ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet53b06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ276013.1|HVU276013 Hordeum vulgare partial mRNA for alpha-... 553 e-154
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 88 2e-14
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 88 2e-14
4gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome... 88 2e-14
5gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome... 88 2e-14
6dbj|AK071837.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 2e-14
7emb|AJ276012.1|HVU276012 Hordeum vulgare partial mRNA for alpha-... 76 7e-11
8emb|AJ586804.1| Setaria viridis tua1 gene for alpha tubulin, exo... 76 7e-11
9gb|AC137924.3| Oryza sativa (japonica cultivar-group) chromosome... 74 3e-10
10emb|X91807.1|OSTA136 O.sativa mRNA for alpha-tubulin (clone OSTA... 74 3e-10
11dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 74 3e-10
12dbj|AK105080.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
13dbj|AK102560.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-10
14gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 74 3e-10
15gb|BT016755.1| Zea mays clone Contig588 mRNA sequence 72 1e-09
16gb|BT016625.1| Zea mays clone Contig458 mRNA sequence 72 1e-09
17gb|BT017959.1| Zea mays clone EL01N0523A02.c mRNA sequence 72 1e-09
18emb|X15704.1|ZMALPTUB Zea mays tandem genes for alpha1-tubulin a... 72 1e-09
19emb|X63176.1|ZMALTUB3 Z.mays mRNA for alpha-tubulin 3 72 1e-09
20emb|AJ586805.1| Setaria viridis tua2 gene for alpha tubulin, exo... 72 1e-09
21dbj|AB036814.1| Chlorella vulgaris tubA mRNA for alpha-tubulin, ... 72 1e-09
22gb|AY103579.1| Zea mays PCO151041 mRNA sequence 72 1e-09
23gb|M60171.1|MZETUBA Zea mays alpha-3-tubulin gene, complete cds 72 1e-09
24gb|AF255561.1|AF255561 Notothenia coriiceps alpha tubulin mRNA, ... 66 6e-08
25gb|U92645.1|GLU92645 Gecarcinus lateralis alpha-1-tubulin mRNA, ... 66 6e-08
26gb|BT016539.1| Zea mays clone Contig372 mRNA sequence 64 3e-07
27gb|BT016903.1| Zea mays clone Contig736 mRNA sequence 64 3e-07
28gb|AY508717.1| Laodelphax striatellus alpha 1-tubulin mRNA, comp... 64 3e-07
29emb|X86079.1|SCTUB1A S.commune tub-1A gene 64 3e-07
30gb|AY103544.1| Zea mays PCO076329 mRNA sequence 64 3e-07
31gb|U58641.1|PFU58641 Pelvetia fastigiata alpha-tubulin mRNA, clo... 64 3e-07
32gb|BT024131.1| Zea mays clone EL01N0448H02 mRNA sequence 62 1e-06
33gb|AF082027.1| Notothenia coriiceps alpha tubulin (GTalphaC) and... 60 4e-06
34emb|CR695348.2|CNS0FZHC Tetraodon nigroviridis full-length cDNA 60 4e-06
35emb|CR688765.2|CNS0FUEH Tetraodon nigroviridis full-length cDNA 60 4e-06
36emb|CR684455.2|CNS0FR2R Tetraodon nigroviridis full-length cDNA 60 4e-06
37emb|BX061027.1|CNS09J93 Single read from an extremity of a full-... 60 4e-06
38emb|BX061200.1|CNS09JDW Single read from an extremity of a full-... 60 4e-06
39emb|BX044537.1|CNS096J1 Single read from an extremity of a full-... 60 4e-06
40emb|BX041329.1|CNS0941X Single read from an extremity of a full-... 60 4e-06
41emb|BX026756.1|CNS08ST4 Single read from an extremity of a full-... 60 4e-06
42emb|BX022059.1|CNS08P6N Single read from an extremity of a full-... 60 4e-06
43emb|BX018245.1|CNS08M8P Single read from an extremity of a full-... 60 4e-06
44emb|BX015702.1|CNS08KA2 Single read from an extremity of a full-... 60 4e-06
45emb|BX014360.1|CNS08J8S Single read from an extremity of a full-... 60 4e-06
46gb|AF255562.1|AF255562 Notothenia coriiceps alpha tubulin mRNA, ... 60 4e-06
