ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet53d09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U08135.1|HVU08135 Hordeum vulgare photosystem-I PSI-F subunit... 258 4e-66
2ref|NM_184976.1| Oryza sativa (japonica cultivar-group), mRNA 62 5e-07
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 62 5e-07
4gb|AC084748.11| Oryza sativa chromosome 3 BAC OSJNBa0010I09 geno... 62 5e-07
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 62 5e-07
6dbj|AK069791.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 5e-07
7dbj|AK060493.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 5e-07
8dbj|AK059890.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 5e-07
9gb|AF093634.1|AF093634 Oryza sativa photosystem-1 F subunit prec... 62 5e-07
10gb|AC026866.8| Homo sapiens BAC clone RP11-420P20 from 7, comple... 42 0.43
11gb|AC140949.1| Pan troglodytes BAC clone RP43-168N2 from 7, comp... 42 0.43
12emb|AL513210.32| Human DNA sequence from clone RP11-35J6 on chro... 42 0.43
13gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's H... 40 1.7
14emb|AL445928.8| Human DNA sequence from clone RP11-305E17 on chr... 40 1.7
15emb|Z99111.2|BSUB0008 Bacillus subtilis complete genome (section... 40 1.7
16emb|AJ222587.1|BS16829KB Bacillus subtilis 29kB DNA fragment fro... 40 1.7
17gb|AC087698.5| Homo sapiens chromosome 8, clone RP11-25K19, comp... 40 1.7
18gb|AC105282.5| Homo sapiens chromosome 18, clone RP11-452F20, co... 40 1.7
19gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, comp... 40 1.7
20emb|AL513406.1|CNS07EFT Human DNA sequence chromosome 8 of Homo ... 40 1.7
21gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 40 1.7
22emb|AL389894.4|LMFLCHR4A Leishmania major Friedlin chromosome 4,... 38 6.7
23gb|AC034195.7| Homo sapiens chromosome 3 clone RP11-673F20 map 3... 38 6.7
24emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 38 6.7
25gb|AC129471.1| Homo sapiens chromosome 5 clone RP11-352J21, comp... 38 6.7
26emb|AL137251.5| Human DNA sequence from clone RP1-141N5 on chrom... 38 6.7
27emb|AL031433.4|HS171N11 Human DNA sequence from clone RP1-171N11... 38 6.7
28gb|AC009635.5| Homo sapiens chromosome 8, clone RP11-21J9, compl... 38 6.7
29gb|AC120797.9| Mus musculus chromosome 18, clone RP24-81D18, com... 38 6.7
30gb|AC104320.2| Homo sapiens chromosome 8 clone CTD-2204N4 map 8p... 38 6.7
31gb|AC145821.16| Papio anubis clone rp41-103i16, complete sequence 38 6.7
32gb|AC090740.5| Homo sapiens chromosome 8, clone RP11-595O22, com... 38 6.7
33gb|AC027017.5| Homo sapiens chromosome 8, clone RP11-450M17, com... 38 6.7
34gb|AC016617.6| Homo sapiens chromosome 5 clone CTD-2239O16, comp... 38 6.7
35ref|XM_627368.1| Cryptosporidium parvum Iowa II hypothetical pro... 38 6.7
36gb|AC020784.8| Homo sapiens chromosome 8, clone RP11-82I19, comp... 38 6.7
37gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosom... 38 6.7
38gb|AC026188.6| Homo sapiens chromosome 3 clone RP11-319I18 map 3... 38 6.7
39gb|AC010679.6| Homo sapiens BAC clone RP11-128O11 from 2, comple... 38 6.7
40gb|AC154837.2| Mus musculus BAC clone RP24-576O2 from 14, comple... 38 6.7
41emb|CT571254.7| Mouse DNA sequence from clone RP23-335F6 on chro... 38 6.7
42emb|AL663067.14| Mouse DNA sequence from clone RP23-23G3 on chro... 38 6.7 
>gb|U08135.1|HVU08135 Hordeum vulgare photosystem-I PSI-F subunit precursor mRNA,
           complete cds
          Length = 990

 Score =  258 bits (130), Expect = 4e-66
 Identities = 133/134 (99%)
 Strand = Plus / Minus

                                                                       
Query: 8   ctcaacaatttgaacaatggtaaaatacacacgtgtgaagagagaacacaatagttatac 67
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 977 ctcaacaatttgaacaatggtaaaatacacacatgtgaagagagaacacaatagttatac 918

                                                                       
Query: 68  aagattgggttcagtttcttaaatacaagagaggttccatttctccatgatcctatcagc 127
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 917 aagattgggttcagtttcttaaatacaagagaggttccatttctccatgatcctatcagc 858

                         
Query: 128 tcctacaccaagcc 141
           ||||||||||||||
Sbjct: 857 tcctacaccaagcc 844
to top
>ref|NM_184976.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1038

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 82  tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
           |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 921 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 867
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                       
Query: 82       tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
                |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 31969219 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 31969273
to top
>gb|AC084748.11| Oryza sativa chromosome 3 BAC OSJNBa0010I09 genomic sequence, complete
             sequence
          Length = 144306

