ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet56b07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ532549.1|LTE532549 Lolium temulentum mRNA for putative sol... 52 7e-04
2gb|AC175059.2| Pan troglodytes BAC clone CH251-777D16 from chrom... 48 0.010
3emb|AL133420.28| Human DNA sequence from clone RP5-904D7 on chro... 46 0.041
4emb|BX322655.10| Zebrafish DNA sequence from clone DKEYP-53E12 i... 46 0.041
5gb|AC146108.3| Pan troglodytes BAC clone RP43-22F10 from 7, comp... 44 0.16
6gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, comple... 44 0.16
7ref|XM_960923.1| Plasmodium falciparum 3D7 hypothetical protein ... 44 0.16
8emb|AL360272.23| Human DNA sequence from clone RP11-169I2 on chr... 44 0.16
9emb|CR382398.1| Plasmodium falciparum chromosome 6, complete seq... 44 0.16
10gb|AC068991.28| Homo sapiens 12 BAC RP11-300D9 (Roswell Park Can... 44 0.16
11gb|AC091639.5| Homo sapiens chromosome 8, clone RP11-61K18, comp... 44 0.16
12gb|AC025828.3|AC025828 Homo sapiens, clone RP11-13I24, complete ... 44 0.16
13emb|BX664611.6| Mouse DNA sequence from clone RP24-201C13 on chr... 44 0.16
14gb|AC007065.5|AC007065 Homo sapiens, clone hRPK.58_A_1, complete... 44 0.16
15dbj|AP005361.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 44 0.16
16gb|AC101748.7| Mus musculus chromosome 5, clone RP24-133H21, com... 42 0.64
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 0.64
18gb|AC124424.4| Mus musculus BAC clone RP24-230J3 from chromosome... 42 0.64
19gb|AC118674.3| Genomic sequence for Oryza sativa, Nipponbare str... 42 0.64
20gb|AC066593.4| Homo sapiens chromosome 3 clone RP11-344O5 map 3p... 42 0.64
21gb|AC096757.3| Homo sapiens BAC clone RP11-543H9 from 4, complet... 42 0.64
22gb|AC021105.13| Homo sapiens BAC clone RP11-163O17 from 4, compl... 42 0.64
23gb|AC158399.2| Mus musculus BAC clone RP23-246A2 from chromosome... 42 0.64
24dbj|AK030792.1| Mus musculus adult male thymus cDNA, RIKEN full-... 42 0.64
25dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.64
26emb|BX294653.11| Zebrafish DNA sequence from clone CH211-196H24 ... 42 0.64
27emb|AJ277858.1|MTR277858 Medicago truncatula nod25 gene for nodu... 42 0.64
28dbj|AB104414.1| Cucumis melo GeAAT-2 mRNA for alcohol acyltransf... 42 0.64
29gb|AC126020.4| Mus musculus BAC clone RP24-364O7 from 8, complet... 42 0.64
30gb|AC147720.1| Gallus gallus BAC clone CH261-46I14 from chromoso... 42 0.64
31gb|U39305.1|ECU39305 Escherichia coli polysaccharide chain lengt... 42 0.64
32gb|AC123689.8| Mus musculus chromosome 15, clone RP23-321P10, co... 42 0.64
33gb|AC157602.8| Mus musculus chromosome 15 clone RP23-104H10, com... 42 0.64
34emb|AL845290.7| Mouse DNA sequence from clone RP23-201A19 on chr... 42 0.64
35emb|AL840623.10| Mouse DNA sequence from clone RP23-289L17 on ch... 42 0.64
36emb|AL844163.7| Mouse DNA sequence from clone RP23-467L21 on chr... 42 0.64
37gb|AC109157.10| Mus musculus chromosome 7, clone RP24-169M16, co... 40 2.5
38gb|AC113600.19| Mus musculus chromosome 6, clone RP23-110A19, co... 40 2.5
39ref|NG_002690.1| Homo sapiens Prader-Willi/Angelman syndrome reg... 40 2.5
40gb|AC099621.12| Mus musculus chromosome 15, clone RP23-468J2, co... 40 2.5
41emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chro... 40 2.5
42gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome ... 40 2.5
43emb|Z70687.2|CET14C1 Caenorhabditis elegans Cosmid T14C1, comple... 40 2.5
44gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosom... 40 2.5
45gb|AC117598.7| Mus musculus chromosome 1, clone RP23-398H16, com... 40 2.5
46gb|AC146308.2| Medicago truncatula clone mth2-10a12, complete se... 40 2.5
47gb|AC137554.15| Medicago truncatula clone mth2-17j18, complete s... 40 2.5
48emb|BX936404.9| Zebrafish DNA sequence from clone CH211-237F6 in... 40 2.5
49emb|AL606759.8| Human DNA sequence from clone CTD-2319N17 on chr... 40 2.5
50emb|AL591202.8| Human DNA sequence from clone RP11-262B12 on chr... 40 2.5
51emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on ch... 40 2.5
52emb|AL365400.19| Human DNA sequence from clone RP11-471G13 on ch... 40 2.5
53emb|AL356739.11| Human DNA sequence from clone RP11-324P13 on ch... 40 2.5
54emb|AL137026.21| Human DNA sequence from clone RP11-20J15 on chr... 40 2.5
55emb|AL022148.1|HS435A7 Human DNA sequence from clone RP3-435A7 o... 40 2.5
56emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chrom... 40 2.5
57emb|CR933104.2| Medicago truncatula chromosome 5 clone mth2-25b3... 40 2.5
58gb|AC163900.3| Mus musculus BAC clone RP23-151K15 from chromosom... 40 2.5
59gb|AC073391.3| Oryza sativa (japonica cultivar-group) chromosome... 40 2.5
60gb|AC025028.21| Homo sapiens 3 BAC RP11-238M12 (Roswell Park Can... 40 2.5
61dbj|AB120741.1| Rhizophora stylosa DNA, microsatellite marker Rh... 40 2.5
62gb|AC008603.7| Homo sapiens chromosome 5 clone CTB-107P3, comple... 40 2.5
63gb|AC107383.3| Homo sapiens BAC clone RP11-125C20 from 4, comple... 40 2.5
64gb|AC093848.2| Homo sapiens BAC clone RP11-486G21 from 4, comple... 40 2.5
65gb|AC034154.6| Homo sapiens BAC clone RP11-242D9 from 4, complet... 40 2.5
66gb|AC172372.2| Pan troglodytes BAC clone CH251-1067L6 from chrom... 40 2.5
67gb|AC080172.5| Homo sapiens chromosome 11, clone CTC-790M5, comp... 40 2.5
68emb|BX649412.8| Zebrafish DNA sequence from clone DKEY-116G10 in... 40 2.5
69gb|AC012378.10| Homo sapiens chromosome 15 clone RP11-420M1 map ... 40 2.5
70emb|BX004804.10| Zebrafish DNA sequence from clone CH211-39M5 in... 40 2.5
71dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.5
72dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.5
73gb|AC008364.5|AC008364 Drosophila melanogaster, chromosome 3R, r... 40 2.5
74gb|AC092609.2| Homo sapiens BAC clone RP11-160A16 from 4, comple... 40 2.5
75gb|AC154582.2| Mus musculus BAC clone RP23-381N7 from chromosome... 40 2.5
76gb|AC023894.21| Homo sapiens 3 BAC RP11-261D23 (Roswell Park Can... 40 2.5
77gb|AC026348.23| Homo sapiens 3 BAC RP11-553D4 (Roswell Park Canc... 40 2.5
78gb|AC172373.3| Pan troglodytes BAC clone CH251-1081D19 from chro... 40 2.5
79gb|AC090983.13| Homo sapiens chromosome 15, clone RP11-385H1, co... 40 2.5
80gb|AC090602.16| Homo sapiens chromosome 15, clone RP11-125E1, co... 40 2.5
81gb|AY957562.1| Bombina orientalis mitochondrion, complete genome 40 2.5
82gb|AC027045.21| Homo sapiens chromosome 17, clone RP11-477N12, c... 40 2.5
83gb|AC125041.2| Mus musculus BAC clone RP23-337J19 from chromosom... 40 2.5
84gb|AC122918.4| Mus musculus chromosome 6 clone RP23-29F15, compl... 40 2.5
85gb|AC004672.1|AC004672 Homo sapiens 12p13.3-0-2.7 BAC RP5-951N9 ... 40 2.5
86dbj|AP005836.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.5
87dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.5
88gb|AC155838.7| Mus musculus 6 BAC RP24-441P8 (Roswell Park Cance... 40 2.5
89gb|AC002071.1|AC002071 Human PAC clone RP1-2C6 from Xq23, comple... 40 2.5
90gb|AC115020.11| Mus musculus chromosome 1, clone RP24-231D14, co... 40 2.5
91gb|AC101703.11| Mus musculus chromosome 1, clone RP23-248B15, co... 40 2.5
92gb|AE003729.3| Drosophila melanogaster chromosome 3R, section 67... 40 2.5
93gb|AC174597.2| Mus musculus BAC clone RP24-418F6 from chromosome... 40 2.5
94dbj|AP002444.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 2.5
95gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 2.5
96gb|AC157825.3| Mus musculus BAC clone RP23-230M23 from chromosom... 40 2.5
97emb|CT010565.14| Mouse DNA sequence from clone RP23-263E11 on ch... 40 2.5
98gb|AC140368.3| Mus musculus BAC clone RP23-198E1 from 14, comple... 40 2.5
99gb|AY823304.1| Norovirus swine/GII/OH-QW101/03/US RNA-dependent ... 40 2.5
100gb|DQ267825.1| Dendrocalamopsis oldhamii vacuolar invertase BObe... 40 2.5
101gb|AC102303.10| Mus musculus chromosome 1, clone RP24-403I11, co... 38 10.0
102gb|AC102749.10| Mus musculus chromosome 5, clone RP24-478I4, com... 38 10.0
103gb|AC160389.4| Mus musculus chromosome 7, clone RP23-257G13, com... 38 10.0
104gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosom... 38 10.0
105gb|AC166932.6| Mus musculus chromosome 7, clone RP23-349I13, com... 38 10.0
106gb|AC113065.16| Mus musculus chromosome 7, clone RP23-263E7, com... 38 10.0
107gb|AC116370.17| Mus musculus chromosome 3, clone RP24-113D8, com... 38 10.0
108gb|AE014850.1| Plasmodium falciparum 3D7 chromosome 12, section ... 38 10.0
109gb|AC167171.2| Mus musculus BAC clone RP23-409H8 from chromosome... 38 10.0
110gb|AC151601.5| Mus musculus BAC clone RP23-241H10 from chromosom... 38 10.0
111gb|AC006815.2| Caenorhabditis elegans cosmid Y6D11A, complete se... 38 10.0
112gb|AC008348.5| Drosophila melanogaster clone BACR02I11, complete... 38 10.0
113gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome ... 38 10.0
114gb|AC149486.1| Populus trichocarpa clone Pop1-8L22, complete seq... 38 10.0
115gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome 38 10.0
116gb|AC149575.1| Populus trichocarpa clone Pop1-41G18, complete se... 38 10.0
117gb|AC148021.2| Mus musculus BAC clone RP23-9A7 from chromosome 1... 38 10.0
118gb|AC126443.3| Mus musculus BAC clone RP23-464J8 from chromosome... 38 10.0
119gb|AC139328.4| Mus musculus BAC clone RP24-299C21 from chromosom... 38 10.0
120gb|AC125395.3| Mus musculus BAC clone RP23-213J1 from chromosome... 38 10.0
121gb|AC123075.5| Mus musculus BAC clone RP23-181C16 from chromosom... 38 10.0
122gb|DQ491003.1| Chlorella virus AR158 ctg_1047243734156 genomic s... 38 10.0
123gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorell... 38 10.0
124gb|AC138667.8| Mus musculus chromosome 14, clone RP24-122H16, co... 38 10.0
125gb|AC114593.12| Mus musculus chromosome 14, clone RP23-44B17, co... 38 10.0
126gb|AC102008.9| Mus musculus chromosome 7, clone RP24-502L8, comp... 38 10.0
127gb|AC123719.10| Mus musculus chromosome 13, clone RP23-412A14, c... 38 10.0
128gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, com... 38 10.0
129gb|AC134439.4| Mus musculus BAC clone RP24-494I18 from chromosom... 38 10.0
130gb|AC116460.10| Mus musculus chromosome 10, clone RP23-244G12, c... 38 10.0
131gb|AC102902.6| Mus musculus chromosome 16, clone RP24-313G10, co... 38 10.0
132gb|AC146615.2| Mus musculus BAC clone RP23-19K2 from chromosome ... 38 10.0
133emb|CR376775.7| Zebrafish DNA sequence from clone CH211-197C5 in... 38 10.0
134emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 38 10.0
135emb|CT009478.9| M.truncatula DNA sequence from clone MTH2-106O21... 38 10.0
136emb|CR936261.8| Zebrafish DNA sequence from clone DKEY-207A6 in ... 38 10.0
137gb|AC113470.14| Mus musculus chromosome 9, clone RP23-262N17, co... 38 10.0
138emb|BX901899.9| Zebrafish DNA sequence from clone DKEY-255N6 in ... 38 10.0
139gb|AC117702.10| Mus musculus chromosome 10, clone RP23-464I2, co... 38 10.0
140gb|AC124496.3| Mus musculus BAC clone RP23-471J10 from chromosom... 38 10.0
141gb|AC125098.4| Mus musculus BAC clone RP24-195M13 from chromosom... 38 10.0
142gb|AC141867.4| Mus musculus BAC clone RP24-424E17 from chromosom... 38 10.0
143gb|AC141329.4| Mus musculus BAC clone RP23-63G7 from chromosome ... 38 10.0
144gb|AC125373.4| Mus musculus BAC clone RP23-379A13 from chromosom... 38 10.0
145gb|AC108797.8| Mus musculus chromosome 3, clone RP23-349M18, com... 38 10.0
146gb|AC115805.12| Mus musculus chromosome 10, clone RP23-412P24, c... 38 10.0
147gb|AC122480.3| Mus musculus BAC clone RP24-355B22 from chromosom... 38 10.0
148gb|AC123565.6| Homo sapiens 3 BAC RP11-539J20 (Roswell Park Canc... 38 10.0
149gb|AC122517.2| Mus musculus BAC clone RP24-459G24 from chromosom... 38 10.0
150gb|AC124489.2| Mus musculus BAC clone RP23-453H5 from chromosome... 38 10.0
151gb|AC121611.3| Mus musculus BAC clone RP23-330I2 from chromosome... 38 10.0
152gb|AC122925.3| Mus musculus BAC clone RP23-9O19 from 1, complete... 38 10.0
153gb|AC122830.4| Mus musculus BAC clone RP23-224I23 from 8, comple... 38 10.0
154gb|AC122320.4| Mus musculus BAC clone RP23-315F17 from 14, compl... 38 10.0
155gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, co... 38 10.0
156gb|AC117185.2| Mus musculus BAC clone RP23-37M7 from 8, complete... 38 10.0
157gb|AC122884.2| Mus musculus BAC clone RP23-88O13 from 5, complet... 38 10.0
158gb|AC122012.3| Mus musculus BAC clone RP24-353N4 from 5, complet... 38 10.0
159gb|AC111007.4| Mus musculus BAC clone RP23-226I10 from 3, comple... 38 10.0
160gb|AC098737.3| Mus musculus BAC clone RP23-122D16 from 1, comple... 38 10.0
161gb|AC004926.2| Homo sapiens PAC clone RP5-910H9 from 7, complete... 38 10.0
162ref|XM_721871.1| Plasmodium yoelii yoelii str. 17XNL CCAAT-box D... 38 10.0
163ref|XM_720836.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 10.0
164ref|XM_960904.1| Plasmodium falciparum 3D7 hypothetical protein ... 38 10.0
165ref|XM_961212.1| Plasmodium falciparum 3D7 erythrocyte membrane ... 38 10.0
166gb|AC073133.9| Homo sapiens BAC clone RP11-691F21 from 7, comple... 38 10.0
167gb|AC078848.3| Homo sapiens BAC clone CTD-2220I23 from 7, comple... 38 10.0
168ref|XM_730932.1| Plasmodium chabaudi chabaudi hypothetical prote... 38 10.0
169gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, com... 38 10.0
170gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, com... 38 10.0
171gb|AC122722.7| Medicago truncatula clone mth1-3f12, complete seq... 38 10.0
172gb|AC148405.5| Medicago truncatula clone mth2-37m7, complete seq... 38 10.0
173gb|AC109253.9| Mus musculus, clone RP23-351D8, complete sequence 38 10.0
174gb|BT025041.1| Drosophila melanogaster LD15160 full insert cDNA 38 10.0
175emb|AL627107.32| Human DNA sequence from clone XXyac-R12DG2 on c... 38 10.0
176gb|BC112569.1| Bos taurus hypothetical protein LOC523894, mRNA (... 38 10.0
177emb|AL592044.4| Human DNA sequence from clone RP13-407F1 on chro... 38 10.0
178emb|AL590009.10| Human DNA sequence from clone RP11-181P4 on chr... 38 10.0
179emb|AL583807.20| Human DNA sequence from clone RP11-105C7 on chr... 38 10.0
180emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chrom... 38 10.0
181emb|AL450337.24| Human DNA sequence from clone RP11-51B10 on chr... 38 10.0
182emb|AL391001.12| Human DNA sequence from clone RP11-477H21 on ch... 38 10.0
183emb|AL359388.32| Human DNA sequence from clone RP11-445I23 on ch... 38 10.0
184gb|AE014818.1| Plasmodium falciparum 3D7 chromosome 14 section 3... 38 10.0
185emb|AL357353.12| Human DNA sequence from clone RP11-251L16 on ch... 38 10.0
186emb|AL356579.24| Human DNA sequence from clone RP11-593A16 on ch... 38 10.0
187gb|AC098690.3| Homo sapiens chromosome 1 clone RP11-507I14, comp... 38 10.0
