ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet56h09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 153 3e-34
2ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 141 1e-30
3emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 141 1e-30
4emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 141 1e-30
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 141 1e-30
6dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 141 1e-30
7dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 1e-30
8dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 1e-30
9emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 141 1e-30
10emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 141 1e-30
11emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 141 1e-30
12dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 1e-30
13gb|AY109324.1| Zea mays CL187_1 mRNA sequence 141 1e-30
14dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 133 3e-28
15dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 133 3e-28
16dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 133 3e-28
17dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 3e-28
18dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 3e-28
19dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 3e-28
20dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 3e-28
21dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 3e-28
22gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 133 3e-28
23dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 133 3e-28
24emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 129 4e-27
25gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 125 7e-26
26gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 121 1e-24
27ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 117 2e-23
28gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 117 2e-23
29dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 117 2e-23
30emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 117 2e-23
31dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
32dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
33dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
34dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 2e-23
35emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 113 3e-22
36dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 4e-21
37gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 109 4e-21
38emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 107 2e-20
39dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 101 1e-18
40emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 101 1e-18
41gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 101 1e-18
42gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 101 1e-18
43ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 94 2e-16
44ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 94 2e-16
45ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 94 2e-16
46ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 94 2e-16
47gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 94 2e-16
48gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 94 2e-16
49emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 94 2e-16
50gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 94 2e-16
51gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 94 2e-16
52gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 94 2e-16
53gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 94 2e-16
54gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 94 2e-16
55gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 94 2e-16
56gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 2e-16
57gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 2e-16
58gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 2e-16
59gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 94 2e-16
60gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 94 2e-16
61gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 94 2e-16
62emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 94 2e-16
63emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 94 2e-16
64emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 94 2e-16
65emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 94 2e-16
66gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 94 2e-16
67emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 94 2e-16
68emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 94 2e-16
69gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 94 2e-16
70gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 92 1e-15
71gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 86 6e-14
72gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 86 6e-14
73dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 86 6e-14
74emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 86 6e-14
75dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 6e-14
76dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 6e-14
77gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 86 6e-14
78gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 86 6e-14
79gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 86 6e-14
80gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 84 2e-13
81gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 82 9e-13
82emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 82 9e-13
83dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 80 4e-12
84emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMW... 80 4e-12
85emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 80 4e-12
86ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 78 1e-11
87ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 78 1e-11
88ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 78 1e-11
89gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 78 1e-11
90gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 78 1e-11
91gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 78 1e-11
92gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 78 1e-11
93gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 78 1e-11
94emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 78 1e-11
95gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 78 1e-11
96gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 78 1e-11
97gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 78 1e-11
98gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 78 1e-11
99gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 78 1e-11
100gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 78 1e-11
101gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 78 1e-11
102gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 78 1e-11
103gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 78 1e-11
104gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 78 1e-11
105gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 78 1e-11
106emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 78 1e-11
107emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 78 1e-11
108emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 78 1e-11
109emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 78 1e-11
110gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 78 1e-11
111gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 78 1e-11
112gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 78 1e-11
113emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 78 1e-11
114emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 78 1e-11
115emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 78 1e-11
116emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 78 1e-11
117gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 76 6e-11
118emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 74 2e-10
119gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 74 2e-10
120emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 74 2e-10
121emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 74 2e-10
122gb|AY112240.1| Zea mays CL187_6 mRNA sequence 74 2e-10
123ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 70 3e-09
124gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 70 3e-09
125gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 70 3e-09
126gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 70 3e-09
127gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 70 3e-09
128gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 70 3e-09
129gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 70 3e-09
130emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 70 3e-09
131emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 70 3e-09
132gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 70 3e-09
133emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 70 3e-09
134emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 70 3e-09
135emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 70 3e-09
136gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 70 3e-09
137gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 70 3e-09
138dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 70 3e-09
139gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 68 1e-08
140gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 68 1e-08
141gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 68 1e-08
142gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 66 5e-08
143gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 66 5e-08
144gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 66 5e-08
145gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 64 2e-07
146dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 64 2e-07
147emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 62 9e-07
148gb|AY104614.1| Zea mays PCO084486 mRNA sequence 62 9e-07
149gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 62 9e-07
150gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 62 9e-07
151gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 62 9e-07
152gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 62 9e-07
153ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 60 3e-06
154ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 60 3e-06
155ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 60 3e-06
156ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 60 3e-06
157ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 60 3e-06
158ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 60 3e-06
159ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 60 3e-06
160ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 60 3e-06
161gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 60 3e-06
162gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 60 3e-06
163gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 60 3e-06
164gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 60 3e-06
165gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 60 3e-06
166gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 60 3e-06
167gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 60 3e-06
168gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 60 3e-06
169gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 60 3e-06
170dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 60 3e-06
171dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 60 3e-06
172dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
173dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 60 3e-06
174dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
175dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
176dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
177dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
178dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
179dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
180dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
181dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
182dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-06
183emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 60 3e-06
184dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 60 3e-06
185dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 60 3e-06
186dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 60 3e-06
187gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 58 1e-05
188gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 58 1e-05
189gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 56 5e-05
190emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 56 5e-05
191emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 54 2e-04
192emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 54 2e-04
193emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 54 2e-04
194emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 54 2e-04
195gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 54 2e-04
196gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 54 2e-04
197gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 54 2e-04
198gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-... 54 2e-04
199gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 52 8e-04
200gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 52 8e-04
201gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 52 8e-04
202dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 52 8e-04
203gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 52 8e-04
204gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 52 8e-04
205dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 52 8e-04
206emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 50 0.003
207emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 48 0.013
208emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 48 0.013
209emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 48 0.013
210gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 48 0.013
211gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 48 0.013
212emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 46 0.051
213gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 46 0.051
214emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 46 0.051
215gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 46 0.051
216dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 46 0.051
217gb|AY171231.1| Chlamydomonas reinhardtii light-harvesting comple... 44 0.20
218gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 44 0.20
219gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 44 0.20
220gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 44 0.20
221gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 44 0.20
222gb|AY106149.1| Zea mays PCO102434 mRNA sequence 44 0.20
223gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 44 0.20
224gb|M64619.1|PEACAB66 Pea cab gene, complete cds 44 0.20
225gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 44 0.20
226dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 44 0.20
227gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mR... 42 0.79
228emb|AL138926.13| Human DNA sequence from clone RP11-173E24 on ch... 42 0.79
229gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 42 0.79
230gb|AC091947.4| Homo sapiens chromosome 5 clone RP11-367F9, compl... 42 0.79
231gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 42 0.79
232gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 42 0.79
233gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 42 0.79
234gb|AY653733.1| Acanthamoeba polyphaga mimivirus, complete genome 42 0.79
235dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 0.79
236gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, c... 40 3.1
237gb|BC052945.1| Homo sapiens cDNA clone IMAGE:5268504 40 3.1
238gb|AC183109.2| Pan troglodytes BAC clone CH251-317D18 from chrom... 40 3.1
239ref|XM_944925.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 3.1
240ref|XM_932161.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 3.1
241gb|DP000032.1| Felis catus target 116 genomic scaffold 40 3.1
242gb|AC139491.2| Homo sapiens chromosome 5 clone RP11-826N14, comp... 40 3.1
243gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H2... 40 3.1
244emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 40 3.1
245gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 3.1
246gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 40 3.1
247gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 40 3.1

