ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet56e12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY177404.1| Secale cereale O-methyltransferase mRNA, complete... 111 1e-21
2gb|AC026689.6| Homo sapiens chromosome 5 clone CTB-55A14, comple... 46 0.055
3gb|AC159166.4| Atelerix albiventris clone LB4-482N5, complete se... 42 0.86
4gb|AC153121.15| Medicago truncatula clone mth2-80o14, complete s... 42 0.86
5gb|AC152351.7| Medicago truncatula clone mth2-75b20, complete se... 42 0.86
6gb|AC004037.1| Homo sapiens chromosome 5, BAC clone 64o24, BAC 5... 40 3.4
7gb|AC124818.7| Mus musculus chromosome 14, clone RP24-505E8, com... 40 3.4
8emb|CR513781.13| Zebrafish DNA sequence from clone CH211-61A15 i... 40 3.4
9gb|AC158982.2| Mus musculus BAC clone RP23-235N21 from chromosom... 40 3.4
10emb|AL008634.1|HS396D17 Human DNA sequence from clone RP3-396D17... 40 3.4
11gb|AC041039.8| Homo sapiens chromosome 8, clone RP11-273P3, comp... 40 3.4
12emb|AL928834.15| Zebrafish DNA sequence from clone CH211-51E12 i... 40 3.4
13gb|AC129713.1| Homo sapiens chromosome 5 clone RP11-391B2, compl... 40 3.4
14gb|AC022721.9| Homo sapiens, clone RP11-191H13, complete sequence 40 3.4
15gb|AC084197.1| Caenorhabditis elegans cosmid Y73B6BL, complete s... 40 3.4
16gb|AC090466.5| Homo sapiens chromosome 8, clone RP11-619O19, com... 40 3.4
17gb|AC079907.25| Homo sapiens 12q BAC RP11-554E23 (Roswell Park C... 40 3.4
18gb|AC008528.6|AC008528 Homo sapiens chromosome 5 clone CTC-473M1... 40 3.4
19emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 40 3.4
20emb|BX890562.8| Zebrafish DNA sequence from clone CH211-222H17 i... 40 3.4
21gb|AC125380.4| Mus musculus BAC clone RP23-204N23 from 1, comple... 40 3.4
22emb|AL591373.8| Mouse DNA sequence from clone RP23-268M6 on chro... 40 3.4
23gb|AC090534.10| Mus musculus Strain C57BL6/J chromosome 18 BAC, ... 40 3.4

>gb|AY177404.1| Secale cereale O-methyltransferase mRNA, complete cds
          Length = 1373

 Score =  111 bits (56), Expect = 1e-21
 Identities = 71/76 (93%)
 Strand = Plus / Minus

                                                                        
Query: 183  acttttaagaaaccgttcacttgtagacctcgataacacctcgtgcacccagtcttttga 242
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||
Sbjct: 1155 acttttatgaaaccgttcacttgtagacctcgataacacctcgtgcacccagtttcttga 1096

                            
Query: 243  caattttataatcgct 258
            ||||||| || |||||
Sbjct: 1095 caattttgtagtcgct 1080



 Score =  105 bits (53), Expect = 7e-20
 Identities = 122/142 (85%), Gaps = 4/142 (2%)
 Strand = Plus / Minus

                                                                        
Query: 8    aaaaggaaatatgatacaaagatgacagaaattacaagcttgtcacgtaggctgctacat 67
            ||||||||| |||| |||||||||| |||||||||||||||||||| ||||||| |||||
Sbjct: 1324 aaaaggaaaaatga-acaaagatga-agaaattacaagcttgtcac-taggctgttacat 1268

                                                                        
Query: 68   gataatatccttgcaaacctaaggcagtccattta-nnnnnnncatcaaagcagaccatc 126
            |||||||||||||||||| || |||||| | ||||        || ||||||| ||||||
Sbjct: 1267 gataatatccttgcaaacatagggcagtgcctttatttttcttcagcaaagcaaaccatc 1208

                                  
Query: 127  catacataaacaaagcacactg 148
            |||||||||| |||||||||||
Sbjct: 1207 catacataaataaagcacactg 1186



to top

>gb|AC026689.6| Homo sapiens chromosome 5 clone CTB-55A14, complete sequence
          Length = 215150

 Score = 46.1 bits (23), Expect = 0.055
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 132   ataaacaaagcacactgcatgct 154
             |||||||||||||||||||||||
Sbjct: 25688 ataaacaaagcacactgcatgct 25710



to top

>gb|AC159166.4| Atelerix albiventris clone LB4-482N5, complete sequence
          Length = 61580

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 14    aaatatgatacaaagatgaca 34
             |||||||||||||||||||||
Sbjct: 33950 aaatatgatacaaagatgaca 33970



to top

>gb|AC153121.15| Medicago truncatula clone mth2-80o14, complete sequence
          Length = 115074

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 10   aaggaaatatgatacaaagatgacagaaa 38
            |||||||||||||  ||||||||||||||
Sbjct: 1179 aaggaaatatgatctaaagatgacagaaa 1151



to top

>gb|AC152351.7| Medicago truncatula clone mth2-75b20, complete sequence
          Length = 111786

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 10    aaggaaatatgatacaaagatgacagaaa 38
             |||||||||||||  ||||||||||||||
Sbjct: 46750 aaggaaatatgatctaaagatgacagaaa 46778



to top

>gb|AC004037.1| Homo sapiens chromosome 5, BAC clone 64o24, BAC 5001 (LBNL H101),
           complete sequence
          Length = 32424

