ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet56f07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC130821.3| Mus musculus BAC clone RP23-205K12 from chromosome 13, complete sequence Length = 227411 Score = 46.1 bits (23), Expect = 0.046 Identities = 26/27 (96%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatgcac 156 ||||||||||| ||||||||||||||| Sbjct: 27546 ctctctctctctctcacatgcatgcac 27520
>gb|AC123043.2| Mus musculus BAC clone RP24-547G7 from 13, complete sequence Length = 230940 Score = 46.1 bits (23), Expect = 0.046 Identities = 26/27 (96%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcac 156 ||||||||||| ||||||||||||||| Sbjct: 58625 ctctctctctctctcacatgcatgcac 58651
>gb|AC025571.20| Homo sapiens 3 BAC RP11-515C21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 159902 Score = 46.1 bits (23), Expect = 0.046 Identities = 23/23 (100%) Strand = Plus / Plus Query: 140 cactcacatgcatgcacagacac 162 ||||||||||||||||||||||| Sbjct: 66965 cactcacatgcatgcacagacac 66987
>gb|AC135388.2| Homo sapiens 12 BAC RP11-474D1 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 85801 Score = 46.1 bits (23), Expect = 0.046 Identities = 23/23 (100%) Strand = Plus / Minus Query: 131 tctctctctcactcacatgcatg 153 ||||||||||||||||||||||| Sbjct: 62582 tctctctctcactcacatgcatg 62560
>emb|AL663027.9| Mouse DNA sequence from clone RP23-16P3 on chromosome 2, complete sequence Length = 219778 Score = 46.1 bits (23), Expect = 0.046 Identities = 26/27 (96%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcac 156 ||||||||||| ||||||||||||||| Sbjct: 70575 ctctctctctctctcacatgcatgcac 70601
>gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, complete sequence Length = 245125 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 132 ctctctctcactcacatgcatgcaca 157 ||||||||||| |||||||||||||| Sbjct: 44586 ctctctctcacacacatgcatgcaca 44561
>gb|AC139757.4| Mus musculus BAC clone RP23-440H11 from chromosome 18, complete sequence Length = 193847 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 132 ctctctctcactcacatgcatgcaca 157 ||||||||||| |||||||||||||| Sbjct: 183892 ctctctctcacacacatgcatgcaca 183867
>emb|BX005408.12| Zebrafish DNA sequence from clone DKEY-156H23 in linkage group 9, complete sequence Length = 210207 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgca 151 |||||||||||||||||||||| Sbjct: 33711 ctctctctctcactcacatgca 33732
>gb|AC093010.7| Homo sapiens 3 BAC RP11-553L6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 161077 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 131 tctctctctcactcacatgcatgcac 156 |||||||||| ||||||||||||||| Sbjct: 127879 tctctctctctctcacatgcatgcac 127854
>emb|CT573039.4| Wallaby DNA sequence from clone MEKBa-403O8, complete sequence Length = 76601 Score = 44.1 bits (22), Expect = 0.18 Identities = 31/34 (91%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatgcacagacact 163 ||||||||||| || |||||||||||||||||| Sbjct: 41060 ctctctctctctttctcatgcatgcacagacact 41027
>emb|AL953877.5| Zebrafish DNA sequence from clone CH211-188M3, complete sequence Length = 152080 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgca 151 |||||||||||||||||||||| Sbjct: 19947 ctctctctctcactcacatgca 19926
>gb|AC009152.8| Homo sapiens chromosome 16 clone RP11-567P19, complete sequence Length = 171127 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Minus Query: 133 tctctctcactcacatgcatgcaca 157 |||||||||| |||||||||||||| Sbjct: 28808 tctctctcacacacatgcatgcaca 28784
>emb|CR974470.7| L.saxatilis DNA sequence from clone CH317-148L22, complete sequence Length = 112797 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 134 ctctctcactcacatgcatgcacagacac 162 ||||||| |||||||||||||||| |||| Sbjct: 48282 ctctctctctcacatgcatgcacacacac 48310
>gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome 1, complete sequence Length = 179626 Score = 42.1 bits (21), Expect = 0.72 Identities = 30/33 (90%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcacagacac 162 |||||||||| |||||||||||||||| |||| Sbjct: 88427 ctctctctctttctcacatgcatgcacacacac 88459
