>emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on chromosome 11 Contains a
              Friedreich ataxia protein (Frda) pseudogene, complete
              sequence
          Length = 203970

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 45     cctcagctgcaaatgttacatt 66
              ||||||||||||||||||||||
Sbjct: 122286 cctcagctgcaaatgttacatt 122307

>gb|AC145590.3| Mus musculus BAC clone RP24-175D4 from chromosome 19, complete sequence
          Length = 179063

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     ttgtttaattttatttgatc 20
             ||||||||||||||||||||
Sbjct: 92615 ttgtttaattttatttgatc 92634

>gb|AC133904.9| Mus musculus chromosome 19, clone RP24-143J12, complete sequence
          Length = 163882

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      ttgtttaattttatttgatc 20
              ||||||||||||||||||||
Sbjct: 136596 ttgtttaattttatttgatc 136577

>emb|AL355350.8| Human DNA sequence from clone RP11-483B5 on chromosome 10 Contains two
             novel genes, the 5'end of the gene for VPS10 domain
             receptor protein SORCS 3 (SORCS3) and a CpG island,
             complete sequence
          Length = 153764

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     ttgtttaattttatttgatc 20
             ||||||||||||||||||||
Sbjct: 35866 ttgtttaattttatttgatc 35885

>emb|AL161646.10| Human DNA sequence from clone RP11-127O4 on chromosome 10 Contains two
              novel genes, the 5'end of the gene for VPS10 domain
              receptor protein SORCS 3 (SORCS3) and one CpG island,
              complete sequence
          Length = 183833

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      ttgtttaattttatttgatc 20
              ||||||||||||||||||||
Sbjct: 122009 ttgtttaattttatttgatc 122028

>gb|AC154041.1| Drosophila melanogaster clone BACR43N11, complete sequence
          Length = 157286

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    cagctgcaaatgttacatt 66
             |||||||||||||||||||
Sbjct: 41401 cagctgcaaatgttacatt 41419

>gb|AC101713.7| Mus musculus chromosome 15, clone RP23-282L9, complete sequence
          Length = 189145

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 83    ttcaatcagcatacaaagg 101
             |||||||||||||||||||
Sbjct: 10688 ttcaatcagcatacaaagg 10670

>gb|AC158129.5| Mus musculus chromosome 15, clone RP24-359B13, complete sequence
          Length = 167206

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    ttcaatcagcatacaaagg 101
             |||||||||||||||||||
Sbjct: 56431 ttcaatcagcatacaaagg 56449

>ref|XM_646605.1| Entamoeba histolytica HM-1:IMSS conserved hypothetical protein
           (151.t00001) partial mRNA
          Length = 747

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 5   ttaattttatttgatcccc 23
           |||||||||||||||||||
Sbjct: 739 ttaattttatttgatcccc 721

>tpg|BK001934.1| TPA: TPA_inf: Drosophila melanogaster HDC08434 (HDC08434) gene,
           complete cds
          Length = 886

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 48  cagctgcaaatgttacatt 66
           |||||||||||||||||||
Sbjct: 444 cagctgcaaatgttacatt 462

>gb|AE003481.3| Drosophila melanogaster chromosome 3L, section 15 of 83 of the complete
             sequence
          Length = 315988

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    cagctgcaaatgttacatt 66
             |||||||||||||||||||
Sbjct: 89356 cagctgcaaatgttacatt 89374

>gb|U31901.1|CCU31901 Cucumaria curata cytochrome oxidase 1 (CO1) gene, mitochondrial
           gene encoding mitochondrial protein, partial cds
          Length = 1323

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 1   ttgtttaattttatttgat 19
           |||||||||||||||||||
Sbjct: 142 ttgtttaattttatttgat 124

>gb|U32214.1|CLU32214 Cucumaria lubrica subtidal specimen cytochrome oxidase 1 (CO1)
           gene, partial cds, and large subunit rRNA gene, partial
           sequence, mitochondrial genes encoding mitochondrial
           products
          Length = 1323

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 1   ttgtttaattttatttgat 19
           |||||||||||||||||||
Sbjct: 142 ttgtttaattttatttgat 124


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,198,812
Number of Sequences: 3902068
Number of extensions: 1198812
Number of successful extensions: 112082
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112046
Number of HSP's gapped (non-prelim): 36
length of query: 109
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 88
effective length of database: 17,151,101,840
effective search space: 1509296961920
effective search space used: 1509296961920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)