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 8   aaaaggaaatatgatacaaa 27
           ||||||||||||||||||||
Sbjct: 546 aaaaggaaatatgatacaaa 527



to top

>gb|AC124818.7| Mus musculus chromosome 14, clone RP24-505E8, complete sequence
          Length = 159170

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     gaaaaggaaatatgatacaa 26
             ||||||||||||||||||||
Sbjct: 49685 gaaaaggaaatatgatacaa 49666



to top

>emb|CR513781.13| Zebrafish DNA sequence from clone CH211-61A15 in linkage group 15,
              complete sequence
          Length = 158040

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     aaagatgacagaaattacaa 44
              ||||||||||||||||||||
Sbjct: 107644 aaagatgacagaaattacaa 107625



to top

>gb|AC158982.2| Mus musculus BAC clone RP23-235N21 from chromosome 14, complete sequence
          Length = 208135

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      gaaaaggaaatatgatacaa 26
              ||||||||||||||||||||
Sbjct: 207324 gaaaaggaaatatgatacaa 207305



to top

>emb|AL008634.1|HS396D17 Human DNA sequence from clone RP3-396D17 on chromosome 1p33-35.3
             Contains EST, STS, GSS, complete sequence
          Length = 152592

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     gaggggaaaaggaaatatga 21
             ||||||||||||||||||||
Sbjct: 76587 gaggggaaaaggaaatatga 76606



to top

>gb|AC041039.8| Homo sapiens chromosome 8, clone RP11-273P3, complete sequence
          Length = 159332

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 24    caaagatgacagaaattacaagct 47
             |||||||||||||||| |||||||
Sbjct: 19726 caaagatgacagaaatgacaagct 19749



to top

>emb|AL928834.15| Zebrafish DNA sequence from clone CH211-51E12 in linkage group 4 Contains
              the gene for a novel protein (zgc:56546), the gene for a
              novel protein similar to the Tctex-1 family, the gene for a
              novel protein similar to vertebrate tubby like protein 4
              (TULP4), the gene for a novel protein similar to vertebrate
              mitochondrial ribosomal protein S10 (MRPS10), the 3' end of
              a novel gene, two novel genes and three CpG islands,
              complete sequence
          Length = 189764

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 235    tcttttgacaattttataat 254
              ||||||||||||||||||||
Sbjct: 124745 tcttttgacaattttataat 124726



to top

>gb|AC129713.1| Homo sapiens chromosome 5 clone RP11-391B2, complete sequence
          Length = 65846

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 8   aaaaggaaatatgatacaaa 27
           ||||||||||||||||||||
Sbjct: 339 aaaaggaaatatgatacaaa 320



to top

>gb|AC022721.9| Homo sapiens, clone RP11-191H13, complete sequence
          Length = 164354

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 24    caaagatgacagaaattacaagct 47
             |||||||||||||||| |||||||
Sbjct: 19977 caaagatgacagaaatgacaagct 19954



to top

>gb|AC084197.1| Caenorhabditis elegans cosmid Y73B6BL, complete sequence
          Length = 216143

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   cttttgacaattttataatc 255
             ||||||||||||||||||||
Sbjct: 48038 cttttgacaattttataatc 48057



to top

>gb|AC090466.5| Homo sapiens chromosome 8, clone RP11-619O19, complete sequence
          Length = 191049

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 24     caaagatgacagaaattacaagct 47
              |||||||||||||||| |||||||
Sbjct: 183486 caaagatgacagaaatgacaagct 183463



to top

>gb|AC079907.25| Homo sapiens 12q BAC RP11-554E23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 184840

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     gaggggaaaaggaaatatga 21
             ||||||||||||||||||||
Sbjct: 30685 gaggggaaaaggaaatatga 30704



to top

>gb|AC008528.6|AC008528 Homo sapiens chromosome 5 clone CTC-473M13, complete sequence
          Length = 125764

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     aaaaggaaatatgatacaaa 27
             ||||||||||||||||||||
Sbjct: 11658 aaaaggaaatatgatacaaa 11677



to top

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 9      aaaggaaatatgatacaaagatga 32
              ||||||| ||||||||||||||||
Sbjct: 875301 aaaggaagtatgatacaaagatga 875278



to top

>emb|BX890562.8| Zebrafish DNA sequence from clone CH211-222H17 in linkage group 4,
             complete sequence
          Length = 195554

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 235   tcttttgacaattttataat 254
             ||||||||||||||||||||
Sbjct: 72864 tcttttgacaattttataat 72883



to top

>gb|AC125380.4| Mus musculus BAC clone RP23-204N23 from 1, complete sequence
          Length = 214005

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 129   tacataaacaaagcacactg 148
             ||||||||||||||||||||
Sbjct: 31022 tacataaacaaagcacactg 31003



to top

>emb|AL591373.8| Mouse DNA sequence from clone RP23-268M6 on chromosome 18, complete
             sequence
          Length = 174264

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 230   cccagtcttttgacaattttataa 253
             ||||||||| ||||||||||||||
Sbjct: 33435 cccagtcttctgacaattttataa 33458



to top

>gb|AC090534.10| Mus musculus Strain C57BL6/J chromosome 18 BAC, RP23-233F17, complete
              sequence
          Length = 176773

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 230    cccagtcttttgacaattttataa 253
              ||||||||| ||||||||||||||
Sbjct: 156054 cccagtcttctgacaattttataa 156077


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,348,549
Number of Sequences: 3902068
Number of extensions: 2348549
Number of successful extensions: 51737
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51704
Number of HSP's gapped (non-prelim): 32
length of query: 261
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 239
effective length of database: 17,147,199,772
effective search space: 4098180745508
effective search space used: 4098180745508
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top