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                    
Query: 82    tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
             |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 61171 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 61225
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                       
Query: 82       tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
                |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 32059731 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 32059785
to top
>dbj|AK069791.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023031N02, full
           insert sequence
          Length = 967

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 82  tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
           |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 890 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 836
to top
>dbj|AK060493.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-D02, full
           insert sequence
          Length = 997

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 82  tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
           |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 920 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 866
to top
>dbj|AK059890.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-C12, full
           insert sequence
          Length = 990

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 82  tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
           |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 913 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 859
to top
>gb|AF093634.1|AF093634 Oryza sativa photosystem-1 F subunit precursor (PSI-F) mRNA,
           complete cds
          Length = 996

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 82  tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 136
           |||||||| ||||| |||  ||||||| ||||||||||||||||||| |||||||
Sbjct: 901 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 847
to top
>gb|AC026866.8| Homo sapiens BAC clone RP11-420P20 from 7, complete sequence
          Length = 179438

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 14    aatttgaacaatggtaaaata 34
             |||||||||||||||||||||
Sbjct: 47352 aatttgaacaatggtaaaata 47372
to top
>gb|AC140949.1| Pan troglodytes BAC clone RP43-168N2 from 7, complete sequence
          Length = 193777

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 14     aatttgaacaatggtaaaata 34
              |||||||||||||||||||||
Sbjct: 170684 aatttgaacaatggtaaaata 170704
to top
>emb|AL513210.32| Human DNA sequence from clone RP11-35J6 on chromosome 6 Contains six
             CpG islands, complete sequence
          Length = 157572

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 24    atggtaaaatacacacgtgtgaagagaga 52
             |||||| ||| ||||||||||||||||||
Sbjct: 82334 atggtacaatccacacgtgtgaagagaga 82306
to top
>gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 230137

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    tcttaaatacaagagaggtt 103
             ||||||||||||||||||||
Sbjct: 82654 tcttaaatacaagagaggtt 82673
to top
>emb|AL445928.8| Human DNA sequence from clone RP11-305E17 on chromosome 1, complete
              sequence
          Length = 173580

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 106    atttctccatgatcctatcagctcctac 133
              ||||||||||||||| |||| |||||||
Sbjct: 156375 atttctccatgatccaatcacctcctac 156348
to top
>emb|Z99111.2|BSUB0008 Bacillus subtilis complete genome (section 8 of 21): from 1410943 to
             1602922
          Length = 191980

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     gttcgccctcaacaatttgaacaa 24
             ||||||| ||||||||||||||||
Sbjct: 56251 gttcgccttcaacaatttgaacaa 56228
to top
>emb|AJ222587.1|BS16829KB Bacillus subtilis 29kB DNA fragment from ykwC gene to cse15 gene
          Length = 29324

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 1    gttcgccctcaacaatttgaacaa 24
            ||||||| ||||||||||||||||
Sbjct: 2245 gttcgccttcaacaatttgaacaa 2222
to top
>gb|AC087698.5| Homo sapiens chromosome 8, clone RP11-25K19, complete sequence
          Length = 150750

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    caagattgggttcagtttct 86
             ||||||||||||||||||||
Sbjct: 10979 caagattgggttcagtttct 10998
to top
>gb|AC105282.5| Homo sapiens chromosome 18, clone RP11-452F20, complete sequence
          Length = 167258

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    ggttcagtttcttaaataca 94
             ||||||||||||||||||||
Sbjct: 17437 ggttcagtttcttaaataca 17456
to top
>gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, complete sequence
          Length = 118755

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    caagattgggttcagtttct 86
             ||||||||||||||||||||
Sbjct: 14523 caagattgggttcagtttct 14504
to top
>emb|AL513406.1|CNS07EFT Human DNA sequence chromosome 8 of Homo sapiens (human)
          Length = 204955

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     caagattgggttcagtttct 86
              ||||||||||||||||||||
Sbjct: 141244 caagattgggttcagtttct 141225
to top
>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 96     gagaggttccatttctccat 115
              ||||||||||||||||||||
Sbjct: 418732 gagaggttccatttctccat 418713
to top
>emb|AL389894.4|LMFLCHR4A Leishmania major Friedlin chromosome 4, left end
          Length = 225394

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 35     cacacgtgtgaagagagaa 53
              |||||||||||||||||||
Sbjct: 133628 cacacgtgtgaagagagaa 133646
to top
>gb|AC034195.7| Homo sapiens chromosome 3 clone RP11-673F20 map 3p, complete sequence
          Length = 189848

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 46    agagagaacacaatagtta 64
             |||||||||||||||||||
Sbjct: 11448 agagagaacacaatagtta 11466
to top
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 81     gtttcttaaatacaagaga 99
              |||||||||||||||||||
Sbjct: 131814 gtttcttaaatacaagaga 131796
to top
>gb|AC129471.1| Homo sapiens chromosome 5 clone RP11-352J21, complete sequence
          Length = 180334

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     aagagagaacacaatagtt 63
              |||||||||||||||||||
Sbjct: 124777 aagagagaacacaatagtt 124759
to top
>emb|AL137251.5| Human DNA sequence from clone RP1-141N5 on chromosome 6 Contains the 3'
             end of the gene for KIAA1913 protein, complete sequence
          Length = 122354