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  153 bits (77), Expect = 3e-34
 Identities = 89/93 (95%)
 Strand = Plus / Minus

                                                                       
Query: 147 ttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 206
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 864 ttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgga 805

                                            
Query: 207 gaggtggtcagcgaggttctcgagcgggccctt 239
           ||||||||| |||||||||||||| ||||||||
Sbjct: 804 gaggtggtcggcgaggttctcgagggggccctt 772



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 724 ggtggtcggcgaggttctcgagggggccctt 694



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749

                                           
Query: 209  ggtggtcagcgaggttctcgagcgggccctt 239
             ||||||||||||||||||||||||||||||
Sbjct: 1748 tgtggtcagcgaggttctcgagcgggccctt 1718



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186

                                           
Query: 209  ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||| |||||||||||||| ||||||||
Sbjct: 1185 ggtggtcggcgaggttctcgagggggccctt 1155



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                            
Query: 149      acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
                |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268

                                               
Query: 209      ggtggtcagcgaggttctcgagcgggccctt 239
                ||||||| |||||||||||||| ||||||||
Sbjct: 23604267 ggtggtcggcgaggttctcgagggggccctt 23604237



 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                            
Query: 149      acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
                |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074

                                   
Query: 209      ggtggtcagcgaggttctc 227
                ||||||| || ||||||||
Sbjct: 30025073 ggtggtcggccaggttctc 30025055



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967

                                            
Query: 209   ggtggtcagcgaggttctcgagcgggccctt 239
             ||||||| |||||||||||||| ||||||||
Sbjct: 66966 ggtggtcggcgaggttctcgagggggccctt 66936



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 795 ggtggtcggcgaggttctcgagggggccctt 765



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 794 ggtggtcggcgaggttctcgagggggccctt 764



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 801

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||||||||||||||||||||||||||
Sbjct: 800 tgtggtcagcgaggttctcgagcgggccctt 770



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225

                                           
Query: 209  ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||| |||||||||||||| ||||||||
Sbjct: 1224 ggtggtcggcgaggttctcgagggggccctt 1194



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           ||||||||||||| |||||||||||  ||||||| |||||||||||||||||||||||||
Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||||||||||||
Sbjct: 748 ggtggtcggcgaggttctcgagcgggccctt 718



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 324 ggtggtcggcgaggttctcgagggggccctt 294



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  141 bits (71), Expect = 1e-30
 Identities = 86/91 (94%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||| |
Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749

                                           
Query: 209  ggtggtcagcgaggttctcgagcgggccctt 239
             ||||||||||||||||||||||||||||||
Sbjct: 1748 tgtggtcagcgaggttctcgagcgggccctt 1718



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                            
Query: 149      acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
                |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721

                                               
Query: 209      ggtggtcagcgaggttctcgagcgggccctt 239
                ||||||| |||||||||||||| ||||||||
Sbjct: 10793720 ggtggtcggcgaggttctcgagggggccctt 10793690



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444

                                            
Query: 209   ggtggtcagcgaggttctcgagcgggccctt 239
             ||||||| |||||||||||||| ||||||||
Sbjct: 17443 ggtggtcggcgaggttctcgagggggccctt 17413



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                          
Query: 149    acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
              |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339

                                             
Query: 209    ggtggtcagcgaggttctcgagcgggccctt 239
              ||||||| |||||||||||||| ||||||||
Sbjct: 130338 ggtggtcggcgaggttctcgagggggccctt 130308



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 788 ggtggtcggcgaggttctcgagggggccctt 758



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggccctt 763



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 795 ggtggtcggcgaggttctcgagggggccctt 765



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggccctt 763



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 793 ggtggtcggcgaggttctcgagggggccctt 763



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score =  133 bits (67), Expect = 3e-28
 Identities = 76/79 (96%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagg 808

                              
Query: 211 tggtcagcgaggttctcga 229
           ||||| |||||||||||||
Sbjct: 807 tggtcggcgaggttctcga 789



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  133 bits (67), Expect = 3e-28
 Identities = 85/91 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||
Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| |||||||||||||| ||||||||
Sbjct: 774 ggtggtcggcgaggttctcgagggggccctt 744



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  129 bits (65), Expect = 4e-27
 Identities = 83/89 (93%)
 Strand = Plus / Minus

                                                                        
Query: 151  ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
            |||||||| ||||||||||||||| ||||||| |||||||||||||| ||||| |||| |
Sbjct: 1676 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatg 1617

                                         
Query: 211  tggtcagcgaggttctcgagcgggccctt 239
            |||||||||||||||||||||||||||||
Sbjct: 1616 tggtcagcgaggttctcgagcgggccctt 1588



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  125 bits (63), Expect = 7e-26
 Identities = 84/91 (92%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134

                                           
Query: 209  ggtggtcagcgaggttctcgagcgggccctt 239
            | ||||| || | ||||||||| ||||||||
Sbjct: 1133 gatggtccgccaagttctcgagggggccctt 1103



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  121 bits (61), Expect = 1e-24
 Identities = 85/93 (91%)
 Strand = Plus / Minus

                                                                       
Query: 147 ttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggc 206
           |||||||||||| || |||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 810 ttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggc 751

                                            
Query: 207 gaggtggtcagcgaggttctcgagcgggccctt 239
           || |||||||||||||||||| || ||||||||
Sbjct: 750 gatgtggtcagcgaggttctcaagtgggccctt 718



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| || ||||||||
Sbjct: 736 ggtggtcggccaggttctc 718



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Plus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937

                                
Query: 209   ggtggtcagcgaggttctc 227
             ||||||| || ||||||||
Sbjct: 13938 ggtggtcggccaggttctc 13956



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064

                                
Query: 209   ggtggtcagcgaggttctc 227
             ||||||| || ||||||||
Sbjct: 21063 ggtggtcggccaggttctc 21045



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  117 bits (59), Expect = 2e-23
 Identities = 83/91 (91%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||| ||
Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtga 2660

                                           
Query: 209  ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||| |||||||||||||  ||||||||
Sbjct: 2659 ggtggtcggcgaggttctcgatggggccctt 2629



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| || ||||||||
Sbjct: 817 ggtggtcggccaggttctc 799



