttatatt 83
             |||||||||||||||||||
Sbjct: 88927 atgggataagttttatatt 88945
to top
>gb|AC106857.8| Homo sapiens chromosome 8, clone RP11-262O21, complete sequence
          Length = 159454

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 28    agttttattccatcctttacatc 50
             ||||||||| |||||||||||||
Sbjct: 43201 agttttattgcatcctttacatc 43179
to top
>gb|AC022666.14| Homo sapiens, clone RP11-30K7, complete sequence
          Length = 150721

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 28     agttttattccatcctttacatc 50
              ||||||||| |||||||||||||
Sbjct: 101863 agttttattgcatcctttacatc 101885
to top
>tpg|BK003577.1| TPA: TPA_inf: Drosophila melanogaster HDC03425 (HDC03425) gene,
            complete cds
          Length = 2655

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 4    tccccatgttgcacacaat 22
            |||||||||||||||||||
Sbjct: 2136 tccccatgttgcacacaat 2154
to top
>gb|AF038110.1|AF038110 HIV-1 isolate TZB0060 from Tanzania, gp120 C2-C4 region (env) gene,
           partial cds
          Length = 664

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 206 aagttttattccatccttt 188
to top
>gb|AY619849.1| HIV-1 isolate C4.8D clone 8 from Sweden envelope glycoprotein (env)
           gene, partial cds
          Length = 357

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 259 aagttttattccatccttt 241
to top
>gb|AY619846.1| HIV-1 isolate C4.53D clone 53 from Sweden envelope glycoprotein
           (env) gene, partial cds
          Length = 357

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 259 aagttttattccatccttt 241
to top
>gb|AY619844.1| HIV-1 isolate C4.51D clone 51 from Sweden envelope glycoprotein
           (env) gene, partial cds
          Length = 354

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 256 aagttttattccatccttt 238
to top
>gb|AY619840.1| HIV-1 isolate C4.43D clone 43 from Sweden envelope glycoprotein
           (env) gene, partial cds
          Length = 357

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 259 aagttttattccatccttt 241
to top
>gb|AY619834.1| HIV-1 isolate C4.3D clone 3 from Sweden envelope glycoprotein (env)
           gene, partial cds
          Length = 354

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 256 aagttttattccatccttt 238
to top
>gb|AY619825.1| HIV-1 isolate C4.12bD clone 12 from Sweden envelope glycoprotein
           (env) gene, partial cds
          Length = 354

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 256 aagttttattccatccttt 238
to top
>gb|AY619824.1| HIV-1 isolate C4.12aD clone 12 from Sweden envelope glycoprotein
           (env) gene, partial cds
          Length = 354

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 256 aagttttattccatccttt 238
to top
>gb|AY619821.1| HIV-1 isolate C4.1D clone 1 from Sweden envelope glycoprotein (env)
           gene, partial cds
          Length = 357

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 259 aagttttattccatccttt 241
to top
>gb|AY619808.1| HIV-1 isolate C2.6D clone 6 from Sweden envelope glycoprotein (env)
           gene, partial cds
          Length = 354

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 256 aagttttattccatccttt 238
to top
>gb|AY619807.1| HIV-1 isolate C2.51D clone 51 from Sweden envelope glycoprotein
           (env) gene, partial cds
          Length = 354

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 256 aagttttattccatccttt 238
to top
>gb|AY619776.1| HIV-1 isolate M3.31D clone 31 from Sweden envelope glycoprotein
           (env) gene, partial cds
          Length = 357

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 259 aagttttattccatccttt 241
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 43       tttacatccgtatgttgcc 61
                |||||||||||||||||||
Sbjct: 20057637 tttacatccgtatgttgcc 20057619
to top
>gb|AF201804.1|AF201804 HIV-1 clone H35-10 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201803.1|AF201803 HIV-1 clone H35-9 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201802.1|AF201802 HIV-1 clone H35-8 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201800.1|AF201800 HIV-1 clone H35-6 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201799.1|AF201799 HIV-1 clone H35-5 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201798.1|AF201798 HIV-1 clone H35-4 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201797.1|AF201797 HIV-1 clone H35-3 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201796.1|AF201796 HIV-1 clone H35-2 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AF201795.1|AF201795 HIV-1 clone H35-1 from Uganda, envelope glycoprotein, C2-C4 region
           (env) gene, partial cds
          Length = 363

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 316 aagttttattccatccttt 298
to top
>gb|AE003666.6| Drosophila melanogaster chromosome 2L, section 75 of 83 of the complete
              sequence
          Length = 318277

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 4      tccccatgttgcacacaat 22
              |||||||||||||||||||
Sbjct: 305044 tccccatgttgcacacaat 305062
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 43       tttacatccgtatgttgcc 61
                |||||||||||||||||||
Sbjct: 20068913 tttacatccgtatgttgcc 20068895
to top
>gb|AC002442.1|AC002442 Drosophila melanogaster DNA sequence (P1 DS08416 (D52)), complete
            sequence
          Length = 79323

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 4    tccccatgttgcacacaat 22
            |||||||||||||||||||
Sbjct: 2544 tccccatgttgcacacaat 2562
to top
>gb|U16042.1|HIV1U16042 Human immunodeficiency virus type 1 clone XSH141L17 envelope
           glycoprotein (env) mRNA, V1-V5 regions, partial cds
          Length = 1075

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  aagttttattccatccttt 45
           |||||||||||||||||||
Sbjct: 679 aagttttattccatccttt 661


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 959,216
Number of Sequences: 3902068
Number of extensions: 959216
Number of successful extensions: 62276
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62207
Number of HSP's gapped (non-prelim): 69
length of query: 114
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 93
effective length of database: 17,151,101,840
effective search space: 1595052471120
effective search space used: 1595052471120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top