188gb|AC111653.8| Rattus norvegicus 2 BAC CH230-108E11 (Children's ... 38 10.0
189emb|AL162723.12| Human DNA sequence from clone RP13-428K23 on ch... 38 10.0
190emb|AL353143.14| Human DNA sequence from clone RP11-383F12 on ch... 38 10.0
191emb|AL354793.11| Human DNA sequence from clone RP11-431N15 on ch... 38 10.0
192emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on ch... 38 10.0
193emb|AL158167.15| Human DNA sequence from clone RP11-534G20 on ch... 38 10.0
194emb|AL139294.15| Human DNA sequence from clone RP5-1044H5 on chr... 38 10.0
195emb|AL135913.8| Human DNA sequence from clone RP1-44I20 on chrom... 38 10.0
196emb|AL138813.8| Human DNA sequence from clone RP1-305K11 on chro... 38 10.0
197emb|AL136324.6| Human DNA sequence from clone RP5-944H6 on chrom... 38 10.0
198emb|AL135929.5| Human DNA sequence from clone RP4-801G22 on chro... 38 10.0
199gb|AC124784.4| Homo sapiens 12 BAC RP11-461F16 (Roswell Park Can... 38 10.0
200emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I... 38 10.0
201emb|AL096803.8|HSBG304P7 Human DNA sequence from clone GS1-304P7... 38 10.0
202gb|AC157917.4| Mus musculus chromosome 3, clone RP23-120L6, comp... 38 10.0
203gb|AC158149.3| Mus musculus chromosome 5, clone RP24-296L6, comp... 38 10.0
204emb|AL009047.1|HS1156N12 Human DNA sequence from clone RP5-1156N... 38 10.0
205gb|AC133796.2| Homo sapiens 3 BAC RP11-10I2 (Roswell Park Cancer... 38 10.0
206gb|AC130388.6| Drosophila melanogaster X BAC CH221-14P20 (Childr... 38 10.0
207gb|AC023714.5| Drosophila melanogaster X BAC RP98-19D19 (Roswell... 38 10.0
208gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, R... 38 10.0
209emb|CR382401.1| Plasmodium falciparum chromosome 6, complete seq... 38 10.0
210emb|AL035477.6|PFMAL4P4 Plasmodium falciparum MAL4P4 38 10.0
211emb|AL034560.3|PFMAL3P8 Plasmodium falciparum MAL3P8, complete s... 38 10.0
212gb|AC156575.3| Mus musculus BAC clone RP23-4P20 from chromosome ... 38 10.0
213gb|AC160756.7| Mus musculus chromosome 15, clone RP23-158H4, com... 38 10.0
214emb|CR382291.11| Zebrafish DNA sequence from clone CH211-245G10,... 38 10.0
215emb|AL669833.7| Mouse DNA sequence from clone RP23-51C16 on chro... 38 10.0
216emb|AL929002.4| Mouse DNA sequence from clone RP23-369A3 on chro... 38 10.0
217emb|AL592465.8| Mouse DNA sequence from clone RP23-36C4 on chrom... 38 10.0
218emb|AL672260.25| Mouse DNA sequence from clone DN-127L1 on chrom... 38 10.0
219gb|AC087301.8| Homo sapiens chromosome 17, clone RP11-661C3, com... 38 10.0
220gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, comp... 38 10.0
221gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 38 10.0
222gb|AC116529.16| Mus musculus chromosome 8, clone RP24-380O18, co... 38 10.0
223emb|AL683883.26| Mouse DNA sequence from clone RP23-361B8 on chr... 38 10.0
224gb|AC156991.9| Mus musculus chromosome 8, clone RP23-297F23, com... 38 10.0
225gb|AC162943.2| Mus musculus BAC clone RP23-76K9 from chromosome ... 38 10.0
226gb|AC012295.20| Mus musculus chromosome 11, clone RP23-48A17, co... 38 10.0
227dbj|AK022093.1| Homo sapiens cDNA FLJ12031 fis, clone HEMBB1001874 38 10.0
228emb|AL929036.8| Mouse DNA sequence from clone RP24-548P4 on chro... 38 10.0
229ref|NM_206620.3| Drosophila melanogaster Tousled-like kinase CG3... 38 10.0
230gb|AF434765.1| Mus musculus fatty acid translocase (Cd36) gene, ... 38 10.0
231gb|AC090179.4| Homo sapiens chromosome 15, clone RP11-236J21, co... 38 10.0
232gb|AC022106.5| Homo sapiens chromosome 5 clone CTC-311G1, comple... 38 10.0
233dbj|AK138435.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 38 10.0
234gb|AC157786.7| Mus musculus chromosome 1, clone RP23-280O23, com... 38 10.0
235gb|AC100783.2| Homo sapiens chromosome 18, clone RP11-141I4, com... 38 10.0
236gb|AC090751.9| Homo sapiens chromosome 15, clone RP11-331H13, co... 38 10.0
237gb|AC093154.2| Homo sapiens chromosome 1 clone RP3-445O10, compl... 38 10.0
238gb|AC166644.7| Mus musculus chromosome 1, clone RP23-375C6, comp... 38 10.0
239gb|AC099015.1| Drosophila melanogaster, chromosome 2R, region 48... 38 10.0
240ref|NM_001031761.2| Bos taurus hypothetical protein LOC523894 (L... 38 10.0
241emb|AL772373.23| Zebrafish DNA sequence from clone CH211-143A22 ... 38 10.0
242gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosom... 38 10.0
243gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Can... 38 10.0
244gb|AC010441.6| Homo sapiens chromosome 5 clone CTD-2228J3, compl... 38 10.0
245gb|AC130669.17| Mus musculus chromosome 15, clone RP24-84O5, com... 38 10.0
246gb|AC010482.8| Homo sapiens chromosome 5 clone CTD-2318J2, compl... 38 10.0
247gb|AC153650.4| Mus musculus BAC clone RP24-93I18 from chromosome... 38 10.0
248gb|AC157557.5| Mus musculus chromosome 7, clone RP24-369M22, com... 38 10.0
249gb|AC023118.4|AC023118 Homo sapiens BAC clone RP11-277L22 from 1... 38 10.0
250gb|AC153527.9| Mus musculus 10 BAC RP23-320A6 (Roswell Park Canc... 38 10.0
251emb|BX247877.13| Zebrafish DNA sequence from clone DKEY-16J24, c... 38 10.0
252emb|AL117071.1|CNS01DO7 Botrytis cinerea strain T4 cDNA library 38 10.0
253gb|AC015819.5|AC015819 Homo sapiens chromosome 18, clone RP11-40... 38 10.0
254dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 38 10.0
255dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 10.0
256gb|AC008126.9|AC008126 Homo sapiens 12 BAC RPCI11-90E9 (Roswell ... 38 10.0
257emb|BX248401.10| Zebrafish DNA sequence from clone CH211-233P10,... 38 10.0
258emb|BX572076.4| Zebrafish DNA sequence from clone DKEY-69N5 in l... 38 10.0
259gb|AC096735.3| Homo sapiens BAC clone RP11-135M12 from 4, comple... 38 10.0
260gb|AC154124.5| Mus musculus chromosome 5, clone RP24-63G13, comp... 38 10.0
261gb|AC007886.7|AC007886 Drosophila melanogaster, chromosome 3R, r... 38 10.0
262gb|AC009916.5|AC009916 Drosophila melanogaster, chromosome 3R, r... 38 10.0
263gb|AC009733.5|AC009733 Drosophila melanogaster, chromosome 3R, r... 38 10.0
264gb|AC073271.4| Homo sapiens BAC clone RP11-541O14 from 2, comple... 38 10.0
265gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chrom... 38 10.0
266gb|AC022081.32|AC022081 Homo sapiens 12 BAC RP11-977P2 (Roswell ... 38 10.0
267gb|AC022506.38| Homo sapiens 12 BAC RP11-181L23 (Roswell Park Ca... 38 10.0
268gb|AC010738.5| Homo sapiens BAC clone RP11-443I9 from 2, complet... 38 10.0
269gb|AC084321.37| Mus musculus strain C57BL/6J chromosome 7 clone ... 38 10.0
270dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic D... 38 10.0
271gb|AC068718.6| Homo sapiens BAC clone RP11-123G24 from 2, comple... 38 10.0
272gb|AC012066.10| Homo sapiens BAC clone RP11-173H9 from 2, comple... 38 10.0
273gb|AC069418.15| Homo sapiens 3 BAC RP11-464F3 (Roswell Park Canc... 38 10.0
274gb|AC012077.4|AC012077 Homo sapiens BAC clone RP11-524G14 from Y... 38 10.0
275gb|AC117539.6| Papio hamadryas, clone RP41-208E11, complete sequ... 38 10.0
276gb|AC061965.16| Homo sapiens chromosome 15, clone RP11-37J13, co... 38 10.0
277gb|AC125035.3| Mus musculus chromosome UL clone RP23-328F24, com... 38 10.0
278gb|AC009358.6|AC009358 Human Chromosome 7 clone RP11-191E5, comp... 38 10.0
279gb|AC106784.3| Homo sapiens chromosome 5 clone RP11-349A15, comp... 38 10.0
280gb|AC124804.10| Homo sapiens chromosome 17, clone RP11-449L23, c... 38 10.0
281gb|AC009178.4|AC009178 Homo sapiens clone RP11-169C22 from 7q31,... 38 10.0
282gb|AC016943.7|AC016943 Homo sapiens 3 BAC RP11-380G10 (Roswell P... 38 10.0
283gb|AC152169.2| Mus musculus BAC clone RP23-79L13 from chromosome... 38 10.0
284dbj|AP004137.3| Oryza sativa (japonica cultivar-group) genomic D... 38 10.0
285gb|AC010340.7|AC010340 Homo sapiens chromosome 5 clone CTD-2010I... 38 10.0
286gb|AF172082.1|AF172082 Homo sapiens HPC1 locus clone 173P17 geno... 38 10.0
287dbj|AB167467.1| Tuberaphis coreana mRNA for cathepsin B-N, compl... 38 10.0
288dbj|AB162623.1| Tuberaphis styraci catB mRNA for cathepsin B-N, ... 38 10.0
289emb|AL935280.12| Zebrafish DNA sequence from clone DKEY-261J4, c... 38 10.0
290emb|AL928988.14| Mouse DNA sequence from clone RP23-402M7 on chr... 38 10.0
291emb|AL713898.9| Mouse DNA sequence from clone RP23-253D13 on chr... 38 10.0
292dbj|AP003880.3| Oryza sativa (japonica cultivar-group) genomic D... 38 10.0
293gb|BC091816.1| Danio rerio cDNA clone IMAGE:7146167 38 10.0
294gb|AF001548.1|HUAF001548 Human Chromosome 16 BAC clone CIT987SK-... 38 10.0
295gb|AC154743.2| Mus musculus BAC clone RP24-392N10 from 13, compl... 38 10.0
296gb|AC005016.1|AC005016 Homo sapiens BAC clone GS1-180J15 from 7q... 38 10.0
297emb|CR848051.16| Zebrafish DNA sequence from clone DKEY-67K15 in... 38 10.0
298gb|AC155244.2| Mus musculus BAC clone RP24-318B2 from 13, comple... 38 10.0
299emb|BX294114.8| Zebrafish DNA sequence from clone DKEY-152J12 in... 38 10.0
300emb|AL583809.3|CNS07EFY Human chromosome 14 DNA sequence BAC R-7... 38 10.0
301gb|AC154777.2| Mus musculus BAC clone RP24-459H24 from 14, compl... 38 10.0
302gb|AC107666.13| Mus musculus chromosome 5, clone RP23-111M3, com... 38 10.0
303emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in... 38 10.0
304gb|AC135255.2| Homo sapiens 12 BAC RP11-118B13 (Roswell Park Can... 38 10.0
305gb|AC116469.13| Mus musculus chromosome 5, clone RP23-171F16, co... 38 10.0
306gb|AC104892.10| Mus musculus chromosome 18, clone RP23-262H4, co... 38 10.0
307emb|CT025920.8| Zebrafish DNA sequence from clone CH73-64P10 in ... 38 10.0
308gb|BT020677.1| Bos taurus hypothetical protein FLJ38968 (FLJ3896... 38 10.0
309gb|AC113288.7| Mus musculus chromosome 5, clone RP23-414I12, com... 38 10.0
310gb|AE003748.3| Drosophila melanogaster chromosome 3R, section 86... 38 10.0
311gb|AE003824.3| Drosophila melanogaster chromosome 2R, section 26... 38 10.0
312gb|AE003772.2| Drosophila melanogaster chromosome 3R, section 11... 38 10.0
313emb|AL132709.5|CNS01DTB Human chromosome 14 DNA sequence BAC R-9... 38 10.0
314gb|AE003456.3| Drosophila melanogaster chromosome 2R, section 64... 38 10.0
315gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 ... 38 10.0
316gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, co... 38 10.0
317gb|AC111039.13| Mus musculus chromosome 5, clone RP24-463M5, com... 38 10.0
318gb|AC163756.5| Pan troglodytes BAC clone CH251-261N12 from chrom... 38 10.0
319gb|AC101547.9| Mus musculus chromosome 5, clone RP23-193C5, comp... 38 10.0
320gb|AC117684.10| Mus musculus chromosome 9, clone RP23-438A6, com... 38 10.0
321gb|AC103404.13| Mus musculus chromosome 5, clone RP23-21O1, comp... 38 10.0
322gb|AC118680.7| Mus musculus chromosome 8, clone RP24-381G7, comp... 38 10.0
323gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, co... 38 10.0
324dbj|AP002797.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 38 10.0
325dbj|AP001524.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 38 10.0
326dbj|AP000916.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 10.0
327dbj|AP001885.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 10.0
328gb|AC005465.1|AC005465 Drosophila melanogaster, chromosome 2R, r... 38 10.0
329emb|CT030656.7| Mouse DNA sequence from clone RP23-271O7 on chro... 38 10.0
330emb|CR955004.2| Medicago truncatula chromosome 5 clone mte1-9e19... 38 10.0
331emb|CT025753.11| Mouse DNA sequence from clone RP24-340F12 on ch... 38 10.0
332gb|AF045643.2| Caenorhabditis elegans cosmid F58H7, complete seq... 38 10.0
333gb|U40315.1|DMSLOW3 Drosophila melanogaster Ca2+-activated K+ ch... 38 10.0
334gb|U92208.1|LIU92208 Legionella israelensis macrophage infectivi... 38 10.0
335gb|AC159269.3| Mus musculus BAC clone RP23-426N14 from chromosom... 38 10.0
336emb|AL357752.19| Human DNA sequence from clone RP13-26D14 on chr... 38 10.0
337emb|BX323819.9| Zebrafish DNA sequence from clone CH211-132F19 i... 38 10.0
338gb|AC161466.4| Gallus gallus BAC clone CH261-104N11 from chromos... 38 10.0
339gb|AC147108.3| Mus musculus BAC clone RP24-70D19 from 13, comple... 38 10.0
340gb|AC144762.3| Mus musculus BAC clone RP24-95D6 from 3, complete... 38 10.0
341gb|AC132571.2| Mus musculus BAC clone RP24-539E18 from 1, comple... 38 10.0
342emb|CT030664.5| Mouse DNA sequence from clone RP23-357K7 on chro... 38 10.0
343gb|AC004252.1|AC004252 Drosophila melanogaster (P1 DS09121 (D88)... 38 10.0
344gb|AC132453.3| Mus musculus BAC clone RP23-200J18 from 6, comple... 38 10.0
345gb|AC132137.3| Mus musculus BAC clone RP23-153E2 from 3, complet... 38 10.0
346gb|AC135511.4| Mus musculus BAC clone RP23-255B19 from 3, comple... 38 10.0
347gb|AC134900.5| Mus musculus BAC clone RP23-249B22 from 10, compl... 38 10.0
348emb|CT025552.9| Mouse DNA sequence from clone RP24-270A4 on chro... 38 10.0
349emb|AL844522.7| Zebrafish DNA sequence from clone DKEY-113M9, co... 38 10.0
350emb|AL772324.5| Mouse DNA sequence from clone RP23-440O7 on chro... 38 10.0
351gb|AC148321.7| Mus musculus BAC clone RP24-512H17 from 19, compl... 38 10.0
352gb|AC002106.1|AC002106 Genomic sequence from Human 9q34, complet... 38 10.0
353gb|U27338.1|PFU27338 Plasmodium falciparum erythrocyte membrane ... 38 10.0
354gb|AC163743.6| Mus musculus BAC clone RP23-415J4 from chromosome... 38 10.0
355dbj|AB047300.1| Rattus norvegicus GAPDH gene for glyceraldehyde-... 38 10.0
356gb|AC099643.5| Mus musculus chromosome 7, clone RP24-350G1, comp... 38 10.0
357gb|AC164586.7| Mus musculus chromosome 8, clone RP24-258B3, comp... 38 10.0
358gb|AC163039.6| Mus musculus BAC clone RP23-188J1 from chromosome... 38 10.0
359dbj|AP004933.1| Lotus japonicus genomic DNA, chromosome 1, clone... 38 10.0
360gb|U35323.1|MMU35323 Mus musculus H2-M alpha chain (H2-Ma) gene,... 38 10.0
361gb|AC171502.2| Mus musculus BAC clone RP23-242G4 from chromosome... 38 10.0
362gb|AC171325.5| Mus musculus chromosome 3, clone RP23-124B15, com... 38 10.0
363gb|AC115008.7| Mus musculus chromosome 3, clone RP24-189F12, com... 38 10.0
364gb|AC162921.3| Mus musculus BAC clone RP23-342H1 from chromosome... 38 10.0
365gb|L40609.1|PFAVAR23A Plasmodium falciparum (strain FCR3) varian... 38 10.0
366emb|AL773580.11| Mouse DNA sequence from clone RP23-26G3 on chro... 38 10.0
367emb|AL672271.9| Mouse DNA sequence from clone RP23-450H23 on chr... 38 10.0
368emb|AL645930.15| Mouse DNA sequence from clone RP23-434L7 on chr... 38 10.0
369emb|AL807763.7| Mouse DNA sequence from clone RP23-28B24 on chro... 38 10.0
370emb|AL929066.7| Mouse DNA sequence from clone RP23-68E1 on chrom... 38 10.0
371gb|AC101299.16| Mus musculus chromosome 1, clone RP23-103M17, co... 38 10.0
372dbj|AP001179.4| Homo sapiens genomic DNA, chromosome 11q14, clon... 38 10.0
373emb|AL627432.26| Mouse DNA sequence from clone RP23-45I5 on chro... 38 10.0