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| || ||||||||
Sbjct: 817 ggtggtcggccaggttctc 799



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| || ||||||||
Sbjct: 819 ggtggtcggccaggttctc 801



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  117 bits (59), Expect = 2e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| || ||||||||
Sbjct: 819 ggtggtcggccaggttctc 801



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  113 bits (57), Expect = 3e-22
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| |||||||| ||||| || ||||| ||||||||||||||||||||||||| |
Sbjct: 815 ttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatg 756

                                        
Query: 211 tggtcagcgaggttctcgagcgggccctt 239
           ||||||||||||||||| || ||||||||
Sbjct: 755 tggtcagcgaggttctcaagagggccctt 727



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  109 bits (55), Expect = 4e-21
 Identities = 64/67 (95%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803

                  
Query: 209 ggtggtc 215
           |||||||
Sbjct: 802 ggtggtc 796



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  109 bits (55), Expect = 4e-21
 Identities = 82/91 (90%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||||||||| ||||||||||||||||||||||| |||||||||  ||||||||||||||
Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcga 1473

                                           
Query: 209  ggtggtcagcgaggttctcgagcgggccctt 239
             |||||| || ||||||||||  ||||||||
Sbjct: 1472 tgtggtcggccaggttctcgatggggccctt 1442



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  107 bits (54), Expect = 2e-20
 Identities = 84/94 (89%)
 Strand = Plus / Minus

                                                                       
Query: 146 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 205
           ||||||||||||| ||||||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 976 tttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcgg 917

                                             
Query: 206 cgaggtggtcagcgaggttctcgagcgggccctt 239
           |||| ||||| || | ||||||||| || |||||
Sbjct: 916 cgagatggtccgccaagttctcgaggggcccctt 883



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  101 bits (51), Expect = 1e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                       
Query: 161 cgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcga 220
           |||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || |
Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggcca 636

                              
Query: 221 ggttctcgagcgggccctt 239
            ||||||||| || |||||
Sbjct: 635 agttctcgaggggtccctt 617



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score =  101 bits (51), Expect = 1e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| ||||||||||||||| ||||||| ||||||||||| |||||||| || |||
Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810

                              
Query: 211 tggtcagcgaggttctcga 229
           || ||||||||||||||||
Sbjct: 809 tgatcagcgaggttctcga 791



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  101 bits (51), Expect = 1e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||||||||||| || ||||||||||| ||||| || |
Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaa 767

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| |||||||||||
Sbjct: 766 ggtggtctgcgaggttctc 748



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  101 bits (51), Expect = 1e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779

                  
Query: 209 ggtggtc 215
           |||||||
Sbjct: 778 ggtggtc 772



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546

                               
Query: 209  ggtggtcagcgaggttctc 227
              ||||| |||||||||||
Sbjct: 2547 aatggtcggcgaggttctc 2565



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546

                               
Query: 209  ggtggtcagcgaggttctc 227
              ||||| |||||||||||
Sbjct: 2547 aatggtcggcgaggttctc 2565



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 791 aatggtcggcgaggttctc 773



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 750

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 749 aatggtcggcgaggttctc 731



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 736 aatggtcggcgaggttctc 718



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 791 aatggtcggcgaggttctc 773



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| ||||||||||||||  ||||||| ||||||||| | ||||||||||| |||
Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825

                              
Query: 211 tggtcagcgaggttctcga 229
           || ||||||||||||||||
Sbjct: 824 tgatcagcgaggttctcga 806



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 93264

                                
Query: 209   ggtggtcagcgaggttctc 227
               ||||| |||||||||||
Sbjct: 93265 aatggtcggcgaggttctc 93283



 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 96044

                                
Query: 209   ggtggtcagcgaggttctc 227
              |||||| |||||||||||
Sbjct: 96043 agtggtccgcgaggttctc 96025



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 80938

                                
Query: 209   ggtggtcagcgaggttctc 227
               ||||| |||||||||||
Sbjct: 80937 aatggtcggcgaggttctc 80919



 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 78158

                                
Query: 209   ggtggtcagcgaggttctc 227
              |||||| |||||||||||
Sbjct: 78159 agtggtccgcgaggttctc 78177



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 736 aatggtcggcgaggttctc 718



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 736 aatggtcggcgaggttctc 718



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 736 aatggtcggcgaggttctc 718



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 787 aatggtcggcgaggttctc 769



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 787 aatggtcggcgaggttctc 769



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 787 aatggtcggcgaggttctc 769



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 787 aatggtcggcgaggttctc 769



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| ||||||||||||||| ||||||| ||||||||||| |||||||| || |||
Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801

                              
Query: 211 tggtcagcgaggttctcga 229
           || |||| |||||||||||
Sbjct: 800 tgatcagtgaggttctcga 782



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 787 aatggtcggcgaggttctc 769



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 787 aatggtcggcgaggttctc 769



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 108

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 107 aatggtcggcgaggttctc 89



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 769

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 768 aatggtcggcgaggttctc 750



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 772

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 771 aatggtcggcgaggttctc 753



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 88  actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 147

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 148 aatggtcggcgaggttctc 166



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||| ||||||| |||||||||||||| ||||| || |
Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaa 789

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| |||||||||||
Sbjct: 788 ggtggtcggcgaggttctc 770



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 1037

                               
Query: 209  ggtggtcagcgaggttctc 227
              ||||| |||||||||||
Sbjct: 1036 aatggtcggcgaggttctc 1018



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                        
Query: 151  ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
            |||||||| ||||||||||||||  ||||||| ||||||||| | ||||||||||| |||
Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903

                               
Query: 211  tggtcagcgaggttctcga 229
            || ||||||||||||||||
Sbjct: 1902 tgatcagcgaggttctcga 1884



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           ||||| || ||||||||||||||  ||||||| ||||||||||| ||||||||||| |||
Sbjct: 285 ttgccaggtacgaagttggtggcataggcccaggcgttgttgttaacggggtcggccagg 226

                              
Query: 211 tggtcagcgaggttctcga 229
           || ||||||||||||||||
Sbjct: 225 tgatcagcgaggttctcga 207



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 69/77 (89%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| ||||||||||||||| | ||||| ||||||||||||||||||||||| ||||| 
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggccaggtga 330

                            
Query: 214 tcagcgaggttctcgag 230
           || |||||||| |||||
Sbjct: 329 tcggcgaggttntcgag 313



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||||||||| ||||||||||||||| | ||||| |||||||||  ||||||||||||||
Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 79033

                                            
Query: 209   ggtggtcagcgaggttctcgagcgggccctt 239
              ||||||   |||||||||||  ||||||||
Sbjct: 79034 cgtggtcgaagaggttctcgatggggccctt 79064



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                            
Query: 149      acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
                |||||||||| ||||||||||||||| | ||||| |||||||||  ||||||||||||||
Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21808783