>gb|AC117221.3| Mus musculus BAC clone RP23-347F2 from 1, complete sequence Length = 194077 Score = 42.1 bits (21), Expect = 0.72 Identities = 30/33 (90%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcacagacac 162 |||||||||| |||||||||||||||| |||| Sbjct: 190912 ctctctctctttctcacatgcatgcacacacac 190944
>emb|AL355602.11| Human DNA sequence from clone RP5-1166F10 on chromosome 1 Contains the 3' end of a novel gene (FLJ36179), complete sequence Length = 99163 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 139 tcactcacatgcatgcacagacact 163 |||||||||| |||||||||||||| Sbjct: 79173 tcactcacatacatgcacagacact 79197
>gb|AC153923.4| Mus musculus 6 BAC RP23-82I13 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 248275 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 123 tggtggcctctctctctcactcaca 147 |||||| |||||||||||||||||| Sbjct: 242521 tggtggtctctctctctcactcaca 242545
>gb|AC068120.6| Homo sapiens BAC clone RP11-12E9 from 2, complete sequence Length = 104268 Score = 42.1 bits (21), Expect = 0.72 Identities = 30/33 (90%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcacagacac 162 |||||| ||| ||||||||||||||||| |||| Sbjct: 39921 ctctctttcttactcacatgcatgcacacacac 39953
>gb|U57045.1|CAU57045 Cebus apella gamma globin (gamma2) gene, complete cds Length = 3609 Score = 42.1 bits (21), Expect = 0.72 Identities = 30/33 (90%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatgcacagacac 162 ||||||||| ||| |||||||||||||| |||| Sbjct: 2487 ctctctctcacacacacatgcatgcacacacac 2455
>emb|AL935192.10| Zebrafish DNA sequence from clone CH211-252B2, complete sequence Length = 192649 Score = 42.1 bits (21), Expect = 0.72 Identities = 30/33 (90%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcacagacac 162 |||||||||||||||||| |||||||| |||| Sbjct: 25752 ctctctctctcactcacaaacatgcacacacac 25784
>emb|AL591544.30| Mouse DNA sequence from clone RP23-386D6 on chromosome 11, complete sequence Length = 201673 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 143 tcacatgcatgcacagacact 163 ||||||||||||||||||||| Sbjct: 42516 tcacatgcatgcacagacact 42536 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||||||| ||||||||| |||| Sbjct: 177474 ctctctctctcacacacatgcatacaca 177501
>emb|AL591892.4| Mouse DNA sequence from clone RP23-422F22 on chromosome 15, complete sequence Length = 113798 Score = 42.1 bits (21), Expect = 0.72 Identities = 30/33 (90%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatgcacagacac 162 ||||||||||||| |||| ||||||||| |||| Sbjct: 65102 ctctctctctcacgcacacgcatgcacacacac 65070
>gb|U14635.1| Caenorhabditis elegans cosmid C27H5, complete sequence Length = 35840 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatg 149 |||||||||||||||||||| Sbjct: 417 ctctctctctcactcacatg 436
>gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, complete sequence Length = 177277 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 cacatgcatgcacagacactgaac 167 |||||||||||||| ||||||||| Sbjct: 133853 cacatgcatgcacacacactgaac 133830
>gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, complete sequence Length = 220242 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 140 cactcacatgcatgcacagacact 163 |||||||||||||||||| ||||| Sbjct: 80533 cactcacatgcatgcacacacact 80510
>gb|AC148980.6| Mus musculus BAC clone RP23-230C16 from chromosome 7, complete sequence Length = 192433 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ctcactcacatgcatgcaca 157 |||||||||||||||||||| Sbjct: 116770 ctcactcacatgcatgcaca 116751
>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence Length = 245390 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 cacatgcatgcacagacactgaac 167 |||||||||||||| ||||||||| Sbjct: 46326 cacatgcatgcacacacactgaac 46303
>gb|AC117118.4| Rattus norvegicus 1 BAC CH230-161O8 (Children's Hospital Oakland Research Institute) complete sequence Length = 216036 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatg 153 ||||||||||| |||||||||||| Sbjct: 72795 ctctctctctctctcacatgcatg 72818
>emb|AJ865188.1| Cocos nucifera microsatellite DNA, clone CnCir 86 Length = 205 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||||||| ||||||||||||| Sbjct: 70 ctctctctctcacagacatgcatgcaca 43