>emb|AJ532549.1|LTE532549 Lolium temulentum mRNA for putative soluble acid invertase (inv1:4
            gene)
          Length = 2407

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 100  gacaatgaatagacataataaaaatgaaaa 129
            |||||||||||||||||||||| |||||||
Sbjct: 2260 gacaatgaatagacataataaagatgaaaa 2231



 Score = 44.1 bits (22), Expect = 0.16
 Identities = 40/45 (88%), Gaps = 2/45 (4%)
 Strand = Plus / Minus

                                                         
Query: 28   tacatatacagctctagctttgcatatcatggcatcttccactag 72
            ||||| |||||||||||| |||  | |||||||||||||||||||
Sbjct: 2326 tacatgtacagctctagccttg--tgtcatggcatcttccactag 2284



to top

>gb|AC175059.2| Pan troglodytes BAC clone CH251-777D16 from chromosome y, complete
            sequence
          Length = 166448

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 152  gaggagaaaatcagaaaggaaatt 175
            ||||||||||||||||||||||||
Sbjct: 8919 gaggagaaaatcagaaaggaaatt 8896



to top

>emb|AL133420.28| Human DNA sequence from clone RP5-904D7 on chromosome 20 Contains ESTs,
             STSs and GSSs, complete sequence
          Length = 84722

 Score = 46.1 bits (23), Expect = 0.041
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 175   tacacatatatgtatatgctata 197
             |||||||||||||||||||||||
Sbjct: 15368 tacacatatatgtatatgctata 15346



to top

>emb|BX322655.10| Zebrafish DNA sequence from clone DKEYP-53E12 in linkage group 8,
              complete sequence
          Length = 184723

 Score = 46.1 bits (23), Expect = 0.041
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 97     cttgacaatgaatagacataataaaaa 123
              |||||||||||||||||| ||||||||
Sbjct: 117622 cttgacaatgaatagacagaataaaaa 117648



to top

>gb|AC146108.3| Pan troglodytes BAC clone RP43-22F10 from 7, complete sequence
          Length = 230349

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 107    aatagacataataaaaatgaaaaggg 132
              |||||||||||||||||||| |||||
Sbjct: 190751 aatagacataataaaaatgataaggg 190726



to top

>gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, complete sequence
          Length = 174491

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 170   gaaattacacatatatgtatat 191
             ||||||||||||||||||||||
Sbjct: 96886 gaaattacacatatatgtatat 96907



to top

>ref|XM_960923.1| Plasmodium falciparum 3D7 hypothetical protein (PFF0125c) partial
            mRNA
          Length = 3894

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 114  ataataaaaatgaaaagggaaa 135
            ||||||||||||||||||||||
Sbjct: 1424 ataataaaaatgaaaagggaaa 1445



to top

>emb|AL360272.23| Human DNA sequence from clone RP11-169I2 on chromosome 6 Contains the
             3' end of the SUPT3H gene for suppressor of Ty 3 homolog
             (S. cerevisiae), complete sequence
          Length = 110382

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 155   gagaaaatcagaaaggaaatta 176
             ||||||||||||||||||||||
Sbjct: 14363 gagaaaatcagaaaggaaatta 14384



to top

>emb|CR382398.1| Plasmodium falciparum chromosome 6, complete sequence; segment 1/5
          Length = 349418

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 114    ataataaaaatgaaaagggaaa 135
              ||||||||||||||||||||||
Sbjct: 110238 ataataaaaatgaaaagggaaa 110217