                                               
Query: 209      ggtggtcagcgaggttctcgagcgggccctt 239
                 ||||||   |||||||||||  ||||||||
Sbjct: 21808782 cgtggtcgaagaggttctcgatggggccctt 21808752



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                            
Query: 149      acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
                |||||||||| ||||||||||||||| | ||||| |||||||||  ||||||||||||||
Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21801812

                                               
Query: 209      ggtggtcagcgaggttctcgagcgggccctt 239
                 ||||||   |||||||||||  ||||||||
Sbjct: 21801811 cgtggtcgaagaggttctcgatggggccctt 21801781



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| ||||||||||| || |||||||| |
Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaa 769

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 768 aatggtcggcgaggttctc 750



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||  ||||||||||||||
Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 782

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||   |||||||||||  ||||||||
Sbjct: 781 cgtggtcgaagaggttctcgatggggccctt 751



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||  ||||||||||||||
Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 357

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||   |||||||||||  ||||||||
Sbjct: 356 cgtggtcgaagaggttctcgatggggccctt 326



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| ||||| ||||||||||| |||||||| |||||||| || |
Sbjct: 187 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 128

                              
Query: 209 ggtggtcagcgaggttctc 227
           |||||||||||||||||||
Sbjct: 127 ggtggtcagcgaggttctc 109



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | ||||| |||||||||  ||||||||||||||
Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 771

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||   |||||||||||  ||||||||
Sbjct: 770 cgtggtcgaagaggttctcgatggggccctt 740



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| ||||||| || ||||||||||| ||||| || |
Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaa 762

                              
Query: 209 ggtggtcagcgaggttctc 227
           |||| ||||| ||||||||
Sbjct: 761 ggtgatcagcaaggttctc 743



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 146 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 205
           ||||||| || || || |||||||||||| ||||||| |||||||||||||| |||||||
Sbjct: 852 tttactttccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcgg 793

                                 
Query: 206 cgaggtggtcagcgaggttctc 227
           | ||||| || |||||||||||
Sbjct: 792 caaggtgatcggcgaggttctc 771



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 69/77 (89%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 137 tttcaagtgttt-acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttg 195
           ||||||||| || |||||||||| || ||||||||||| || ||||| || |||||||||
Sbjct: 483 tttcaagtgcttcacttgccggggacaaagttggtggcaaaagcccaggcattgttgttg 424

                            
Query: 196 acggggtcggcgaggtg 212
           |||||||||||||||||
Sbjct: 423 acggggtcggcgaggtg 407



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgagg 222
           |||||||||||| ||||||| |||||||||||||| ||||| |||||||| || ||||||
Sbjct: 822 aagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgaggtgatcggcgagg 763

                
Query: 223 ttctc 227
           |||||
Sbjct: 762 ttctc 758



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| ||||||||||||||| ||||||| || |||||||| ||||||||||| ||||| 
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 833

                           
Query: 214 tcagcgaggttctcga 229
           || || ||||||||||
Sbjct: 832 tcggcaaggttctcga 817



to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 204 ggcgaggtggtcagcgaggttctcgagcgggcccttacca 243
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 3   ggcgaggtggtcagcgaggttctcgagcgggcccttacca 42



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| ||||| ||||||||| ||||||| || |||||||| ||||||||||| ||||| 
Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 826

                           
Query: 214 tcagcgaggttctcga 229
           || |||||||||||||
Sbjct: 825 tcggcgaggttctcga 810



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttacca 774



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||| ||||||||||| |||||||||||||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttacca 761



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 809 aatggtcagcaaggttctctatcggtcccttacca 775



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 701

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 700 aatggtcagcaaggttctctatcggtcccttacca 666



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||||||||||| |||||||||||||| || || || |
Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 571

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 570 aatggtcggcgaggttctc 552



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttacca 761



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 743

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttacca 708



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttacca 774



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 76/87 (87%), Gaps = 1/87 (1%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaa-ggcccacgcgttgttgttgacggggtcggcgaggtg 212
           ||||| |||||||| ||||| || |||||| ||||||||||| |||||||| || |||||
Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacggggtctgctaggtg 625

                                      
Query: 213 gtcagcgaggttctcgagcgggccctt 239
           |||||| |||||||| | |||||||||
Sbjct: 624 gtcagcaaggttctccaacgggccctt 598



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttacca 761



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||| ||||||||||| |||||||||||||| || ||||| |
Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 743

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttacca 708



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttacca 708



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||| ||||||||||| |||||||||||||| || ||||| |
Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 795 aatggtcagcaaggttctctatcggtcccttacca 761



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 794 aatggtcagcaaggttctctatcggtcccttacca 760



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 742 aatggtcagcaaggttctctatcggtcccttacca 708



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttacca 774



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttacca 774



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 789

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 788 aatggtcagcaaggttctctatcggtcccttacca 754



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 794 aatggtcagcaaggttctctatcggtcccttacca 760



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 808 aatggtcagcaaggttctctatcggtcccttacca 774



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 113

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 112 aatggtcagcaaggttctctatcggtcccttacca 78



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 778

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 777 aatggtcagcaaggttctctatcggtcccttacca 743



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||||||| ||||||| |||||||||| ||| |||||||| |
Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggcca 779

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 778 aatggtcggcgaggttctc 760



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 70/79 (88%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||| ||||||||||||||||| |||||||||||||| |||||||| |
Sbjct: 830 actttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 772

                              
Query: 209 ggtggtcagcgaggttctc 227
             ||||| |||||||||||
Sbjct: 771 aatggtcggcgaggttctc 753



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 689

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 688 aatggtcagcaaggttctctatcggtcccttacca 654



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||| ||||| || |||||||| ||||||||||| |||||||||||||| || ||||| |
Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 22481

                                                
Query: 209   ggtggtcagcgaggttctcgagcgggcccttacca 243
               |||||||| |||||||| | ||| |||||||||
Sbjct: 22480 aatggtcagcaaggttctctatcggtcccttacca 22446



 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 19835

                                                
Query: 209   ggtggtcagcgaggttctcgagcgggcccttacca 243
               |||||||| |||||||| | ||| |||||||||
Sbjct: 19834 aatggtcagcaaggttctctatcggtcccttacca 19800



 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                         
Query: 149   acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
             |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 16172

                                                
Query: 209   ggtggtcagcgaggttctcgagcgggcccttacca 243
               |||||||| |||||||| | ||| |||||||||
Sbjct: 16173 aatggtcagcaaggttctctatcggtcccttacca 16207



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 809 aatggtcagcaaggttctctatcggtcccttacca 775



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 69/79 (87%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| || ||||| ||||| ||||||||||| |||||||| |||||||| || |
Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 970