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 112   ccatgatcctatcagctcc 130
             |||||||||||||||||||
Sbjct: 97398 ccatgatcctatcagctcc 97380
to top
>emb|AL031433.4|HS171N11 Human DNA sequence from clone RP1-171N11 on chromosome 6q23 Contains
             the 5' end of a novel gene, the gene for UC28 protein
             (UROC28) and a CpG island, complete sequence
          Length = 129227

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   catgatcctatcagctcct 131
             |||||||||||||||||||
Sbjct: 79262 catgatcctatcagctcct 79244
to top
>gb|AC009635.5| Homo sapiens chromosome 8, clone RP11-21J9, complete sequence
          Length = 171903

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    atttgaacaatggtaaaat 33
             |||||||||||||||||||
Sbjct: 66694 atttgaacaatggtaaaat 66676
to top
>gb|AC120797.9| Mus musculus chromosome 18, clone RP24-81D18, complete sequence
          Length = 210631

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 119    cctatcagctcctacacca 137
              |||||||||||||||||||
Sbjct: 132618 cctatcagctcctacacca 132636
to top
>gb|AC104320.2| Homo sapiens chromosome 8 clone CTD-2204N4 map 8p21-p11, complete
             sequence
          Length = 134133

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 20    aacaatggtaaaatacaca 38
             |||||||||||||||||||
Sbjct: 90579 aacaatggtaaaatacaca 90597
to top
>gb|AC145821.16| Papio anubis clone rp41-103i16, complete sequence
          Length = 169553

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     acaatggtaaaatacacac 39
              |||||||||||||||||||
Sbjct: 102656 acaatggtaaaatacacac 102674
to top
>gb|AC090740.5| Homo sapiens chromosome 8, clone RP11-595O22, complete sequence
          Length = 184838

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 20    aacaatggtaaaatacaca 38
             |||||||||||||||||||
Sbjct: 48076 aacaatggtaaaatacaca 48094
to top
>gb|AC027017.5| Homo sapiens chromosome 8, clone RP11-450M17, complete sequence
          Length = 163266

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    atttgaacaatggtaaaat 33
             |||||||||||||||||||
Sbjct: 96721 atttgaacaatggtaaaat 96703
to top
>gb|AC016617.6| Homo sapiens chromosome 5 clone CTD-2239O16, complete sequence
          Length = 114972

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    aagagagaacacaatagtt 63
             |||||||||||||||||||
Sbjct: 72543 aagagagaacacaatagtt 72525
to top
>ref|XM_627368.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd8_4840),
            partial mRNA
          Length = 7230

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 67   caagattgggttcagtttc 85
            |||||||||||||||||||
Sbjct: 5947 caagattgggttcagtttc 5929
to top
>gb|AC020784.8| Homo sapiens chromosome 8, clone RP11-82I19, complete sequence
          Length = 183111

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     atttgaacaatggtaaaat 33
              |||||||||||||||||||
Sbjct: 144865 atttgaacaatggtaaaat 144847
to top
>gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosome 14, complete sequence
          Length = 215346

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     caagattgggttcagtttc 85
              |||||||||||||||||||
Sbjct: 181076 caagattgggttcagtttc 181094
to top
>gb|AC026188.6| Homo sapiens chromosome 3 clone RP11-319I18 map 3p, complete sequence
          Length = 177721

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 46    agagagaacacaatagtta 64
             |||||||||||||||||||
Sbjct: 72793 agagagaacacaatagtta 72775
to top
>gb|AC010679.6| Homo sapiens BAC clone RP11-128O11 from 2, complete sequence
          Length = 188937

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 111    tccatgatcctatcagctcctac 133
              |||||||||| ||||||||||||
Sbjct: 179569 tccatgatccaatcagctcctac 179591
to top
>gb|AC154837.2| Mus musculus BAC clone RP24-576O2 from 14, complete sequence
          Length = 134124

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 67     caagattgggttcagtttc 85
              |||||||||||||||||||
Sbjct: 122152 caagattgggttcagtttc 122134
to top
>emb|CT571254.7| Mouse DNA sequence from clone RP23-335F6 on chromosome 12, complete
             sequence
          Length = 189879

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    acaatggtaaaatacacac 39
             |||||||||||||||||||
Sbjct: 47360 acaatggtaaaatacacac 47378
to top
>emb|AL663067.14| Mouse DNA sequence from clone RP23-23G3 on chromosome 2, complete
             sequence
          Length = 193057

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Plus

                                        
Query: 31    aatacacacgtgtgaagagagaacaca 57
             |||||||||| ||||||||||||||||
Sbjct: 75921 aatacacacg-gtgaagagagaacaca 75946


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,564,235
Number of Sequences: 3902068
Number of extensions: 1564235
Number of successful extensions: 106451
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 106273
Number of HSP's gapped (non-prelim): 179
length of query: 141
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 120
effective length of database: 17,151,101,840
effective search space: 2058132220800
effective search space used: 2058132220800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top