 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 104   atgaatagacataataaaa 122
             |||||||||||||||||||
Sbjct: 12148 atgaatagacataataaaa 12130



to top

>gb|AC068991.28| Homo sapiens 12 BAC RP11-300D9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 173639

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 155   gagaaaatcagaaaggaaatta 176
             ||||||||||||||||||||||
Sbjct: 19697 gagaaaatcagaaaggaaatta 19718



to top

>gb|AC091639.5| Homo sapiens chromosome 8, clone RP11-61K18, complete sequence
          Length = 147480

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 172   aattacacatatatgtatatgc 193
             ||||||||||||||||||||||
Sbjct: 47094 aattacacatatatgtatatgc 47115



to top

>gb|AC025828.3|AC025828 Homo sapiens, clone RP11-13I24, complete sequence
          Length = 152843

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 172    aattacacatatatgtatatgc 193
              ||||||||||||||||||||||
Sbjct: 149559 aattacacatatatgtatatgc 149538



to top

>emb|BX664611.6| Mouse DNA sequence from clone RP24-201C13 on chromosome X, complete
             sequence
          Length = 59966

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 116   aataaaaatgaaaagggaaaca 137
             ||||||||||||||||||||||
Sbjct: 22332 aataaaaatgaaaagggaaaca 22311



to top

>gb|AC007065.5|AC007065 Homo sapiens, clone hRPK.58_A_1, complete sequence
          Length = 169325

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 155   gagaaaatcagaaaggaaatta 176
             ||||||||||||||||||||||
Sbjct: 15429 gagaaaatcagaaaggaaatta 15450



to top

>dbj|AP005361.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1538E2, complete
             sequence
          Length = 65355

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 172   aattacacatatatgtatatgc 193
             ||||||||||||||||||||||
Sbjct: 27123 aattacacatatatgtatatgc 27102



to top

>gb|AC101748.7| Mus musculus chromosome 5, clone RP24-133H21, complete sequence
          Length = 168366

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                           
Query: 162    tcagaaaggaaattacacatatatgtata 190
              ||||||||||||| |||||||||||||||
Sbjct: 108582 tcagaaaggaaat-acacatatatgtata 108609



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 106      gaatagacataataaaaatgaaaag 130
                ||||| |||||||||||||||||||
Sbjct: 11690289 gaataaacataataaaaatgaaaag 11690265



to top

>gb|AC124424.4| Mus musculus BAC clone RP24-230J3 from chromosome 2, complete sequence
          Length = 190802

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 13    atttgattgatgtagtacata 33
             |||||||||||||||||||||
Sbjct: 62261 atttgattgatgtagtacata 62281



to top

>gb|AC118674.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0093J20, from chromosome 3, complete sequence
          Length = 148635

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 106   gaatagacataataaaaatgaaaag 130
             ||||| |||||||||||||||||||
Sbjct: 79384 gaataaacataataaaaatgaaaag 79360



to top

>gb|AC066593.4| Homo sapiens chromosome 3 clone RP11-344O5 map 3p, complete sequence
          Length = 165873

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 105   tgaatagacataataaaaatg 125
             |||||||||||||||||||||
Sbjct: 59404 tgaatagacataataaaaatg 59384



to top

>gb|AC096757.3| Homo sapiens BAC clone RP11-543H9 from 4, complete sequence
          Length = 188464

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 179    catatatgtatatgctataaa 199
              |||||||||||||||||||||
Sbjct: 171255 catatatgtatatgctataaa 171235



to top

>gb|AC021105.13| Homo sapiens BAC clone RP11-163O17 from 4, complete sequence
          Length = 187360

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   aaaggaaattacacatatatg 186
             |||||||||||||||||||||
Sbjct: 26981 aaaggaaattacacatatatg 27001



to top

>gb|AC158399.2| Mus musculus BAC clone RP23-246A2 from chromosome 14, complete sequence
          Length = 198948

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 175   tacacatatatgtatatgcta 195
             |||||||||||||||||||||
Sbjct: 52520 tacacatatatgtatatgcta 52500



to top

>dbj|AK030792.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
            library, clone:5830402J09 product:hypothetical protein,
            full insert sequence
          Length = 4547

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 13   atttgattgatgtagtacata 33
            |||||||||||||||||||||
Sbjct: 4007 atttgattgatgtagtacata 4027



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 106      gaatagacataataaaaatgaaaag 130
                ||||| |||||||||||||||||||
Sbjct: 11687052 gaataaacataataaaaatgaaaag 11687028



to top

>emb|BX294653.11| Zebrafish DNA sequence from clone CH211-196H24 in linkage group 20,
             complete sequence
          Length = 208836

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 110   agacataataaaaatgaaaag 130
             |||||||||||||||||||||
Sbjct: 86937 agacataataaaaatgaaaag 86917



to top

>emb|AJ277858.1|MTR277858 Medicago truncatula nod25 gene for nodulin 25, exons 1-13
          Length = 10581

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 171  aaattacacatatatgtatat 191
            |||||||||||||||||||||
Sbjct: 3963 aaattacacatatatgtatat 3983



to top

>dbj|AB104414.1| Cucumis melo GeAAT-2 mRNA for alcohol acyltransferase, complete cds
          Length = 1567

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 104  atgaatagacataataaaaat 124
            |||||||||||||||||||||
Sbjct: 1263 atgaatagacataataaaaat 1283



to top

>gb|AC126020.4| Mus musculus BAC clone RP24-364O7 from 8, complete sequence
          Length = 179287

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 161   atcagaaaggaaattacacatatat 185
             |||||||||||||||| ||||||||
Sbjct: 81322 atcagaaaggaaattaaacatatat 81298



to top

>gb|AC147720.1| Gallus gallus BAC clone CH261-46I14 from chromosome unknown, complete
              sequence
          Length = 204711

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 98     ttgacaatgaatagacataat 118
              |||||||||||||||||||||
Sbjct: 109228 ttgacaatgaatagacataat 109208



to top

>gb|U39305.1|ECU39305 Escherichia coli polysaccharide chain length determining protein
          (wzz) gene, partial cds
          Length = 948

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 3  gaacaaattgatttgattgat 23
          |||||||||||||||||||||
Sbjct: 31 gaacaaattgatttgattgat 51



to top

>gb|AC123689.8| Mus musculus chromosome 15, clone RP23-321P10, complete sequence
          Length = 218071

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 176    acacatatatgtatatgctat 196
              |||||||||||||||||||||
Sbjct: 166156 acacatatatgtatatgctat 166176



to top

>gb|AC157602.8| Mus musculus chromosome 15 clone RP23-104H10, complete sequence
          Length = 211648

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 176    acacatatatgtatatgctat 196
              |||||||||||||||||||||
Sbjct: 161076 acacatatatgtatatgctat 161056



to top

>emb|AL845290.7| Mouse DNA sequence from clone RP23-201A19 on chromosome 2, complete
            sequence
          Length = 146005

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 121  aaatgaaaagggaaacaaaga 141
            |||||||||||||||||||||
Sbjct: 4750 aaatgaaaagggaaacaaaga 4770



to top

>emb|AL840623.10| Mouse DNA sequence from clone RP23-289L17 on chromosome 4, complete
             sequence
          Length = 112610

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 171   aaattacacatatatgtatat 191
             |||||||||||||||||||||
Sbjct: 18204 aaattacacatatatgtatat 18224



to top

>emb|AL844163.7| Mouse DNA sequence from clone RP23-467L21 on chromosome 2, complete
              sequence
          Length = 165671

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 13     atttgattgatgtagtacata 33
              |||||||||||||||||||||
Sbjct: 159358 atttgattgatgtagtacata 159338



to top

>gb|AC109157.10| Mus musculus chromosome 7, clone RP24-169M16, complete sequence
          Length = 164968

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 116   aataaaaatgaaaagggaaacaaagata 143
             |||||||||||| | |||||||||||||
Sbjct: 41306 aataaaaatgaatatggaaacaaagata 41333



to top

>gb|AC113600.19| Mus musculus chromosome 6, clone RP23-110A19, complete sequence
          Length = 212705

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 112    acataataaaaatgaaaagg 131
              ||||||||||||||||||||
Sbjct: 201500 acataataaaaatgaaaagg 201519



to top

>ref|NG_002690.1| Homo sapiens Prader-Willi/Angelman syndrome region (PWSAS@) on
             chromosome 15
          Length = 755217

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   catatatgtatatgctataa 198
             ||||||||||||||||||||
Sbjct: 64218 catatatgtatatgctataa 64237



to top

>gb|AC099621.12| Mus musculus chromosome 15, clone RP23-468J2, complete sequence
          Length = 178810

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 119    aaaaatgaaaagggaaacaa 138
              ||||||||||||||||||||
Sbjct: 142411 aaaaatgaaaagggaaacaa 142430



to top

>emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chromosome 13, complete
             sequence
          Length = 217752

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   attacacatatatgtatatg 192
             ||||||||||||||||||||
Sbjct: 75763 attacacatatatgtatatg 75782



to top

>gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome 15, complete sequence
          Length = 198019

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    aaaaatgaaaagggaaacaa 138
              ||||||||||||||||||||
Sbjct: 108989 aaaaatgaaaagggaaacaa 108970



to top

>emb|Z70687.2|CET14C1 Caenorhabditis elegans Cosmid T14C1, complete sequence
          Length = 16646

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 1   ctgaacaaattgatttgatt 20
           ||||||||||||||||||||
Sbjct: 481 ctgaacaaattgatttgatt 462



to top

>gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosome 16, complete
             sequence
          Length = 159535

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   aaatgaaaagggaaacaaag 140
             ||||||||||||||||||||
Sbjct: 56953 aaatgaaaagggaaacaaag 56934



to top

>gb|AC117598.7| Mus musculus chromosome 1, clone RP23-398H16, complete sequence
          Length = 196300

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 158   aaaatcagaaaggaaattac 177
             ||||||||||||||||||||
Sbjct: 51377 aaaatcagaaaggaaattac 51358



to top

>gb|AC146308.2| Medicago truncatula clone mth2-10a12, complete sequence
          Length = 112733

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   aaaatgaaaagggaaacaaa 139
             ||||||||||||||||||||
Sbjct: 73784 aaaatgaaaagggaaacaaa 73803



to top

>gb|AC137554.15| Medicago truncatula clone mth2-17j18, complete sequence
          Length = 121248

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 120   aaaatgaaaagggaaacaaa 139
             ||||||||||||||||||||
Sbjct: 96296 aaaatgaaaagggaaacaaa 96277



to top

>emb|BX936404.9| Zebrafish DNA sequence from clone CH211-237F6 in linkage group 17,
             complete sequence
          Length = 86765

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 98    ttgacaatgaatagacataataaaaatgaaaa 129
             |||||||| |||| | ||||||||||||||||
Sbjct: 82597 ttgacaattaataaaaataataaaaatgaaaa 82566



to top

>emb|AL606759.8| Human DNA sequence from clone CTD-2319N17 on chromosome X, complete
           sequence
          Length = 30082

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 173 attacacatatatgtatatg 192
           ||||||||||||||||||||
Sbjct: 652 attacacatatatgtatatg 633



to top

>emb|AL591202.8| Human DNA sequence from clone RP11-262B12 on chromosome X, complete
             sequence
          Length = 92817

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   aatagacataataaaaatga 126
             ||||||||||||||||||||
Sbjct: 27866 aatagacataataaaaatga 27847



to top

>emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on chromosome 10 Contains the
              3' end of a breast cancer antigen (NY-BR-1) pseudogene, the
              3' end of a novel gene, a pseudogene similar to part of
              cubilin (intrinsic factor-cobalamin receptor, CUBN), a
              seven transmembrane helix receptor (FLJ31393) pseudogene,
              the OR13A1 gene for olfactory receptor family 13 subfamily
              A member 1 and two CpG islands, complete sequence
          Length = 168473

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 107    aatagacataataaaaatga 126
              ||||||||||||||||||||
Sbjct: 125203 aatagacataataaaaatga 125184



to top

>emb|AL365400.19| Human DNA sequence from clone RP11-471G13 on chromosome Xq21.32-22.1
              Contains a novel pseudogene,  a heterogeneous nuclear
              ribonucleoprotein D-like (HNRPDL) pseudogene and a
              ribosomal protein S7 (RPS7) pseudogene, complete sequence
          Length = 176391

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 107    aatagacataataaaaatga 126
              ||||||||||||||||||||
Sbjct: 142791 aatagacataataaaaatga 142810



to top

>emb|AL356739.11| Human DNA sequence from clone RP11-324P13 on chromosome 6, complete
             sequence
          Length = 98548

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 166   aaaggaaattacacatatat 185
             ||||||||||||||||||||
Sbjct: 72636 aaaggaaattacacatatat 72617



to top

>emb|AL137026.21| Human DNA sequence from clone RP11-20J15 on chromosome 10 Contains
             CXCL12 gene for chemokine (C-X-C motif) ligand 12 (stromal
             cell-derived factor 1), two putative transcripts and two
             putative CpG islands, complete sequence
          Length = 184474

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   aatagacataataaaaatga 126
             ||||||||||||||||||||
Sbjct: 21558 aatagacataataaaaatga 21539



to top

>emb|AL022148.1|HS435A7 Human DNA sequence from clone RP3-435A7 on chromosome Xq22.1-22.3,
             complete sequence
          Length = 98067

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   attacacatatatgtatatg 192
             ||||||||||||||||||||
Sbjct: 96719 attacacatatatgtatatg 96700



to top

>emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chromosome 9; segment 1/5
          Length = 330050