                               
Query: 209  ggtggtcagcgaggttctc 227
            |||| ||||||||||||||
Sbjct: 969  ggtgatcagcgaggttctc 951



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 960

                                               
Query: 209  ggtggtcagcgaggttctcgagcgggcccttacca 243
              |||||||| |||||||| | ||| |||||||||
Sbjct: 959  aatggtcagcaaggttctctatcggtcccttacca 925



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| || |||||||| ||||||||||| |||||||||||||| || ||||| |
Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 949

                                               
Query: 209  ggtggtcagcgaggttctcgagcgggcccttacca 243
              |||||||| |||||||| | ||| |||||||||
Sbjct: 948  aatggtcagcaaggttctctatcggtcccttacca 914



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 888

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 887 aatggtcagcaaggttctctatcggtcccttacca 853



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| || ||||| |||||||| ||||| ||||||||||| |||||||| || ||||||
Sbjct: 791 ccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggtgg 732

                         
Query: 214 tcagcgaggttctc 227
           ||||| ||||||||
Sbjct: 731 tcagcaaggttctc 718



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                             
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 197
            |||| ||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2326



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                        
Query: 144  tgtttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtc 203
            |||| |||| ||||| || ||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 8568 tgttcactttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtc 8627

                                 
Query: 204  ggcgaggtggtcagcgaggtt 224
             |||| ||||||||| |||||
Sbjct: 8628 agcgatgtggtcagcaaggtt 8648



 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtc 203
           |||| ||||| || ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 215 actttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtc 161



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| |||||||| |||||| | ||||| |||||||||  |||||||||||||| |
Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765

                                        
Query: 211 tggtcagcgaggttctcgagcgggccctt 239
           |||||   |||||||||||  ||||||||
Sbjct: 764 tggtcgaagaggttctcgatggggccctt 736



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                             
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 197
            |||| ||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgac 2327



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| |||||||| |||||| | ||||| |||||||||  |||||||||||||| |
Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413

                                        
Query: 211 tggtcagcgaggttctcgagcgggccctt 239
           |||||   |||||||||||  ||||||||
Sbjct: 412 tggtcgaagaggttctcgatggggccctt 384



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 801 agtggtccgcgaggttctc 783



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||||||||||| ||||||||||| || || ||||| |
Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 571

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| || ||||| | ||| |||||||||
Sbjct: 570 aatggtcagcaagattctccaacggtcccttacca 536



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| || ||||| |||||||||||||| ||||| || |
Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtcagcaa 792

                              
Query: 209 ggtggtcagcgaggttctc 227
           | |||||||| ||||||||
Sbjct: 791 gatggtcagcaaggttctc 773



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 739 agtggtccgcgaggttctc 721



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 801 agtggtccgcgaggttctc 783



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 801 agtggtccgcgaggttctc 783



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 808

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 807 agtggtccgcgaggttctc 789



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 81/95 (85%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||||||| |||||||||||||| || ||||| |
Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcggcca 781

                                              
Query: 209 ggtggtcagcgaggttctcgagcgggcccttacca 243
             |||||||| |||||||| | ||| |||||||||
Sbjct: 780 aatggtcagcaaggttctctatcggtcccttacca 746



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 460

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 459 agtggtccgcgaggttctc 441



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 801 agtggtccgcgaggttctc 783



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 169 gtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||| ||||||||||| |||||||| |||||||| || ||||| ||||||||||||||
Sbjct: 900 gtggcaaaggcccacgcattgttgttaacggggtcagcaaggtgatcagcgaggttctc 842



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 1040

                               
Query: 209  ggtggtcagcgaggttctc 227
             |||||| |||||||||||
Sbjct: 1039 agtggtccgcgaggttctc 1021



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtc 203
           |||| ||||| ||||||||||| ||||||||||| |||||||||||||| |||||
Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| ||||||||||| ||||||||||| || ||||||||||| || || || |
Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| |||||||||||
Sbjct: 739 agtggtccgcgaggttctc 721



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||  ||||||| |||||||||||||| |||||||| |
Sbjct: 850 actttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggcaa 791

                              
Query: 209 ggtggtcagcgaggttctc 227
           | || ||||| ||||||||
Sbjct: 790 gatgatcagcaaggttctc 772



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| ||||||||||||||| | | ||| |||||||||  ||||||||||| ||
Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtga 763

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
            ||||||   |||||||||||  ||||||||
Sbjct: 762 cgtggtcgaagaggttctcgatggggccctt 732



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| || ||||| |||||||| ||||| || |||||||| |||||||| || ||||||
Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtgg 776

                         
Query: 214 tcagcgaggttctc 227
           ||||| ||||||||
Sbjct: 775 tcagcaaggttctc 762



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           |||||||||||||||||||| | |  |||||||||||||||||| |||||||| | ||||
Sbjct: 994 ccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtgg 935

             
Query: 214 tc 215
           ||
Sbjct: 934 tc 933



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| || ||||| |||||||||||||| || ||||| ||||| ||||| ||||| |||
Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgagatgg 940

                         
Query: 214 tcagcgaggttctc 227
           ||||| ||||||||
Sbjct: 939 tcagcaaggttctc 926



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 163 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgagg 222
           ||||| |||||||||||||| || |||||||| || |||||||| ||||| ||||| |||
Sbjct: 800 aagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaaggtgatcagcaagg 741

                
Query: 223 ttctc 227
           |||||
Sbjct: 740 ttctc 736



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 163 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgagg 222
           ||||| |||||| ||||||| || |||||||| |||||||| || ||||||||||| |||
Sbjct: 782 aagtttgtggcgtaggcccaggcattgttgttaacggggtctgcaaggtggtcagcaagg 723

                
Query: 223 ttctc 227
           |||||
Sbjct: 722 ttctc 718



to top

>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding  protein
           mRNA, partial cds
          Length = 191

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 151 ttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgagg 210
           |||||||| |||||||| |||||| | ||||| |||||||||  |||||||||||  | |
Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggssacg 47

                                        
Query: 211 tggtcagcgaggttctcgagcgggccctt 239
           |||||   |||||||||||  ||||||||
Sbjct: 46  tggtcgaagaggttctcgatggggccctt 18



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 146 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 205
           |||| |||||||| ||||||||||||||| | ||||| |||||||||  ||||||||| |
Sbjct: 579 tttagttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcag 520

                                   
Query: 206 cgaggtggtcagcgaggttctcga 229
           |||  |||||   |||||||||||
Sbjct: 519 cgacatggtcgaagaggttctcga 496



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 176  aggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
            ||||||| ||||||||||| || |||||||| ||||||||||| ||||||||
Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctc 2174



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| ||||||||||||||  ||||||| |||||||||||||| ||  | || |
Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccagcaa 981