>gb|AC132474.3| Mus musculus BAC clone RP23-114G13 from chromosome 9, complete sequence Length = 220976 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 tctctctcactcacatgcatgcac 156 |||||||| ||||||||||||||| Sbjct: 28813 tctctctctctcacatgcatgcac 28836
>gb|AC124502.4| Mus musculus BAC clone RP23-414G6 from chromosome 19, complete sequence Length = 219212 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ctcactcacatgcatgcaca 157 |||||||||||||||||||| Sbjct: 125201 ctcactcacatgcatgcaca 125182
>gb|AC011352.6| Homo sapiens chromosome 5 clone CTC-327F10, complete sequence Length = 166644 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 cacatgcatgcacagacactgaac 167 |||||||||||||| ||||||||| Sbjct: 86180 cacatgcatgcacacacactgaac 86203
>gb|AC155171.7| Mus musculus BAC clone RP23-100A10 from chromosome 7, complete sequence Length = 193027 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ctcactcacatgcatgcaca 157 |||||||||||||||||||| Sbjct: 182495 ctcactcacatgcatgcaca 182514
>gb|AC139045.7| Mus musculus chromosome 7, clone RP23-466H15, complete sequence Length = 186309 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 134 ctctctcactcacatgcatgcaca 157 ||||||||| |||||||||||||| Sbjct: 11443 ctctctcacacacatgcatgcaca 11466
>emb|AL590395.4| Human DNA sequence from clone RP11-390H11 on chromosome 6, complete sequence Length = 154747 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 tctctctcactcacatgcatgcac 156 |||||||| ||||||||||||||| Sbjct: 151524 tctctctccctcacatgcatgcac 151547
>emb|AL512424.14| Human DNA sequence from clone RP11-453E2 on chromosome 10 Contains the 5' end of the SLIT1 gene for slit homolog 1 (Drosophila), a novel gene and a CpG island, complete sequence Length = 172510 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 tggaggagcagtactgccaa 205 |||||||||||||||||||| Sbjct: 39310 tggaggagcagtactgccaa 39329
>emb|AL163542.8| Human DNA sequence from clone RP11-360I23 on chromosome 13 Contains part of the DACH gene for dachshund homolog (Drosophila) (DACH1 FLJ10138), complete sequence Length = 177037 Score = 40.1 bits (20), Expect = 2.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 131 tctctctctcactcacatgcatgcacagacac 162 |||||||||||| |||| ||||||||||||| Sbjct: 92144 tctctctctcacacacacacatgcacagacac 92175
>emb|AL096708.34|HS1179L24 Human DNA sequence from clone RP5-1179L24 on chromosome 6q24.3-25.3 Contains the PPP1R14C gene for protein phosphatase 1 regulatory (inhibitor) subunit 14C (KEPI NY-BR-81 CPI17-like), complete sequence Length = 107104 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ctcactcacatgcatgcaca 157 |||||||||||||||||||| Sbjct: 32888 ctcactcacatgcatgcaca 32869
>emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 on chromosome 6q24 Contains the 3' end of a variant of the EPM2A gene for progressive myoclonus type 2 epilepsy (Lafora disease) protein (laforin) and a BTB/POZ domain zinc finger protein pseudogene, complete sequence Length = 115835 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 tgcatgcacagacactgaac 167 |||||||||||||||||||| Sbjct: 106284 tgcatgcacagacactgaac 106265
>emb|BX465220.18| Zebrafish DNA sequence from clone CH211-226O13 in linkage group 21, complete sequence Length = 209782 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 129 cctctctctctcactcacat 148 |||||||||||||||||||| Sbjct: 204706 cctctctctctcactcacat 204687
>emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 in linkage group 1, complete sequence Length = 161017 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatg 149 |||||||||||||||||||| Sbjct: 113233 ctctctctctcactcacatg 113214
>emb|BX664605.15| Zebrafish DNA sequence from clone DKEYP-53E4 in linkage group 21, complete sequence Length = 170126 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 129 cctctctctctcactcacat 148 |||||||||||||||||||| Sbjct: 159073 cctctctctctcactcacat 159092
>emb|BX296567.23| Zebrafish DNA sequence from clone DKEY-261P22 in linkage group 15, complete sequence Length = 224041 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 129 cctctctctctcactcacat 148 |||||||||||||||||||| Sbjct: 119128 cctctctctctcactcacat 119109
>gb|AC122707.2| Homo sapiens chromosome 5 clone RP11-158J3, complete sequence Length = 180483 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 agtaataactgaatagtgaa 110 |||||||||||||||||||| Sbjct: 128205 agtaataactgaatagtgaa 128186