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 171    aaattacacatatatgtatatgct 194
              |||||||| |||||||||||||||
Sbjct: 121170 aaattacatatatatgtatatgct 121147



to top

>emb|CR933104.2| Medicago truncatula chromosome 5 clone mth2-25b3, COMPLETE SEQUENCE
          Length = 117135

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 107   aatagacataataaaaatgaaaagggaa 134
             |||||| || ||||||||||||||||||
Sbjct: 59216 aatagatatgataaaaatgaaaagggaa 59189



to top

>gb|AC163900.3| Mus musculus BAC clone RP23-151K15 from chromosome 12, complete sequence
          Length = 200606

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    gaaaatcagaaaggaaatta 176
              ||||||||||||||||||||
Sbjct: 177163 gaaaatcagaaaggaaatta 177144



to top

>gb|AC073391.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             nbeb0015F09b, complete sequence
          Length = 108964

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    tttgattgatgtagtacata 33
             ||||||||||||||||||||
Sbjct: 18603 tttgattgatgtagtacata 18622



to top

>gb|AC025028.21| Homo sapiens 3 BAC RP11-238M12 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 145969

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 107   aatagacataataaaaatga 126
             ||||||||||||||||||||
Sbjct: 49230 aatagacataataaaaatga 49249



to top

>dbj|AB120741.1| Rhizophora stylosa DNA, microsatellite marker Rhst13
          Length = 352

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 106 gaatagacataataaaaatgaaaa 129
           |||||||||||| |||||||||||
Sbjct: 205 gaatagacataaaaaaaatgaaaa 182



to top

>gb|AC008603.7| Homo sapiens chromosome 5 clone CTB-107P3, complete sequence
          Length = 123866

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 107   aatagacataataaaaatga 126
             ||||||||||||||||||||
Sbjct: 64547 aatagacataataaaaatga 64566



to top

>gb|AC107383.3| Homo sapiens BAC clone RP11-125C20 from 4, complete sequence
          Length = 173808

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 173   attacacatatatgtatatgctat 196
             |||||| |||||||||||||||||
Sbjct: 56808 attacatatatatgtatatgctat 56785



to top

>gb|AC093848.2| Homo sapiens BAC clone RP11-486G21 from 4, complete sequence
          Length = 175064

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 116    aataaaaatgaaaagggaaacaaa 139
              ||||||||||| ||||||||||||
Sbjct: 124644 aataaaaatgataagggaaacaaa 124667



to top

>gb|AC034154.6| Homo sapiens BAC clone RP11-242D9 from 4, complete sequence
          Length = 210563

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   acatatatgtatatgctata 197
             ||||||||||||||||||||
Sbjct: 17357 acatatatgtatatgctata 17338



to top

>gb|AC172372.2| Pan troglodytes BAC clone CH251-1067L6 from chromosome y, complete
             sequence
          Length = 192570

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   agaaaatcagaaaggaaatt 175
             ||||||||||||||||||||
Sbjct: 61916 agaaaatcagaaaggaaatt 61897



 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   agaaaatcagaaaggaaatt 175
             ||||||||||||||||||||
Sbjct: 48088 agaaaatcagaaaggaaatt 48107



to top

>gb|AC080172.5| Homo sapiens chromosome 11, clone CTC-790M5, complete sequence
          Length = 152435

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    aataaaaatgaaaagggaaa 135
              ||||||||||||||||||||
Sbjct: 143218 aataaaaatgaaaagggaaa 143199



to top

>emb|BX649412.8| Zebrafish DNA sequence from clone DKEY-116G10 in linkage group 1,
             complete sequence
          Length = 78932

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 100   gacaatgaatagacataataaaaa 123
             ||||||||||||||| ||||||||
Sbjct: 36559 gacaatgaatagacagaataaaaa 36536



to top

>gb|AC012378.10| Homo sapiens chromosome 15 clone RP11-420M1 map 15q21.3, complete
             sequence
          Length = 199289

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   aataaaaatgaaaagggaaa 135
             ||||||||||||||||||||
Sbjct: 82794 aataaaaatgaaaagggaaa 82775



to top

>emb|BX004804.10| Zebrafish DNA sequence from clone CH211-39M5 in linkage group 5, complete
              sequence
          Length = 170010

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 100    gacaatgaatagacataataaaaa 123
              |||| |||||||||||||||||||
Sbjct: 146952 gacactgaatagacataataaaaa 146975



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 14       tttgattgatgtagtacata 33
                ||||||||||||||||||||
Sbjct: 15435257 tttgattgatgtagtacata 15435276



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 115      taataaaaatgaaaagggaaacaa 138
                |||||||||||||||||| |||||
Sbjct: 11611954 taataaaaatgaaaaggggaacaa 11611931



to top

>gb|AC008364.5|AC008364 Drosophila melanogaster, chromosome 3R, region 92D-92D, BAC clone
              BACR09G02, complete sequence
          Length = 166642

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 114    ataataaaaatgaaaagggaaaca 137
              ||||||||||||||||| ||||||
Sbjct: 115617 ataataaaaatgaaaagagaaaca 115594



to top

>gb|AC092609.2| Homo sapiens BAC clone RP11-160A16 from 4, complete sequence
          Length = 150751

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   attacacatatatgtatatg 192
             ||||||||||||||||||||
Sbjct: 77678 attacacatatatgtatatg 77659



to top

>gb|AC154582.2| Mus musculus BAC clone RP23-381N7 from chromosome 12, complete sequence
          Length = 194302

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    attacacatatatgtatatg 192
              ||||||||||||||||||||
Sbjct: 121904 attacacatatatgtatatg 121885



to top

>gb|AC023894.21| Homo sapiens 3 BAC RP11-261D23 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 4001

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 172  aattacacatatatgtatatgctataaa 199
            ||||||| |||||| |||||||||||||
Sbjct: 3432 aattacatatatatttatatgctataaa 3459



to top

>gb|AC026348.23| Homo sapiens 3 BAC RP11-553D4 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 104159

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 172  aattacacatatatgtatatgctataaa 199
            ||||||| |||||| |||||||||||||
Sbjct: 1431 aattacatatatatttatatgctataaa 1458



to top

>gb|AC172373.3| Pan troglodytes BAC clone CH251-1081D19 from chromosome y, complete
            sequence
          Length = 194913

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  agaaaatcagaaaggaaatt 175
            ||||||||||||||||||||
Sbjct: 5879 agaaaatcagaaaggaaatt 5860



to top

>gb|AC090983.13| Homo sapiens chromosome 15, clone RP11-385H1, complete sequence
          Length = 203244

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   catatatgtatatgctataa 198
             ||||||||||||||||||||
Sbjct: 23568 catatatgtatatgctataa 23549



to top

>gb|AC090602.16| Homo sapiens chromosome 15, clone RP11-125E1, complete sequence
          Length = 174707

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   catatatgtatatgctataa 198
             ||||||||||||||||||||
Sbjct: 64218 catatatgtatatgctataa 64237



to top

>gb|AY957562.1| Bombina orientalis mitochondrion, complete genome
          Length = 17173

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   aaattacacatatatgtata 190
             ||||||||||||||||||||
Sbjct: 17088 aaattacacatatatgtata 17069



to top

>gb|AC027045.21| Homo sapiens chromosome 17, clone RP11-477N12, complete sequence
          Length = 188646

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   atagacataataaaaatgaa 127
             ||||||||||||||||||||
Sbjct: 75121 atagacataataaaaatgaa 75140



to top

>gb|AC125041.2| Mus musculus BAC clone RP23-337J19 from chromosome 12, complete
             sequence
          Length = 202288

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   gaaaatcagaaaggaaatta 176
             ||||||||||||||||||||
Sbjct: 54314 gaaaatcagaaaggaaatta 54295



to top

>gb|AC122918.4| Mus musculus chromosome 6 clone RP23-29F15, complete sequence
          Length = 210315

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 118    taaaaatgaaaagggaaaca 137
              ||||||||||||||||||||
Sbjct: 207560 taaaaatgaaaagggaaaca 207579



to top

>gb|AC004672.1|AC004672 Homo sapiens 12p13.3-0-2.7 BAC RP5-951N9 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 85420

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   aaattacacatatatgtata 190
             ||||||||||||||||||||
Sbjct: 39786 aaattacacatatatgtata 39805



to top

>dbj|AP005836.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBa0013F08
          Length = 166989

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 115    taataaaaatgaaaagggaaacaa 138
              |||||||||||||||||| |||||
Sbjct: 127961 taataaaaatgaaaaggggaacaa 127938



to top

>dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0711F01
          Length = 193091

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 115   taataaaaatgaaaagggaaacaa 138
             |||||||||||||||||| |||||
Sbjct: 46588 taataaaaatgaaaaggggaacaa 46565



to top

>gb|AC155838.7| Mus musculus 6 BAC RP24-441P8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 196288

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    acataataaaaatgaaaagg 131
              ||||||||||||||||||||
Sbjct: 156175 acataataaaaatgaaaagg 156156



to top

>gb|AC002071.1|AC002071 Human PAC clone RP1-2C6 from Xq23, complete sequence
          Length = 63726

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   aatagacataataaaaatga 126
             ||||||||||||||||||||
Sbjct: 37956 aatagacataataaaaatga 37937



to top

>gb|AC115020.11| Mus musculus chromosome 1, clone RP24-231D14, complete sequence
          Length = 188569

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 158   aaaatcagaaaggaaattac 177
             ||||||||||||||||||||
Sbjct: 15850 aaaatcagaaaggaaattac 15869



to top

>gb|AC101703.11| Mus musculus chromosome 1, clone RP23-248B15, complete sequence
          Length = 208984

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   aaaaatgaaaagggaaacaa 138
             ||||||||||||||||||||
Sbjct: 32207 aaaaatgaaaagggaaacaa 32188



to top

>gb|AE003729.3| Drosophila melanogaster chromosome 3R, section 67 of 118 of the complete
              sequence
          Length = 232477

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 114    ataataaaaatgaaaagggaaaca 137
              ||||||||||||||||| ||||||
Sbjct: 185569 ataataaaaatgaaaagagaaaca 185546



to top

>gb|AC174597.2| Mus musculus BAC clone RP24-418F6 from chromosome 6, complete sequence
          Length = 188358

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   taaaaatgaaaagggaaaca 137
             ||||||||||||||||||||
Sbjct: 92718 taaaaatgaaaagggaaaca 92737



to top

>dbj|AP002444.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-262A12, complete
             sequence
          Length = 174558

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   aataaaaatgaaaagggaaa 135
             ||||||||||||||||||||
Sbjct: 22814 aataaaaatgaaaagggaaa 22833



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 14       tttgattgatgtagtacata 33
                ||||||||||||||||||||
Sbjct: 15443498 tttgattgatgtagtacata 15443517



to top

>gb|AC157825.3| Mus musculus BAC clone RP23-230M23 from chromosome 16, complete
             sequence
          Length = 207864

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   acataataaaaatgaaaagg 131
             ||||||||||||||||||||
Sbjct: 58700 acataataaaaatgaaaagg 58719



to top

>emb|CT010565.14| Mouse DNA sequence from clone RP23-263E11 on chromosome 16, complete
             sequence
          Length = 200242

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   acataataaaaatgaaaagg 131
             ||||||||||||||||||||
Sbjct: 41698 acataataaaaatgaaaagg 41679



to top

>gb|AC140368.3| Mus musculus BAC clone RP23-198E1 from 14, complete sequence
          Length = 177084

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   aataaaaatgaaaagggaaa 135
             ||||||||||||||||||||
Sbjct: 75792 aataaaaatgaaaagggaaa 75811



to top

>gb|AY823304.1| Norovirus swine/GII/OH-QW101/03/US RNA-dependent RNA polymerase gene,
            partial cds; and capsid protein and VP2 small basic
            protein genes, complete cds
          Length = 3316

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 120  aaaatgaaaagggaaacaaagata 143
            |||| |||||||||||||||||||
Sbjct: 3300 aaaaggaaaagggaaacaaagata 3277



to top

>gb|DQ267825.1| Dendrocalamopsis oldhamii vacuolar invertase BObetaFRUCT3 mRNA,
            complete cds
          Length = 2155

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 53   atcatggcatcttccactag 72
            ||||||||||||||||||||
Sbjct: 2124 atcatggcatcttccactag 2105



to top

>gb|AC102303.10| Mus musculus chromosome 1, clone RP24-403I11, complete sequence
          Length = 162813

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 102873 aaaaatgaaaagggaaaca 102855



to top

>gb|AC102749.10| Mus musculus chromosome 5, clone RP24-478I4, complete sequence
          Length = 173437

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 15945 aaaaatgaaaagggaaaca 15963



to top

>gb|AC160389.4| Mus musculus chromosome 7, clone RP23-257G13, complete sequence
          Length = 237741

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 175    tacacatatatgtatatgc 193
              |||||||||||||||||||
Sbjct: 134662 tacacatatatgtatatgc 134644



to top

>gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosome 17, complete sequence
          Length = 169205

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 144597 aaatgaaaagggaaacaaa 144615



to top

>gb|AC166932.6| Mus musculus chromosome 7, clone RP23-349I13, complete sequence
          Length = 226889

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 164161 aaatgaaaagggaaacaaa 164143



to top

>gb|AC113065.16| Mus musculus chromosome 7, clone RP23-263E7, complete sequence
          Length = 202134

