>gb|AY333434.1| Salmonella typhimurium plasmid pU302L, complete sequence
          Length = 84514

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    acatctattttattccggaaa 30
             |||||||||||||||||||||
Sbjct: 39260 acatctattttattccggaaa 39240

>gb|AC113323.12| Mus musculus chromosome 15, clone RP23-451O9, complete sequence
          Length = 175138

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    cacagacagtgtgatacagtg 88
             |||||||||||||||||||||
Sbjct: 20685 cacagacagtgtgatacagtg 20705

>emb|AJ851089.1| Uncultured bacterium pRSB107 plasmid
          Length = 120592

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 10     acatctattttattccggaaa 30
              |||||||||||||||||||||
Sbjct: 108928 acatctattttattccggaaa 108908

>gb|DQ381420.1| Escherichia coli plasmid pAPEC-O1-ColBM, complete sequence
          Length = 174241

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    acatctattttattccggaaa 30
             |||||||||||||||||||||
Sbjct: 66374 acatctattttattccggaaa 66354

>gb|AY545598.5| Escherichia coli plasmid pAPEC-O2-ColV, complete sequence
          Length = 184501

 Score = 42.1 bits (21), Expect = 0.46
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    acatctattttattccggaaa 30
             |||||||||||||||||||||
Sbjct: 47816 acatctattttattccggaaa 47796

>emb|CR735143.13| Zebrafish DNA sequence from clone CH211-244P16 in linkage group 5,
            complete sequence
          Length = 147626

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 3    cgaatccacatctatttta 21
            |||||||||||||||||||
Sbjct: 1083 cgaatccacatctatttta 1065

>emb|AL356865.19| Human DNA sequence from clone RP11-36N22 on chromosome 10 Contains a
             pseudogene similar to part of solute carrier family 25,
             (mitochondrial carrier), member 18 (SLC25A18), the GPR10
             gene for G protein-coupled receptor 10 (GR3, PrRPR), a
             translocase of outer mitochondrial membrane 22 homolog
             (yeast) (TOM22) (TOMM22) pseudogene and one CpG island,
             complete sequence
          Length = 156604

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    aatggccgccatcaaacat 47
             |||||||||||||||||||
Sbjct: 97001 aatggccgccatcaaacat 97019

>emb|X53253.1|ECGENES E.chrysanthemi genes inh, prtD, prtE and prtF
          Length = 5435

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 24   ccggaaatggccgccatca 42
            |||||||||||||||||||
Sbjct: 2896 ccggaaatggccgccatca 2914

>emb|BX927098.24| Zebrafish DNA sequence from clone DKEY-228D14 in linkage group 13,
             complete sequence
          Length = 229413

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 89    cagcatgtagggtgggaaa 107
             |||||||||||||||||||
Sbjct: 80231 cagcatgtagggtgggaaa 80213

>gb|AC040977.10| Homo sapiens chromosome 17, clone RP11-589P10, complete sequence
          Length = 174741

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   aatggccgccatcaaacat 47
            |||||||||||||||||||
Sbjct: 3801 aatggccgccatcaaacat 3819

>gb|AC027763.9| Homo sapiens chromosome 17, clone RP11-530N7, complete sequence
          Length = 169770

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     aatggccgccatcaaacat 47
              |||||||||||||||||||
Sbjct: 100158 aatggccgccatcaaacat 100140

>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
               sequence
          Length = 4332241

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 3       cgaatccacatctatttta 21
               |||||||||||||||||||
Sbjct: 1062188 cgaatccacatctatttta 1062170

>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 3       cgaatccacatctatttta 21
               |||||||||||||||||||
Sbjct: 3161907 cgaatccacatctatttta 3161925

>emb|CR933780.12| Zebrafish DNA sequence from clone DKEY-60F6 in linkage group 5, complete
              sequence
          Length = 227454

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 3      cgaatccacatctatttta 21
              |||||||||||||||||||
Sbjct: 151640 cgaatccacatctatttta 151658

>gb|M60395.1|ERWPRTBCDE Erwinia chrysanthemi prt locus encoding inhibitor (inh) and protease
            (prtB, prtC) and prtD, prtE, and prtF genes, complete cds
          Length = 8524

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 24   ccggaaatggccgccatca 42
            |||||||||||||||||||
Sbjct: 2896 ccggaaatggccgccatca 2914


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,001,935
Number of Sequences: 3902068
Number of extensions: 1001935
Number of successful extensions: 61216
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61115
Number of HSP's gapped (non-prelim): 101
length of query: 148
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 127
effective length of database: 17,151,101,840
effective search space: 2178189933680
effective search space used: 2178189933680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)