>emb|BX649516.8| Zebrafish DNA sequence from clone DKEY-51D8 in linkage group 14, complete sequence Length = 209974 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 129 cctctctctctcactcacat 148 |||||||||||||||||||| Sbjct: 204899 cctctctctctcactcacat 204918
>emb|BX649556.9| Zebrafish DNA sequence from clone DKEY-29M1 in linkage group 11, complete sequence Length = 197002 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 129 cctctctctctcactcacat 148 |||||||||||||||||||| Sbjct: 30478 cctctctctctcactcacat 30497
>gb|AF407166.1| Homo sapiens PKC-potentiated PP1 inhibitory protein (KEPI) gene, complete cds Length = 168856 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ctcactcacatgcatgcaca 157 |||||||||||||||||||| Sbjct: 94640 ctcactcacatgcatgcaca 94621
>gb|AC022163.5| Homo sapiens chromosome 5 clone RP11-454F19, complete sequence Length = 165675 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 agtaataactgaatagtgaa 110 |||||||||||||||||||| Sbjct: 2693 agtaataactgaatagtgaa 2674
>gb|AC127352.5| Mus musculus BAC clone RP23-81P4 from chromosome 7, complete sequence Length = 196031 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ctcactcacatgcatgcaca 157 |||||||||||||||||||| Sbjct: 142442 ctcactcacatgcatgcaca 142461
>gb|AC008965.6| Homo sapiens chromosome 5 clone CTD-2364L17, complete sequence Length = 139939 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 agtaataactgaatagtgaa 110 |||||||||||||||||||| Sbjct: 67266 agtaataactgaatagtgaa 67285
>gb|AC068294.26|AC068294 Mus musculus 3 BAC RP23-418O21 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 201750 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||| ||| |||||||||||||| Sbjct: 173609 ctctctctcacacacacatgcatgcaca 173636
>gb|AC012368.6| Homo sapiens BAC clone RP11-547M24 from 2, complete sequence Length = 196206 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 cacatgcatgcacagacact 163 |||||||||||||||||||| Sbjct: 179733 cacatgcatgcacagacact 179714
>gb|AC102022.8| Mus musculus chromosome 8, clone RP24-67K5, complete sequence Length = 156728 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 131 tctctctctcactcacatgc 150 |||||||||||||||||||| Sbjct: 100681 tctctctctcactcacatgc 100700
>gb|AC124476.5| Mus musculus BAC clone RP24-93F9 from chromosome 10, complete sequence Length = 169031 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 tctctctcactcacatgcatgcac 156 |||||||||| ||||||||||||| Sbjct: 53778 tctctctcacacacatgcatgcac 53801
>emb|AL773536.21| Mouse DNA sequence from clone RP23-186J20 on chromosome 2, complete sequence Length = 161244 Score = 40.1 bits (20), Expect = 2.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 131 tctctctctcactcacatgcatgcacagacac 162 |||||||||| |||| ||||||||||| |||| Sbjct: 13418 tctctctctctctcaaatgcatgcacacacac 13387
>emb|BX897748.11| Zebrafish DNA sequence from clone CH211-152M4 in linkage group 4, complete sequence Length = 64422 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 140 cactcacatgcatgcacagacact 163 |||||||||||||||||| ||||| Sbjct: 53392 cactcacatgcatgcacatacact 53369
>emb|BX664610.10| Zebrafish DNA sequence from clone DKEY-11N6 in linkage group 22, complete sequence Length = 206964 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 121 catggtggcctctctctctcactc 144 |||||||| ||||||||||||||| Sbjct: 145933 catggtggactctctctctcactc 145910
>emb|BX663521.10| Zebrafish DNA sequence from clone DKEYP-50F5 in linkage group 14, complete sequence Length = 179663 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 11 cggttttacaggttcaatcc 30 |||||||||||||||||||| Sbjct: 113082 cggttttacaggttcaatcc 113101
>gb|AC120378.7| Mus musculus chromosome 7, clone RP24-263N3, complete sequence Length = 143396 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 134 ctctctcactcacatgcatgcaca 157 ||||||||| |||||||||||||| Sbjct: 38182 ctctctcacacacatgcatgcaca 38205
>emb|CT573040.5| Wallaby DNA sequence from clone MEKBa-454A14, complete sequence Length = 164317 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatg 153 ||||||||||||| |||||||||| Sbjct: 66451 ctctctctctcacacacatgcatg 66428