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 188812 aaatgaaaagggaaacaaa 188830



to top

>gb|AC116370.17| Mus musculus chromosome 3, clone RP24-113D8, complete sequence
          Length = 155613

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 121   aaatgaaaagggaaacaaa 139
             |||||||||||||||||||
Sbjct: 52492 aaatgaaaagggaaacaaa 52474



to top

>gb|AE014850.1| Plasmodium falciparum 3D7 chromosome 12, section 7 of 9 of the complete
              sequence
          Length = 250713

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 104    atgaatagacataataaaa 122
              |||||||||||||||||||
Sbjct: 218020 atgaatagacataataaaa 218002



to top

>gb|AC167171.2| Mus musculus BAC clone RP23-409H8 from chromosome 13, complete sequence
          Length = 203840

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 197767 aaatgaaaagggaaacaaa 197785



to top

>gb|AC151601.5| Mus musculus BAC clone RP23-241H10 from chromosome 7, complete sequence
          Length = 187463

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 121   aaatgaaaagggaaacaaa 139
             |||||||||||||||||||
Sbjct: 53459 aaatgaaaagggaaacaaa 53477



to top

>gb|AC006815.2| Caenorhabditis elegans cosmid Y6D11A, complete sequence
          Length = 8452

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 120  aaaatgaaaagggaaacaa 138
            |||||||||||||||||||
Sbjct: 3752 aaaatgaaaagggaaacaa 3734



to top

>gb|AC008348.5| Drosophila melanogaster clone BACR02I11, complete sequence
          Length = 191467

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 179   catatatgtatatgctata 197
             |||||||||||||||||||
Sbjct: 47243 catatatgtatatgctata 47225



to top

>gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome 19, complete
            sequence
          Length = 221043

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 151  tgaggagaaaatcagaaag 169
            |||||||||||||||||||
Sbjct: 4365 tgaggagaaaatcagaaag 4347



to top

>gb|AC149486.1| Populus trichocarpa clone Pop1-8L22, complete sequence
          Length = 66066

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 123   atgaaaagggaaacaaaga 141
             |||||||||||||||||||
Sbjct: 11405 atgaaaagggaaacaaaga 11387



to top

>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome
          Length = 2650701

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      ctgaacaaattgatttgat 19
              |||||||||||||||||||
Sbjct: 718186 ctgaacaaattgatttgat 718168



to top

>gb|AC149575.1| Populus trichocarpa clone Pop1-41G18, complete sequence
          Length = 111678

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 123   atgaaaagggaaacaaaga 141
             |||||||||||||||||||
Sbjct: 74018 atgaaaagggaaacaaaga 74000



to top

>gb|AC148021.2| Mus musculus BAC clone RP23-9A7 from chromosome 19, complete sequence
          Length = 213178

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 179    catatatgtatatgctata 197
              |||||||||||||||||||
Sbjct: 138843 catatatgtatatgctata 138825



to top

>gb|AC126443.3| Mus musculus BAC clone RP23-464J8 from chromosome 7, complete sequence
          Length = 192927

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 173776 aaatgaaaagggaaacaaa 173794



to top

>gb|AC139328.4| Mus musculus BAC clone RP24-299C21 from chromosome Y, complete sequence
          Length = 156740

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 58325 aaaaatgaaaagggaaaca 58343



to top

>gb|AC125395.3| Mus musculus BAC clone RP23-213J1 from chromosome 14, complete
            sequence
          Length = 208938

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 119  aaaaatgaaaagggaaaca 137
            |||||||||||||||||||
Sbjct: 9621 aaaaatgaaaagggaaaca 9639



to top

>gb|AC123075.5| Mus musculus BAC clone RP23-181C16 from chromosome 3, complete sequence
          Length = 198063

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 171   aaattacacatatatgtat 189
             |||||||||||||||||||
Sbjct: 83320 aaattacacatatatgtat 83338



to top

>gb|DQ491003.1| Chlorella virus AR158 ctg_1047243734156 genomic sequence
          Length = 344691

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 121  aaatgaaaagggaaacaaagata 143
            ||||||||| |||||||||||||
Sbjct: 7851 aaatgaaaacggaaacaaagata 7873



to top

>gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorella virus NY2A ctg_13
              genomic sequence
          Length = 368683

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 121    aaatgaaaagggaaacaaagata 143
              ||||||||| |||||||||||||
Sbjct: 360740 aaatgaaaacggaaacaaagata 360718



to top

>gb|AC138667.8| Mus musculus chromosome 14, clone RP24-122H16, complete sequence
          Length = 177623

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 45431 aaaaatgaaaagggaaaca 45413



to top

>gb|AC114593.12| Mus musculus chromosome 14, clone RP23-44B17, complete sequence
          Length = 210843

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 11526 aaaaatgaaaagggaaaca 11544



to top

>gb|AC102008.9| Mus musculus chromosome 7, clone RP24-502L8, complete sequence
          Length = 194538

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 175  tacacatatatgtatatgc 193
            |||||||||||||||||||
Sbjct: 7198 tacacatatatgtatatgc 7180



to top

>gb|AC123719.10| Mus musculus chromosome 13, clone RP23-412A14, complete sequence
          Length = 202533

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 22245 aaaaatgaaaagggaaaca 22227



to top

>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence
          Length = 190888

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 155734 aaaaatgaaaagggaaaca 155716



to top

>gb|AC134439.4| Mus musculus BAC clone RP24-494I18 from chromosome 13, complete sequence
          Length = 133093

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 149    agtgaggagaaaatcagaa 167
              |||||||||||||||||||
Sbjct: 115523 agtgaggagaaaatcagaa 115541



to top

>gb|AC116460.10| Mus musculus chromosome 10, clone RP23-244G12, complete sequence
          Length = 203330

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 198581 aaatgaaaagggaaacaaa 198563



to top

>gb|AC102902.6| Mus musculus chromosome 16, clone RP24-313G10, complete sequence
          Length = 122431

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 108   atagacataataaaaatga 126
             |||||||||||||||||||
Sbjct: 63925 atagacataataaaaatga 63943



to top

>gb|AC146615.2| Mus musculus BAC clone RP23-19K2 from chromosome 14, complete
            sequence
          Length = 192561

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 176  acacatatatgtatatgct 194
            |||||||||||||||||||
Sbjct: 1952 acacatatatgtatatgct 1970



to top

>emb|CR376775.7| Zebrafish DNA sequence from clone CH211-197C5 in linkage group 23,
              complete sequence
          Length = 196846

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 172    aattacacatatatgtata 190
              |||||||||||||||||||
Sbjct: 147679 aattacacatatatgtata 147697



to top

>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete sequence
          Length = 3214944

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 5       acaaattgatttgattgat 23
               |||||||||||||||||||
Sbjct: 2724790 acaaattgatttgattgat 2724808



to top

>emb|CT009478.9| M.truncatula DNA sequence from clone MTH2-106O21 on chromosome 3,
             complete sequence
          Length = 121373

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 112   acataataaaaatgaaaag 130
             |||||||||||||||||||
Sbjct: 88147 acataataaaaatgaaaag 88129



to top

>emb|CR936261.8| Zebrafish DNA sequence from clone DKEY-207A6 in linkage group 5,
             complete sequence
          Length = 106678

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 172   aattacacatatatgtata 190
             |||||||||||||||||||
Sbjct: 18957 aattacacatatatgtata 18975



to top

>gb|AC113470.14| Mus musculus chromosome 9, clone RP23-262N17, complete sequence
          Length = 202838

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 112    acataataaaaatgaaaag 130
              |||||||||||||||||||
Sbjct: 190878 acataataaaaatgaaaag 190896



to top

>emb|BX901899.9| Zebrafish DNA sequence from clone DKEY-255N6 in linkage group 16,
             complete sequence
          Length = 127034

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 103   aatgaatagacataataaaaatgaaaa 129
             |||||||||| ||||||||||| ||||
Sbjct: 61716 aatgaatagaaataataaaaataaaaa 61742



to top

>gb|AC117702.10| Mus musculus chromosome 10, clone RP23-464I2, complete sequence
          Length = 147559

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 133568 aaatgaaaagggaaacaaa 133586



to top

>gb|AC124496.3| Mus musculus BAC clone RP23-471J10 from chromosome 3, complete sequence
          Length = 185141

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 112   acataataaaaatgaaaag 130
             |||||||||||||||||||
Sbjct: 40458 acataataaaaatgaaaag 40440



to top

>gb|AC125098.4| Mus musculus BAC clone RP24-195M13 from chromosome 16, complete
             sequence
          Length = 182685

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   acataataaaaatgaaaag 130
             |||||||||||||||||||
Sbjct: 81027 acataataaaaatgaaaag 81045



to top

>gb|AC141867.4| Mus musculus BAC clone RP24-424E17 from chromosome 19, complete
             sequence
          Length = 126889

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 179   catatatgtatatgctata 197
             |||||||||||||||||||
Sbjct: 10247 catatatgtatatgctata 10265



to top

>gb|AC141329.4| Mus musculus BAC clone RP23-63G7 from chromosome 7, complete sequence
          Length = 153106

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 115    taataaaaatgaaaagggaaacaaaga 141
              |||||||||||||||| |||| |||||
Sbjct: 144743 taataaaaatgaaaagagaaagaaaga 144717



to top

>gb|AC125373.4| Mus musculus BAC clone RP23-379A13 from chromosome 3, complete sequence
          Length = 190760

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 155   gagaaaatcagaaaggaaa 173
             |||||||||||||||||||
Sbjct: 55912 gagaaaatcagaaaggaaa 55930



to top

>gb|AC108797.8| Mus musculus chromosome 3, clone RP23-349M18, complete sequence
          Length = 208211

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 117   ataaaaatgaaaagggaaa 135
             |||||||||||||||||||
Sbjct: 92660 ataaaaatgaaaagggaaa 92678



to top

>gb|AC115805.12| Mus musculus chromosome 10, clone RP23-412P24, complete sequence
          Length = 193434

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 121   aaatgaaaagggaaacaaa 139
             |||||||||||||||||||
Sbjct: 28518 aaatgaaaagggaaacaaa 28536



to top

>gb|AC122480.3| Mus musculus BAC clone RP24-355B22 from chromosome 14, complete sequence
          Length = 164525

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 176    acacatatatgtatatgct 194
              |||||||||||||||||||
Sbjct: 135129 acacatatatgtatatgct 135111



to top

>gb|AC123565.6| Homo sapiens 3 BAC RP11-539J20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 156163

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 114   ataataaaaatgaaaaggg 132
             |||||||||||||||||||
Sbjct: 12176 ataataaaaatgaaaaggg 12194



to top

>gb|AC122517.2| Mus musculus BAC clone RP24-459G24 from chromosome 7, complete sequence
          Length = 186032

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 115    taataaaaatgaaaagggaaacaaaga 141
              |||||||||||||||| |||| |||||
Sbjct: 143052 taataaaaatgaaaagagaaagaaaga 143078



to top

>gb|AC124489.2| Mus musculus BAC clone RP23-453H5 from chromosome 14, complete sequence
          Length = 167067

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 42283 tacacatatatgtatatgc 42265



to top

>gb|AC121611.3| Mus musculus BAC clone RP23-330I2 from chromosome 6, complete sequence
          Length = 197889

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 126   aaaagggaaacaaagatag 144
             |||||||||||||||||||
Sbjct: 16725 aaaagggaaacaaagatag 16743



to top

>gb|AC122925.3| Mus musculus BAC clone RP23-9O19 from 1, complete sequence
          Length = 256751

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 175    tacacatatatgtatatgc 193
              |||||||||||||||||||
Sbjct: 212204 tacacatatatgtatatgc 212222



to top

>gb|AC122830.4| Mus musculus BAC clone RP23-224I23 from 8, complete sequence
          Length = 257003

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 90558 aaaaatgaaaagggaaaca 90540



to top

>gb|AC122320.4| Mus musculus BAC clone RP23-315F17 from 14, complete sequence
          Length = 197655

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 116003 aaatgaaaagggaaacaaa 116021



to top

>gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, complete sequence
          Length = 192100

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 131486 aaaaatgaaaagggaaaca 131504



to top

>gb|AC117185.2| Mus musculus BAC clone RP23-37M7 from 8, complete sequence
          Length = 188791

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 130958 aaaaatgaaaagggaaaca 130940



to top

>gb|AC122884.2| Mus musculus BAC clone RP23-88O13 from 5, complete sequence
          Length = 160295

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 175  tacacatatatgtatatgc 193
            |||||||||||||||||||
Sbjct: 7993 tacacatatatgtatatgc 7975



to top

>gb|AC122012.3| Mus musculus BAC clone RP24-353N4 from 5, complete sequence
          Length = 188867

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 115   taataaaaatgaaaaggga 133
             |||||||||||||||||||
Sbjct: 51341 taataaaaatgaaaaggga 51323



to top

>gb|AC111007.4| Mus musculus BAC clone RP23-226I10 from 3, complete sequence
          Length = 176259

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 130537 aaaaatgaaaagggaaaca 130555



to top

>gb|AC098737.3| Mus musculus BAC clone RP23-122D16 from 1, complete sequence
          Length = 212615

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 115   taataaaaatgaaaaggga 133
             |||||||||||||||||||
Sbjct: 52646 taataaaaatgaaaaggga 52664



to top

>gb|AC004926.2| Homo sapiens PAC clone RP5-910H9 from 7, complete sequence
          Length = 153556