                               
Query: 209  ggtggtcagcgaggttctc 227
            |||| || |||||||||||
Sbjct: 980  ggtgatcggcgaggttctc 962



to top

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 185 cgttgttgttgacggggtcggcgaggtggtc 215
           |||||||||||||||||||||||||||||||
Sbjct: 955 cgttgttgttgacggggtcggcgaggtggtc 925



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||||||||| || || ||||||||| | ||||| |||||||||  ||||||||||||||
Sbjct: 837 acttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggcga 778

                  
Query: 209 ggtggtc 215
            ||||||
Sbjct: 777 cgtggtc 771



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| ||||| |||||||| ||||||||||| || ||||| || |
Sbjct: 837 actttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtcagcaa 778

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| || ||||||||
Sbjct: 777 ggtggtcggcaaggttctc 759



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| ||||| |||||||| ||||||||||| || |||||||| |
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaa 290

                              
Query: 209 ggtggtcagcgaggttctc 227
            |||||| || ||||||||
Sbjct: 289 tgtggtcggcaaggttctc 271



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 67/79 (84%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||  ||||||| || ||||||||||| ||||| || |
Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaa 931

                              
Query: 209 ggtggtcagcgaggttctc 227
           |||||||||| | ||||||
Sbjct: 930 ggtggtcagccaagttctc 912



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 767



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 791



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 791



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 793



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 796



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 796



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 798



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 831



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 758 acggggtcggcgaggtgatcagcgaggttctcga 725



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||||||||| ||||||||||||||||
Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcga 736



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                  
Query: 166      ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
                ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 22434804



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 166   ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
             ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 95871



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 796



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 154  ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
            ||||| ||||||||||||||| ||||||| |||||||||   ||||||||||| | ||||
Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggccaagtgg 2958

              
Query: 214  tc 215
            ||
Sbjct: 2957 tc 2956



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 796



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 796



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 767



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 796



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 791



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 791



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 796



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 792



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 166 ttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtc 215
           ||||||||| || |||| |||||||||  |||||||||||||||||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtc 798



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 64/74 (86%), Gaps = 1/74 (1%)
 Strand = Plus / Plus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| || ||||| |||||||| ||| | ||||||||||| |||||||| || ||||||
Sbjct: 6   ccggggacaaagtttgtggcgaaagccaa-gcgttgttgttaacggggtctgcaaggtgg 64

                         
Query: 214 tcagcgaggttctc 227
           ||||| ||||||||
Sbjct: 65  tcagcaaggttctc 78



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| ||||||||||||||| ||||||| |||||||||   ||||||||||| | ||||
Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggccaagtgg 780

             
Query: 214 tc 215
           ||
Sbjct: 779 tc 778



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                        
Query: 146  tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 205
            ||||||| ||||| || ||||| |||||  ||||||| ||||||||||| |||||||| |
Sbjct: 2709 tttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcag 2650

                                  
Query: 206  cgaggtggtcagcgaggttctc 227
            | ||||| ||| | ||||||||
Sbjct: 2649 caaggtgatcaacaaggttctc 2628



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                        
Query: 154  ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
            ||||| || ||||| |||||| ||||||| || |||||||| || ||||| || ||||||
Sbjct: 7665 ccggggacaaagtttgtggcgtaggcccaagcattgttgttaactgggtctgcaaggtgg 7606

                          
Query: 214  tcagcgaggttctc 227
            ||||| ||||||||
Sbjct: 7605 tcagcaaggttctc 7592



 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                        
Query: 154  ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
            ||||| || ||||| |||||  ||| ||| ||||||||||| || ||||| || ||||||
Sbjct: 5125 ccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtctgcaaggtgg 5066

                          
Query: 214  tcagcgaggttctc 227
            ||||| ||||||||
Sbjct: 5065 tcagcaaggttctc 5052



 Score = 50.1 bits (25), Expect = 0.003
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 163  aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgagg 222
            ||||| |||||| ||| ||| ||||||||||| || ||||| || || |||||||| |||
Sbjct: 2663 aagtttgtggcgtaggaccaggcgttgttgttaactgggtcagcaagatggtcagcaagg 2604

                 
Query: 223  ttctc 227
            |||||
Sbjct: 2603 ttctc 2599



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 160 acgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtg 212
           |||||||||||||| || ||||| || |||||||||||||| ||||| |||||
Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtg 609



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgac 197
           |||| ||||| |||||||||||||| |||||||| || |||||||||||
Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgac 793



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 184 gcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||||||||| |||||||| || ||||||||||| ||||||||
Sbjct: 761 gcgttgttgttaacggggtctgcaaggtggtcagcaaggttctc 718



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||||||||| |||  ||| || |||||||| || ||||| || |
Sbjct: 851 actttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagcaa 792

                           
Query: 209 ggtggtcagcgaggtt 224
           ||||||||||||||||
Sbjct: 791 ggtggtcagcgaggtt 776



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||  ||||||| || ||||||||||| ||||| |  |
Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtcagaaa 754

                              
Query: 209 ggtggtcagcgaggttctc 227
           | |||||||| ||||||||
Sbjct: 753 gatggtcagcaaggttctc 735



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                        
Query: 146  tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 205
            ||||||| ||||| || ||||| |||||  ||||||| ||||||||||| |||||||| |
Sbjct: 1306 tttactttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtcag 1247

                   
Query: 206  cgaggtg 212
            | |||||
Sbjct: 1246 caaggtg 1240



to top

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| ||||| |||||||| || |||||||| || ||||| || |
Sbjct: 835 actttccgggaacaaagttagtggcaaaggcccaggcattgttgttaacagggtctgcaa 776

                              
Query: 209 ggtggtcagcgaggttctc 227
           |||||||||| | ||||||
Sbjct: 775 ggtggtcagccaagttctc 757



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || |||||||||||| ||| ||| || |||||||| || ||||| || |
Sbjct: 869 actttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagcaa 810

                              
Query: 209 ggtggtcagcgaggttctc 227
           ||||||| || ||||||||
Sbjct: 809 ggtggtcggctaggttctc 791



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| |||||| ||| ||| ||||||||||| || || ||||| |
Sbjct: 229 actttccgggaacaaagtttgtggcgtaggaccaagcgttgttgttaactggatcggcaa 170

                              
Query: 209 ggtggtcagcgaggttctc 227
           | |||||||| ||||||||
Sbjct: 169 gatggtcagcaaggttctc 151



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           ||||||||||  | ||||| || ||||||||||| || |||||||| || ||||| || |
Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtctgcaa 799

                              
Query: 209 ggtggtcagcgaggttctc 227
           | || ||||||||||||||
Sbjct: 798 gatgatcagcgaggttctc 780



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| ||||| || ||||| ||||||||||| || ||||| || |
Sbjct: 349 actttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgcaa 290