>gb|AC164107.3| Mus musculus BAC clone RP23-461D6 from chromosome 14, complete sequence Length = 181095 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 cactcacatgcatgcacaga 159 |||||||||||||||||||| Sbjct: 125435 cactcacatgcatgcacaga 125416
>gb|AC140393.3| Mus musculus BAC clone RP24-179D17 from 14, complete sequence Length = 184279 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 140 cactcacatgcatgcacagacact 163 |||||||||||||||||| ||||| Sbjct: 101679 cactcacatgcatgcacacacact 101656
>emb|CR387992.11| Zebrafish DNA sequence from clone DKEY-234K24 in linkage group 1, complete sequence Length = 76732 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatg 149 |||||||||||||||||||| Sbjct: 62251 ctctctctctcactcacatg 62270
>emb|AL732614.15| Mouse DNA sequence from clone RP23-322G17 on chromosome 4, complete sequence Length = 218910 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ctcactcacatgcatgcaca 157 |||||||||||||||||||| Sbjct: 112895 ctcactcacatgcatgcaca 112914
>emb|CT025573.9| Mouse DNA sequence from clone RP24-274P18 on chromosome 17, complete sequence Length = 210893 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 121 catggtggcctctctctctc 140 |||||||||||||||||||| Sbjct: 120658 catggtggcctctctctctc 120677
>gb|U80954.1| Caenorhabditis elegans cosmid T07F8, complete sequence Length = 23862 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatg 149 |||||||||||||||||||| Sbjct: 23779 ctctctctctcactcacatg 23798
>emb|AL844896.7| Mouse DNA sequence from clone RP23-356L21 on chromosome 2, complete sequence Length = 83203 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||||| ||| |||||||||||| Sbjct: 55666 ctctctctctctctctcatgcatgcaca 55639
>emb|AL683809.7| Mouse DNA sequence from clone RP23-440B21 on chromosome X, complete sequence Length = 213187 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||||| || ||||||||||||| Sbjct: 161684 ctctctctctctctgacatgcatgcaca 161711
>emb|AL807778.10| Mouse DNA sequence from clone RP23-198G1 on chromosome 2, complete sequence Length = 203518 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatg 153 ||||||||||| |||||||||||| Sbjct: 136632 ctctctctctctctcacatgcatg 136609
>emb|AL806523.14| Mouse DNA sequence from clone RP23-423O7 on chromosome 4, complete sequence Length = 217762 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||||| ||||||||||| |||| Sbjct: 141497 ctctctctctctctcacatgcatacaca 141524
>emb|AL669926.6| Mouse DNA sequence from clone RP23-74K21 on chromosome 2, complete sequence Length = 226854 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 140 cactcacatgcatgcacagacact 163 |||||||||||||||||| ||||| Sbjct: 145489 cactcacatgcatgcacacacact 145466
>emb|AL731789.9| Mouse DNA sequence from clone RP23-52F6 on chromosome X, complete sequence Length = 218939 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||||| ||| |||||||||||| Sbjct: 216397 ctctctctctctctctcatgcatgcaca 216424
>emb|AL732419.6| Mouse DNA sequence from clone RP23-228A20 on chromosome X, complete sequence Length = 194380 Score = 40.1 bits (20), Expect = 2.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 130 ctctctctctcactcacatgcatgcaca 157 ||||||||||| ||||||| |||||||| Sbjct: 141859 ctctctctctctctcacatacatgcaca 141832
>gb|AC166160.3| Mus musculus BAC clone RP24-86O19 from chromosome 7, complete sequence Length = 221792 Score = 40.1 bits (20), Expect = 2.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 134 ctctctcactcacatgcatgcaca 157 ||||||||| |||||||||||||| Sbjct: 32894 ctctctcacacacatgcatgcaca 32871 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,105,569 Number of Sequences: 3902068 Number of extensions: 6105569 Number of successful extensions: 268980 Number of sequences better than 10.0: 74 Number of HSP's better than 10.0 without gapping: 74 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 268515 Number of HSP's gapped (non-prelim): 449 length of query: 224 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 202 effective length of database: 17,147,199,772 effective search space: 3463734353944 effective search space used: 3463734353944 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