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 180   atatatgtatatgctataa 198
             |||||||||||||||||||
Sbjct: 86541 atatatgtatatgctataa 86523



to top

>ref|XM_721871.1| Plasmodium yoelii yoelii str. 17XNL CCAAT-box DNA binding protein
            subunit B (PY06331) partial mRNA
          Length = 2762

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 107  aatagacataataaaaatgaaaa 129
            |||||| ||||||||||||||||
Sbjct: 2671 aatagaaataataaaaatgaaaa 2693



to top

>ref|XM_720836.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05467)
           partial mRNA
          Length = 1530

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 115 taataaaaatgaaaaggga 133
           |||||||||||||||||||
Sbjct: 644 taataaaaatgaaaaggga 662



to top

>ref|XM_960904.1| Plasmodium falciparum 3D7 hypothetical protein (PFF0010w) partial
            mRNA
          Length = 8640

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 104  atgaatagacataataaaa 122
            |||||||||||||||||||
Sbjct: 7953 atgaatagacataataaaa 7935



to top

>ref|XM_961212.1| Plasmodium falciparum 3D7 erythrocyte membrane protein 1 (VAR) partial
             mRNA
          Length = 11865

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 104   atgaatagacataataaaa 122
             |||||||||||||||||||
Sbjct: 10932 atgaatagacataataaaa 10914



to top

>gb|AC073133.9| Homo sapiens BAC clone RP11-691F21 from 7, complete sequence
          Length = 95280

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 174   ttacacatatatgtatatg 192
             |||||||||||||||||||
Sbjct: 28283 ttacacatatatgtatatg 28301



to top

>gb|AC078848.3| Homo sapiens BAC clone CTD-2220I23 from 7, complete sequence
          Length = 134778

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 107   aatagacataataaaaatg 125
             |||||||||||||||||||
Sbjct: 35104 aatagacataataaaaatg 35086



to top

>ref|XM_730932.1| Plasmodium chabaudi chabaudi hypothetical protein (PC107346.00.0)
           partial mRNA
          Length = 261

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 158 aaaatcagaaaggaaatta 176
           |||||||||||||||||||
Sbjct: 117 aaaatcagaaaggaaatta 99



to top

>gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, complete sequence
          Length = 207293

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 173   attacacatatatgtatat 191
             |||||||||||||||||||
Sbjct: 96854 attacacatatatgtatat 96836



to top

>gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, complete sequence
          Length = 240406

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 198699 aaatgaaaagggaaacaaa 198681



to top

>gb|AC122722.7| Medicago truncatula clone mth1-3f12, complete sequence
          Length = 116833

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 112   acataataaaaatgaaaag 130
             |||||||||||||||||||
Sbjct: 63763 acataataaaaatgaaaag 63745



to top

>gb|AC148405.5| Medicago truncatula clone mth2-37m7, complete sequence
          Length = 115984

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 112   acataataaaaatgaaaag 130
             |||||||||||||||||||
Sbjct: 33981 acataataaaaatgaaaag 33963



to top

>gb|AC109253.9| Mus musculus, clone RP23-351D8, complete sequence
          Length = 254578

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 123   atgaaaagggaaacaaaga 141
             |||||||||||||||||||
Sbjct: 40800 atgaaaagggaaacaaaga 40782



to top

>gb|BT025041.1| Drosophila melanogaster LD15160 full insert cDNA
          Length = 5558

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 171  aaattacacatatatgtat 189
            |||||||||||||||||||
Sbjct: 5373 aaattacacatatatgtat 5391



to top

>emb|AL627107.32| Human DNA sequence from clone XXyac-R12DG2 on chromosome 13 Contains 2
             novel genes, a calumenin (CALU) pseudogene, a novel gene
             (possible ortholog of RIKEN cDNA 4933433D23 gene) and a
             CpG island, complete sequence
          Length = 79018

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 153   aggagaaaatcagaaagga 171
             |||||||||||||||||||
Sbjct: 11639 aggagaaaatcagaaagga 11621



to top

>gb|BC112569.1| Bos taurus hypothetical protein LOC523894, mRNA (cDNA clone
           MGC:137118 IMAGE:8028093), complete cds
          Length = 1437

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 157 gaaaatcagaaaggaaatt 175
           |||||||||||||||||||
Sbjct: 185 gaaaatcagaaaggaaatt 203



to top

>emb|AL592044.4| Human DNA sequence from clone RP13-407F1 on chromosome 13, complete
             sequence
          Length = 236130

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 70290 tacacatatatgtatatgc 70308



to top

>emb|AL590009.10| Human DNA sequence from clone RP11-181P4 on chromosome 6 Contains the
              WASF1 gene for WAS protein family member 1 and part of the
              FLJ31482 gene, complete sequence
          Length = 153046

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 158    aaaatcagaaaggaaatta 176
              |||||||||||||||||||
Sbjct: 139288 aaaatcagaaaggaaatta 139306



to top

>emb|AL583807.20| Human DNA sequence from clone RP11-105C7 on chromosome 9 Contains the
             5' end of the LAMC3 gene for laminin gamma 3 and a CpG
             island, complete sequence
          Length = 92607

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 182   atatgtatatgctataaaa 200
             |||||||||||||||||||
Sbjct: 52586 atatgtatatgctataaaa 52604



to top

>emb|AL513332.9| Human DNA sequence from clone RP11-58B8 on chromosome 9, complete
            sequence
          Length = 124531

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 175  tacacatatatgtatatgctata 197
            ||||||||||||||||| |||||
Sbjct: 8946 tacacatatatgtatatactata 8924



to top

>emb|AL450337.24| Human DNA sequence from clone RP11-51B10 on chromosome 10 Contains the 5'
              end of the PARD3 gene for par-3 partitioning defective 3
              homolog (C.elegans), a novel gene, a pseudogene similar to
              part of synovial sarcoma translocation, chromosome 18
              protein (SS18), a peroxiredoxin 2 (PRDX2) pseudogene and a
              CpG island, complete sequence
          Length = 173987

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 180    atatatgtatatgctataa 198
              |||||||||||||||||||
Sbjct: 116567 atatatgtatatgctataa 116585



to top

>emb|AL391001.12| Human DNA sequence from clone RP11-477H21 on chromosome 1 Contains part
             of the PBX1 gene for pre-B-cell leukemia transcription
             factor 1, complete sequence
          Length = 196730

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 123   atgaaaagggaaacaaaga 141
             |||||||||||||||||||
Sbjct: 32665 atgaaaagggaaacaaaga 32647



to top

>emb|AL359388.32| Human DNA sequence from clone RP11-445I23 on chromosome 10 Contains the
             5' end of the MMS19L gene for MMS19-like (MET18 homolog,
             S. cerevisiae), the gene for a novel protein (FLJ11807),
             the 5' end of the ANKRD2 gene for ankyrin repeat domain 2
             (stretch responsive muscle) and two CpG islands, complete
             sequence
          Length = 86299

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 106   gaatagacataataaaaatgaaa 128
             |||||||| ||||||||||||||
Sbjct: 76918 gaatagacctaataaaaatgaaa 76940



to top

>gb|AE014818.1| Plasmodium falciparum 3D7 chromosome 14 section 3 of 13 of the complete
              sequence
          Length = 252632

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 173    attacacatatatgtatat 191
              |||||||||||||||||||
Sbjct: 158543 attacacatatatgtatat 158561



to top

>emb|AL357353.12| Human DNA sequence from clone RP11-251L16 on chromosome 10, complete
             sequence
          Length = 129800

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Plus

                                        
Query: 174   ttacacatatatgta-tatgctataaa 199
             ||||||||||||||| |||||||||||
Sbjct: 33878 ttacacatatatgtattatgctataaa 33904



to top

>emb|AL356579.24| Human DNA sequence from clone RP11-593A16 on chromosome 6 Contains the
             5' end of the gene for KIAA1798 protein and a CpG island,
             complete sequence
          Length = 172816

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 173   attacacatatatgtatat 191
             |||||||||||||||||||
Sbjct: 86049 attacacatatatgtatat 86067



to top

>gb|AC098690.3| Homo sapiens chromosome 1 clone RP11-507I14, complete sequence
          Length = 128000

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 29718 tacacatatatgtatatgc 29736



to top

>gb|AC111653.8| Rattus norvegicus 2 BAC CH230-108E11 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 247105

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 178    acatatatgtatatgctat 196
              |||||||||||||||||||
Sbjct: 112984 acatatatgtatatgctat 113002



to top

>emb|AL162723.12| Human DNA sequence from clone RP13-428K23 on chromosome X, complete
              sequence
          Length = 192780

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 107    aatagacataataaaaatgaaaa 129
              |||||||| ||||||||||||||
Sbjct: 100189 aatagacacaataaaaatgaaaa 100211



to top

>emb|AL353143.14| Human DNA sequence from clone RP11-383F12 on chromosome 13 Contains part
              of a novel gene (including KIAA0865), possible ortholog of
              rat myosin heavy chain Myr 8 (Loc192253) and a novel gene,
              complete sequence
          Length = 170276

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 152    gaggagaaaatcagaaaggaaat 174
              |||||||||| ||||||||||||
Sbjct: 125699 gaggagaaaaccagaaaggaaat 125677



to top

>emb|AL354793.11| Human DNA sequence from clone RP11-431N15 on chromosome Xp11.1-11.22
             Contains the UBQLN2 gene for ubiquilin 2, a novel gene and
             a CpG island, complete sequence
          Length = 180504

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 107   aatagacataataaaaatgaaaa 129
             |||||||| ||||||||||||||
Sbjct: 66513 aatagacacaataaaaatgaaaa 66491



to top

>emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on chromosome 9 Contains the
             5' end of the ABO gene for ABO blood group (transferase A
             alpha 1-3-N-acetylgalactosaminyltransferase; transferase B
             alpha 1-3-galactosyltransferase) pseudogene ABO-*O02
             allele, the gene for a novel protein similar to lipocalin
             1 (protein migrating faster than albumin tear prealbumin)
             (LCN1), a ribosomal protein L21 (RPL21) pseudogene, the
             RPL7A gene for ribosomal protein L7a, a novel gene
             (MGC43306), the XPMC2H gene for Xenopus prevents mitotic
             catastrophe 2 homolog, the 5' end of the ADAMTS13 gene for
             a disintegrin-like and metalloprotease (reprolysin type)
             with thrombospondin type 1 motif 13, the SURF1 gene for
             surfeit 1, the SURF2 gene for surfeit 2, the SURF4 gene
             for surfeit 4, the SURF5 gene for surfeit 5, the SURF6
             gene for surfeit 6 and eight CpG islands, complete
             sequence
          Length = 184513

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 121   aaatgaaaagggaaacaaa 139
             |||||||||||||||||||
Sbjct: 37903 aaatgaaaagggaaacaaa 37921



to top

>emb|AL158167.15| Human DNA sequence from clone RP11-534G20 on chromosome 10 Contains two
             novel genes and the 3' end of the SVIL gene for
             supervillin (archvillin) and a CpG island, complete
             sequence
          Length = 227744

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 156   agaaaatcagaaaggaaat 174
             |||||||||||||||||||
Sbjct: 11020 agaaaatcagaaaggaaat 11002



to top

>emb|AL139294.15| Human DNA sequence from clone RP5-1044H5 on chromosome 1p31.2-32.3
             Contains the 5' end of the DNAJC6 gene for DnaJ (Hsp40)
             homolog subfamily C member 6, a novel gene and a
             cytochrome c oxidase subunit VIc (COX6C) pseudogene,
             complete sequence
          Length = 93614

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 174   ttacacatatatgtatatg 192
             |||||||||||||||||||
Sbjct: 65961 ttacacatatatgtatatg 65979



to top

>emb|AL135913.8| Human DNA sequence from clone RP1-44I20 on chromosome 6, complete
            sequence
          Length = 44006

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 104  atgaatagacataataaaaatga 126
            ||||||| |||||||||||||||
Sbjct: 3056 atgaatatacataataaaaatga 3034



to top

>emb|AL138813.8| Human DNA sequence from clone RP1-305K11 on chromosome 11p13-14.2
             Contains STSs and GSSs, complete sequence
          Length = 76738

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 173   attacacatatatgtatat 191
             |||||||||||||||||||
Sbjct: 62950 attacacatatatgtatat 62932



to top

>emb|AL136324.6| Human DNA sequence from clone RP5-944H6 on chromosome 1p22.3-31.2
             Contains the 3' end of the PTGFR gene for prostaglandin,
             complete sequence
          Length = 135758

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   acataataaaaatgaaaag 130
             |||||||||||||||||||
Sbjct: 48930 acataataaaaatgaaaag 48948



to top

>emb|AL135929.5| Human DNA sequence from clone RP4-801G22 on chromosome 1q21.2-22
             Contains the 5' end of the gene for immunoglobulin
             superfamily receptor translocation associated 2 (IRTA2),
             the gene for immunoglobulin superfamily receptor
             translocation associated 1 (IRTA1) and two pseudogenes
             similar to part of a Fc receptor-like protein, complete
             sequence
          Length = 97146

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 67926 tacacatatatgtatatgc 67944



to top

>gb|AC124784.4| Homo sapiens 12 BAC RP11-461F16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 144000

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 123   atgaaaagggaaacaaaga 141
             |||||||||||||||||||
Sbjct: 83246 atgaaaagggaaacaaaga 83228



to top

>emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I13 on chromosome Xq23-25 Contains
             an alpha tubulin pseudogene, complete sequence
          Length = 122400