                              
Query: 209 ggtggtcagcgaggttctc 227
           |||| ||||| ||||||||
Sbjct: 289 ggtgatcagcaaggttctc 271



to top

>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end
          Length = 351

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| ||||| || ||||| ||||||||||| || ||||| || |
Sbjct: 349 actttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgcaa 290

                              
Query: 209 ggtggtcagcgaggttctc 227
           |||| ||||| ||||||||
Sbjct: 289 ggtgatcagcaaggttctc 271



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||| ||||| ||||||||||||||||
Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcga 736



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||| ||||| ||||||||||||||||
Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcga 736



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           ||||||||||| ||||| ||||||||||||||||
Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcga 736



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 151  ttgccgggcacgaagttggtggcgaaggcccacgcgttgttg 192
            |||||||| ||||||||||||||| | ||||| |||||||||
Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| || ||||| ||||| |||||||| || ||||||||||| || || || ||||||
Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatctgcaaggtgg 732

                         
Query: 214 tcagcgaggttctc 227
           ||||| || |||||
Sbjct: 731 tcagcaagattctc 718



to top

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| || ||||| |||||| ||| ||| ||||||||||| || ||||| || ||||| 
Sbjct: 344 ccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtctgcaaggtga 285

                         
Query: 214 tcagcgaggttctc 227
           ||||| ||||||||
Sbjct: 284 tcagcaaggttctc 271



to top

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 154 ccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtgg 213
           ||||| || ||||| |||||| | ||||| || |||||||| || ||||| || ||||||
Sbjct: 927 ccggggacaaagtttgtggcgtacgcccaagcattgttgttaactgggtctgcaaggtgg 868

                         
Query: 214 tcagcgaggttctc 227
           ||||| ||||||||
Sbjct: 867 tcagcaaggttctc 854



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 183 cgcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||||||||||||| |||||||| | |||||| || ||||||||
Sbjct: 760 cgcgttgttgttgacagggtcggcaatgtggtcggcaaggttctc 716



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 184 gcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||||||||| || |||||||| ||||| ||||| ||||||||
Sbjct: 997 gcgttgttgttaactgggtcggcaaggtgatcagcaaggttctc 954



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 184 gcgttgttgttgacggggtcggcgaggtggtcagcgaggttctcgagcgggccctt 239
           ||||||||| || ||||||| || ||||||||||| ||||||| ||  ||||||||
Sbjct: 766 gcgttgttggtgccggggtcagccaggtggtcagccaggttctggatggggccctt 711



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 184 gcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||||||||| || ||||| || ||||||||||| ||||||||
Sbjct: 822 gcgttgttgttaaccgggtcagcaaggtggtcagcaaggttctc 779



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 184 gcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||||||||| |||||||| || |||||||| || ||||||||
Sbjct: 761 gcgttgttgttaacggggtctgcaaggtggtctgcaaggttctc 718



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 184  gcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
            ||||||||||| || ||||| || ||||||||||| ||||||||
Sbjct: 1742 gcgttgttgttaaccgggtcagcaaggtggtcagcaaggttctc 1699



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 51/59 (86%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                      
Query: 149 acttgccgggcacgaagttggtggcgaaggccc-acgcgttgttgttgacggggtcggc 206
           |||| ||||| || |||||||| |||||||||| | |||||||||||||| || |||||
Sbjct: 53  actttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                       
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
           |||| ||||| || ||||| |||||  | ||||| || ||||||||||| ||||| || |
Sbjct: 848 actttccggggacaaagtttgtggcatatgcccaagcattgttgttgacagggtcagcaa 789

                                          
Query: 209 ggtggtcagcgaggttctcgagcgggccctt 239
           ||||||| || ||||| || ||||| |||||
Sbjct: 788 ggtggtctgcaaggttttccagcggtccctt 758



to top

>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein
          Length = 1067

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 185 cgttgttgttgacggggtcggcgaggtggtcagcgaggttctcgagcgggccctt 239
           |||||||| || ||||| | || ||||||||||| |||||||| || ||||||||
Sbjct: 740 cgttgttggtgccgggggcagccaggtggtcagccaggttctccagggggccctt 686



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtc 203
           |||| ||||| || ||||| ||||| |||||||| ||||||||||| || |||||
Sbjct: 349 actttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtc 295



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| || ||||| |||||  ||||||| ||||||||||| || ||||| || |
Sbjct: 1872 actttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagcaa 1931

                               
Query: 209  ggtggtcagcgaggttctc 227
            | ||||| || ||||||||
Sbjct: 1932 gatggtcggcaaggttctc 1950



to top

>gb|AY171231.1| Chlamydomonas reinhardtii light-harvesting complex I protein (Lhca)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1274

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 198 ggggtcggcgaggtggtcagcgaggttctcgagcgggccctt 239
           |||||| || ||||||||||| ||||| ||||| ||||||||
Sbjct: 685 ggggtcagccaggtggtcagccaggttgtcgagggggccctt 644



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 178 gcccacgcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||| || |||||| |||| ||||| || ||||||||||| ||||||||
Sbjct: 755 gcccaggcattgttggtgactgggtcagcaaggtggtcagcaaggttctc 706



to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 149 acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgtt 194
           |||| ||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgttgtt 829



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           |||||||| || ||||| ||||||||||||||||
Sbjct: 769 acggggtcagccaggtgatcagcgaggttctcga 736



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 196 acggggtcggcgaggtggtcagcgaggttctcga 229
           |||||||| || ||||| ||||||||||||||||
Sbjct: 769 acggggtcagccaggtgatcagcgaggttctcga 736



to top

>gb|AY106149.1| Zea mays PCO102434 mRNA sequence
          Length = 1081

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 199 gggtcggcgaggtggtcagcgaggttctcgagcgggcc 236
           |||||||||||||||   ||||||||||| ||||||||
Sbjct: 750 gggtcggcgaggtgggaggcgaggttctccagcgggcc 713



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                       
Query: 146 tttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcgg 205
           ||||||| ||||| || |||||||||||  ||||||| || |||||||| || || || |
Sbjct: 825 tttactttccggggacaaagttggtggcataggcccatgcattgttgttcactggatcag 766

                                 
Query: 206 cgaggtggtcagcgaggttctc 227
           | ||| |||| || ||||||||
Sbjct: 765 caagggggtcggctaggttctc 744



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                        
Query: 142  agtgtttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 201
            |||||||| || ||||| || |||||||||||  | | ||| || ||||||||||| |||
Sbjct: 1524 agtgtttattttccgggaacaaagttggtggcatatgaccatgcattgttgttgactggg 1465

                                      
Query: 202  tcggcgaggtggtcagcgaggttctc 227
            || || || || ||||| ||||||||
Sbjct: 1464 tctgcaagatgatcagcaaggttctc 1439