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 34286 tacacatatatgtatatgc 34304



 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 34250 tacacatatatgtatatgc 34268



to top

>emb|AL096803.8|HSBG304P7 Human DNA sequence from clone GS1-304P7 on chromosome 1q25.1-31.1
             Contains a zinc-finger protein pseudogene and a novel
             pseudogene, complete sequence
          Length = 129723

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 24516 tacacatatatgtatatgc 24498



to top

>gb|AC157917.4| Mus musculus chromosome 3, clone RP23-120L6, complete sequence
          Length = 206959

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 87125 aaaaatgaaaagggaaaca 87143



to top

>gb|AC158149.3| Mus musculus chromosome 5, clone RP24-296L6, complete sequence
          Length = 155517

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 95780 tacacatatatgtatatgc 95762



to top

>emb|AL009047.1|HS1156N12 Human DNA sequence from clone RP5-1156N12 on chromosome X, complete
              sequence
          Length = 146360

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 107    aatagacataataaaaatgaaaa 129
              |||||||| ||||||||||||||
Sbjct: 144673 aatagacacaataaaaatgaaaa 144695



to top

>gb|AC133796.2| Homo sapiens 3 BAC RP11-10I2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 125170

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 34215 tacacatatatgtatatgc 34233



to top

>gb|AC130388.6| Drosophila melanogaster X BAC CH221-14P20 (Children's Hospital Oakland
             Research Institute Drosophila melanogaster sheared DNA BAC
             Library) complete sequence
          Length = 117795

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 171   aaattacacatatatgtat 189
             |||||||||||||||||||
Sbjct: 44545 aaattacacatatatgtat 44563



to top

>gb|AC023714.5| Drosophila melanogaster X BAC RP98-19D19 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 160100

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 171    aaattacacatatatgtat 189
              |||||||||||||||||||
Sbjct: 157404 aaattacacatatatgtat 157386



to top

>gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, RP23-366C17, Complete
            Sequence, complete sequence
          Length = 217768

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 174  ttacacatatatgtatatg 192
            |||||||||||||||||||
Sbjct: 4510 ttacacatatatgtatatg 4492



to top

>emb|CR382401.1| Plasmodium falciparum chromosome 6, complete sequence; segment 4/5
          Length = 337203

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 104    atgaatagacataataaaa 122
              |||||||||||||||||||
Sbjct: 309405 atgaatagacataataaaa 309423



to top

>emb|AL035477.6|PFMAL4P4 Plasmodium falciparum MAL4P4
          Length = 272698

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 104    atgaatagacataataaaa 122
              |||||||||||||||||||
Sbjct: 246014 atgaatagacataataaaa 246032



to top

>emb|AL034560.3|PFMAL3P8 Plasmodium falciparum MAL3P8, complete sequence
          Length = 108908

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 104   atgaatagacataataaaa 122
             |||||||||||||||||||
Sbjct: 40456 atgaatagacataataaaa 40438



to top

>gb|AC156575.3| Mus musculus BAC clone RP23-4P20 from chromosome 13, complete sequence
          Length = 196560

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 23228 aaaaatgaaaagggaaaca 23246



to top

>gb|AC160756.7| Mus musculus chromosome 15, clone RP23-158H4, complete sequence
          Length = 194707

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 71008 aaaaatgaaaagggaaaca 70990



to top

>emb|CR382291.11| Zebrafish DNA sequence from clone CH211-245G10, complete sequence
          Length = 159807

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 68    actagctcaactacaactt 86
             |||||||||||||||||||
Sbjct: 98736 actagctcaactacaactt 98718



to top

>emb|AL669833.7| Mouse DNA sequence from clone RP23-51C16 on chromosome 11, complete
            sequence
          Length = 48352

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 119  aaaaatgaaaagggaaaca 137
            |||||||||||||||||||
Sbjct: 7520 aaaaatgaaaagggaaaca 7502



to top

>emb|AL929002.4| Mouse DNA sequence from clone RP23-369A3 on chromosome 11, complete
             sequence
          Length = 50526

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 11243 aaaaatgaaaagggaaaca 11261



to top

>emb|AL592465.8| Mouse DNA sequence from clone RP23-36C4 on chromosome 11 Contains the
            Tbx4 gene for T-box 4, a ribosomal protein L21 (Rpl21)
            pseudogene and the 3' end of the Brip1 gene for BRCA1
            interacting protein C-terminal helicase 1, complete
            sequence
          Length = 238358

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  aataaaaatgaaaagggaa 134
            |||||||||||||||||||
Sbjct: 2870 aataaaaatgaaaagggaa 2852



to top

>emb|AL672260.25| Mouse DNA sequence from clone DN-127L1 on chromosome 3 Contains a
             Saccharomyces cerevisiae Nip7p homolog (pEachy) homolog
             pseudogene, a tumor protein translationally-controlled 1
             (Tpt1) pseudogene, a high mobility group box 2 (Hmgb2)
             pseudogene and the Cd2 gene for CD2 antigen, complete
             sequence
          Length = 169010

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 85183 tacacatatatgtatatgc 85165



to top

>gb|AC087301.8| Homo sapiens chromosome 17, clone RP11-661C3, complete sequence
          Length = 229153

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 37192 tacacatatatgtatatgc 37174



to top

>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence
          Length = 202719

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 101013 aaaaatgaaaagggaaaca 100995



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 111     gacataataaaaatgaaaa 129
               |||||||||||||||||||
Sbjct: 2098766 gacataataaaaatgaaaa 2098784



to top

>gb|AC116529.16| Mus musculus chromosome 8, clone RP24-380O18, complete sequence
          Length = 166863

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 158   aaaatcagaaaggaaattacaca 180
             |||||||||||| ||||||||||
Sbjct: 31440 aaaatcagaaagcaaattacaca 31418



to top

>emb|AL683883.26| Mouse DNA sequence from clone RP23-361B8 on chromosome X, complete
             sequence
          Length = 190863

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 121   aaatgaaaagggaaacaaa 139
             |||||||||||||||||||
Sbjct: 44747 aaatgaaaagggaaacaaa 44729



to top

>gb|AC156991.9| Mus musculus chromosome 8, clone RP23-297F23, complete sequence
          Length = 164343

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 10930 tacacatatatgtatatgc 10948



to top

>gb|AC162943.2| Mus musculus BAC clone RP23-76K9 from chromosome 16, complete sequence
          Length = 184984

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 117    ataaaaatgaaaagggaaa 135
              |||||||||||||||||||
Sbjct: 125420 ataaaaatgaaaagggaaa 125438



to top

>gb|AC012295.20| Mus musculus chromosome 11, clone RP23-48A17, complete sequence
          Length = 187364

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 116   aataaaaatgaaaagggaa 134
             |||||||||||||||||||
Sbjct: 56314 aataaaaatgaaaagggaa 56296



to top

>dbj|AK022093.1| Homo sapiens cDNA FLJ12031 fis, clone HEMBB1001874
          Length = 1759

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 123 atgaaaagggaaacaaaga 141
           |||||||||||||||||||
Sbjct: 147 atgaaaagggaaacaaaga 165



to top

>emb|AL929036.8| Mouse DNA sequence from clone RP24-548P4 on chromosome 2, complete
             sequence
          Length = 100285

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 45356 aaaaatgaaaagggaaaca 45338



to top

>ref|NM_206620.3| Drosophila melanogaster Tousled-like kinase CG32782-RD, transcript
            variant D (tlk), mRNA
          Length = 6283

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 171  aaattacacatatatgtat 189
            |||||||||||||||||||
Sbjct: 5418 aaattacacatatatgtat 5436



to top

>gb|AF434765.1| Mus musculus fatty acid translocase (Cd36) gene, downstream promoter
            region and 5' UTR
          Length = 6396

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 173  attacacatatatgtatat 191
            |||||||||||||||||||
Sbjct: 2119 attacacatatatgtatat 2137



to top

>gb|AC090179.4| Homo sapiens chromosome 15, clone RP11-236J21, complete sequence
          Length = 161586

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 174    ttacacatatatgtatatg 192
              |||||||||||||||||||
Sbjct: 119105 ttacacatatatgtatatg 119123



to top

>gb|AC022106.5| Homo sapiens chromosome 5 clone CTC-311G1, complete sequence
          Length = 149790

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 104   atgaatagacataataaaa 122
             |||||||||||||||||||
Sbjct: 25715 atgaatagacataataaaa 25697



to top

>dbj|AK138435.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230106L07
           product:unclassifiable, full insert sequence
          Length = 3558

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 175 tacacatatatgtatatgc 193
           |||||||||||||||||||
Sbjct: 347 tacacatatatgtatatgc 329



to top

>gb|AC157786.7| Mus musculus chromosome 1, clone RP23-280O23, complete sequence
          Length = 205264

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 20252 aaaaatgaaaagggaaaca 20270



to top

>gb|AC100783.2| Homo sapiens chromosome 18, clone RP11-141I4, complete sequence
          Length = 149913

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 180    atatatgtatatgctataa 198
              |||||||||||||||||||
Sbjct: 139741 atatatgtatatgctataa 139723



to top

>gb|AC090751.9| Homo sapiens chromosome 15, clone RP11-331H13, complete sequence
          Length = 207888

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 174   ttacacatatatgtatatg 192
             |||||||||||||||||||
Sbjct: 23914 ttacacatatatgtatatg 23932



to top

>gb|AC093154.2| Homo sapiens chromosome 1 clone RP3-445O10, complete sequence
          Length = 145658

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 173   attacacatatatgtatat 191
             |||||||||||||||||||
Sbjct: 20054 attacacatatatgtatat 20036



to top

>gb|AC166644.7| Mus musculus chromosome 1, clone RP23-375C6, complete sequence
          Length = 175851

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 173   attacacatatatgtatat 191
             |||||||||||||||||||
Sbjct: 36050 attacacatatatgtatat 36032



to top

>gb|AC099015.1| Drosophila melanogaster, chromosome 2R, region 48C-49A, BAC clone
              BACR26P21, complete sequence
          Length = 157010

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 173    attacacatatatgtatat 191
              |||||||||||||||||||
Sbjct: 100464 attacacatatatgtatat 100446



to top

>ref|NM_001031761.2| Bos taurus hypothetical protein LOC523894 (LOC523894), mRNA
          Length = 1437

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 157 gaaaatcagaaaggaaatt 175
           |||||||||||||||||||
Sbjct: 185 gaaaatcagaaaggaaatt 203



to top

>emb|AL772373.23| Zebrafish DNA sequence from clone CH211-143A22 in linkage group 14,
              complete sequence
          Length = 185265

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     actagctcaactacaactt 86
              |||||||||||||||||||
Sbjct: 106058 actagctcaactacaactt 106076



to top

>gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosome 3, complete sequence
          Length = 200393

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 157262 aaaaatgaaaagggaaaca 157244



to top

>gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206191

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 121    aaatgaaaagggaaacaaa 139
              |||||||||||||||||||
Sbjct: 148759 aaatgaaaagggaaacaaa 148777



to top

>gb|AC010441.6| Homo sapiens chromosome 5 clone CTD-2228J3, complete sequence
          Length = 157076

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 104   atgaatagacataataaaa 122
             |||||||||||||||||||
Sbjct: 22468 atgaatagacataataaaa 22486



to top

>gb|AC130669.17| Mus musculus chromosome 15, clone RP24-84O5, complete sequence
          Length = 205231

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 119   aaaaatgaaaagggaaaca 137
             |||||||||||||||||||
Sbjct: 39507 aaaaatgaaaagggaaaca 39525



to top

>gb|AC010482.8| Homo sapiens chromosome 5 clone CTD-2318J2, complete sequence
          Length = 203278

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 99    tgacaatgaatagacataataaaaatg 125
             ||||| |||||||||||||| ||||||
Sbjct: 94850 tgacattgaatagacataatcaaaatg 94824



to top

>gb|AC153650.4| Mus musculus BAC clone RP24-93I18 from chromosome 1, complete sequence
          Length = 199753

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 175    tacacatatatgtatatgc 193
              |||||||||||||||||||
Sbjct: 113775 tacacatatatgtatatgc 113793



to top

>gb|AC157557.5| Mus musculus chromosome 7, clone RP24-369M22, complete sequence
          Length = 202543

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 175   tacacatatatgtatatgc 193
             |||||||||||||||||||
Sbjct: 86838 tacacatatatgtatatgc 86856



to top

>gb|AC023118.4|AC023118 Homo sapiens BAC clone RP11-277L22 from 11, complete sequence
          Length = 154330

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 178    acatatatgtatatgctat 196
              |||||||||||||||||||
Sbjct: 151403 acatatatgtatatgctat 151421



to top

>gb|AC153527.9| Mus musculus 10 BAC RP23-320A6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 205006

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 119    aaaaatgaaaagggaaaca 137
              |||||||||||||||||||
Sbjct: 169582 aaaaatgaaaagggaaaca 169600


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,841,326
Number of Sequences: 3902068
Number of extensions: 3841326
Number of successful extensions: 407060
Number of sequences better than 10.0: 373
Number of HSP's better than 10.0 without gapping: 370
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 403509
Number of HSP's gapped (non-prelim): 3554
length of query: 200
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 178
effective length of database: 17,147,199,772
effective search space: 3052201559416
effective search space used: 3052201559416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top