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                        
Query: 142  agtgtttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacgggg 201
            |||||||| || ||||| || |||||||||||  | | ||| || ||||||||||| |||
Sbjct: 1825 agtgtttattttccgggaacaaagttggtggcatatgaccatgcattgttgttgactggg 1766

                                      
Query: 202  tcggcgaggtggtcagcgaggttctc 227
            || || || || ||||| ||||||||
Sbjct: 1765 tctgcaagatgatcagcaaggttctc 1740



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 178 gcccacgcgttgttgttgacggggtcggcgaggtggtcagcgaggttctc 227
           ||||| || |||||| |||| ||||| || ||||||||||| ||||||||
Sbjct: 811 gcccaagcattgttggtgactgggtcagcaaggtggtcagcaaggttctc 762



to top

>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial
           sequence; nuclear gene for chloroplast product
          Length = 255

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 149 acttgccgggcacgaagttggtggc 173
           |||| ||||||||||||||||||||
Sbjct: 183 acttcccgggcacgaagttggtggc 159



to top

>emb|AL138926.13| Human DNA sequence from clone RP11-173E24 on chromosome 1q31.1-31.3,
              complete sequence
          Length = 169162

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 30     atgttccatatgggccctcaa 50
              |||||||||||||||||||||
Sbjct: 137529 atgttccatatgggccctcaa 137549



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 205 gcgaggtggtcagcgaggttctcga 229
           |||||||| ||||||||||||||||
Sbjct: 760 gcgaggtgatcagcgaggttctcga 736



to top

>gb|AC091947.4| Homo sapiens chromosome 5 clone RP11-367F9, complete sequence
          Length = 170063

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 46     ctcaattgtaaacatctttga 66
              |||||||||||||||||||||
Sbjct: 100293 ctcaattgtaaacatctttga 100273



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 147 ttacttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtc 203
           |||||| ||||| ||||||||||| || || ||||| || |||||||| || |||||
Sbjct: 807 ttactttccggggacgaagttggtcgcaaaagcccaagcattgttgttaaccgggtc 751



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 199 gggtcggcgaggtggtcagcgaggttctc 227
           ||||| || ||||||||||||||||||||
Sbjct: 578 gggtcagcaaggtggtcagcgaggttctc 550



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 163 aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgagg 222
           |||||||||||  | ||||| ||||| ||||| || ||||| || |||||||| || | |
Sbjct: 871 aagttggtggcataagcccaggcgttattgttcaccgggtcagcaaggtggtcggccaag 812

                            
Query: 223 ttctcgagcgggccctt 239
           ||||| ||||| |||||
Sbjct: 811 ttctccagcggaccctt 795



to top

>gb|AY653733.1| Acanthamoeba polyphaga mimivirus, complete genome
          Length = 1181404

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 72    tacaacatcaacgatccgatattag 96
             ||||||||||| |||||||||||||
Sbjct: 68412 tacaacatcaaggatccgatattag 68388



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                         
Query: 163   aagttggtggcgaaggcccacgcgttgttgttgacggggtcggcgaggtggtcagcgagg 222
             |||||||||||  ||||||| || |||||||| || ||||| |  |||||||| || |||
Sbjct: 65575 aagttggtggcataggcccaggcattgttgttaactgggtcagaaaggtggtctgcaagg 65634

                  
Query: 223   ttctc 227
             |||||
Sbjct: 65635 ttctc 65639



to top

>gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, complete sequence
          Length = 220334

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 98    catacatccagagtacacacatac 121
             ||||||| ||||||||||||||||
Sbjct: 92264 catacatacagagtacacacatac 92287



to top

>gb|BC052945.1| Homo sapiens cDNA clone IMAGE:5268504
          Length = 3651

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   ccctcaattgtaaacatctt 63
            ||||||||||||||||||||
Sbjct: 3435 ccctcaattgtaaacatctt 3416



to top

>gb|AC183109.2| Pan troglodytes BAC clone CH251-317D18 from chromosome 5, complete
              sequence
          Length = 169688

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     ccctcaattgtaaacatctt 63
              ||||||||||||||||||||
Sbjct: 101948 ccctcaattgtaaacatctt 101929



to top

>ref|XM_944925.1| PREDICTED: Homo sapiens hypothetical protein LOC649241, transcript
            variant 1 (LOC649242), mRNA
          Length = 3631

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   ccctcaattgtaaacatctt 63
            ||||||||||||||||||||
Sbjct: 3429 ccctcaattgtaaacatctt 3410



to top

>ref|XM_932161.1| PREDICTED: Homo sapiens hypothetical protein LOC643200, transcript
            variant 1 (LOC643201), mRNA
          Length = 3631

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 44   ccctcaattgtaaacatctt 63
            ||||||||||||||||||||
Sbjct: 3429 ccctcaattgtaaacatctt 3410



to top

>gb|DP000032.1| Felis catus target 116 genomic scaffold
          Length = 376810

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      aaaccatgcatttctcatat 20
              ||||||||||||||||||||
Sbjct: 108334 aaaccatgcatttctcatat 108353



to top

>gb|AC139491.2| Homo sapiens chromosome 5 clone RP11-826N14, complete sequence
          Length = 186722

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ccctcaattgtaaacatctt 63
             ||||||||||||||||||||
Sbjct: 21773 ccctcaattgtaaacatctt 21754



to top

>gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H24, complete sequence
          Length = 104325

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ccctcaattgtaaacatctt 63
             ||||||||||||||||||||
Sbjct: 78023 ccctcaattgtaaacatctt 78004



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 160 acgaagttggtggcgaaggcccacgcgttgtt 191
           |||||||||||||| |||||||| || |||||
Sbjct: 860 acgaagttggtggcaaaggcccaggcattgtt 829



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 189    gttgttgacggggtcggcga 208
              ||||||||||||||||||||
Sbjct: 357104 gttgttgacggggtcggcga 357085



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 151  ttgccgggcacgaagttggtggcg 174
            |||||||||||||| |||||||||
Sbjct: 1742 ttgccgggcacgaacttggtggcg 1719



to top

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                        
Query: 149  acttgccgggcacgaagttggtggcgaaggcccacgcgttgttgttgacggggtcggcga 208
            |||| ||||| || ||||| |||||  | ||||| || ||||||||||| ||||| || |
Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagcaa 1491

                            
Query: 209  ggtggtcagcgaggtt 224
            |||| ||||| |||||
Sbjct: 1490 ggtgatcagcaaggtt 1475


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,895,825
Number of Sequences: 3902068
Number of extensions: 1895825
Number of successful extensions: 34934
Number of sequences better than 10.0: 247
Number of HSP's better than 10.0 without gapping: 247
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 34562
Number of HSP's gapped (non-prelim): 373
length of query: 243
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 221
effective length of database: 17,147,199,772
effective search space: 3789531149612
effective search space used: 3789531149612
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top