47gb|AF255560.1|AF255560 Notothenia coriiceps alpha tubulin mRNA, ... 60 4e-06
48ref|XM_309723.2| Anopheles gambiae str. PEST ENSANGP00000002667 ... 60 4e-06
49dbj|D16504.1|CHLTUA1 Chlorella vulgaris tua1 gene for alpha-tubu... 60 4e-06
50ref|XM_414991.1| PREDICTED: Gallus gallus similar to tubulin alp... 58 2e-05
51ref|XM_414990.1| PREDICTED: Gallus gallus similar to Hypothetica... 58 2e-05
52gb|AF455115.1| Trypanosoma cruzi alpha tubulin mRNA, complete cds 58 2e-05
53gb|AY182002.1| Chlamydomonas reinhardtii alpha tubulin-2 gene, c... 58 2e-05
54ref|XM_797406.1| Trypanosoma cruzi strain CL Brener alpha tubuli... 58 2e-05
55emb|CR732697.2|CNS0GSAL Tetraodon nigroviridis full-length cDNA 58 2e-05
56emb|CR732182.2|CNS0GRWB Tetraodon nigroviridis full-length cDNA 58 2e-05
57emb|CR711696.2|CNS0GC3G Tetraodon nigroviridis full-length cDNA 58 2e-05
58emb|CR725161.2|CNS0GMHB Tetraodon nigroviridis full-length cDNA 58 2e-05
59emb|CR723578.2|CNS0GL9C Tetraodon nigroviridis full-length cDNA 58 2e-05
60emb|CR720335.2|CNS0GIR9 Tetraodon nigroviridis full-length cDNA 58 2e-05
61emb|CR719023.2|CNS0GHQT Tetraodon nigroviridis full-length cDNA 58 2e-05
62emb|CR718721.2|CNS0GHIF Tetraodon nigroviridis full-length cDNA 58 2e-05
63emb|CR715696.2|CNS0GF6K Tetraodon nigroviridis full-length cDNA 58 2e-05
64emb|CR714456.2|CNS0GE84 Tetraodon nigroviridis full-length cDNA 58 2e-05
65emb|CR714452.2|CNS0GE80 Tetraodon nigroviridis full-length cDNA 58 2e-05
66emb|CR712506.2|CNS0GCPY Tetraodon nigroviridis full-length cDNA 58 2e-05
67emb|CR713080.2|CNS0GD5W Tetraodon nigroviridis full-length cDNA 58 2e-05
68emb|CR711238.2|CNS0GBQQ Tetraodon nigroviridis full-length cDNA 58 2e-05
69gb|DQ450538.1| Trypanosoma cyclops beta tubulin gene, partial cd... 58 2e-05
70emb|CR705383.2|CNS0G783 Tetraodon nigroviridis full-length cDNA 58 2e-05
71emb|CR700121.2|CNS0G35X Tetraodon nigroviridis full-length cDNA 58 2e-05
72emb|CR698293.2|CNS0G1R5 Tetraodon nigroviridis full-length cDNA 58 2e-05
73emb|CR694522.2|CNS0FYUE Tetraodon nigroviridis full-length cDNA 58 2e-05
74emb|CR693716.2|CNS0FY80 Tetraodon nigroviridis full-length cDNA 58 2e-05
75emb|CR694076.1|CNS0FYI0 Tetraodon nigroviridis full-length cDNA 58 2e-05
76emb|CR688815.2|CNS0FUFV Tetraodon nigroviridis full-length cDNA 58 2e-05
77emb|CR686078.2|CNS0FSBU Tetraodon nigroviridis full-length cDNA 58 2e-05
78emb|CR685355.2|CNS0FRRR Tetraodon nigroviridis full-length cDNA 58 2e-05
79emb|CR683675.2|CNS0FQH3 Tetraodon nigroviridis full-length cDNA 58 2e-05
80emb|CR677878.2|CNS0FM0E Tetraodon nigroviridis full-length cDNA 58 2e-05
81emb|CR672515.2|CNS0FHVT Tetraodon nigroviridis full-length cDNA 58 2e-05
82emb|CR669356.2|CNS0FFG2 Tetraodon nigroviridis full-length cDNA 58 2e-05
83emb|CR665919.2|CNS0FCSL Tetraodon nigroviridis full-length cDNA 58 2e-05
84emb|CR663313.2|CNS0FAS7 Tetraodon nigroviridis full-length cDNA 58 2e-05
85emb|CR660191.2|CNS0F8DH Tetraodon nigroviridis full-length cDNA 58 2e-05
86emb|CR642960.2|CNS0EV2U Tetraodon nigroviridis full-length cDNA 58 2e-05
87emb|X86080.1|SCTUB1B S.commune tub-1B gene 58 2e-05
88emb|X07442.1|GGTUBA3C Chicken alpha 3 tubulin gene exon 4 58 2e-05
89gb|BC089547.1| Mus musculus tubulin, alpha 3, mRNA (cDNA clone M... 58 2e-05
90dbj|AK132775.1| Mus musculus adult male testis cDNA, RIKEN full-... 58 2e-05
91dbj|AK006344.1| Mus musculus adult male testis cDNA, RIKEN full-... 58 2e-05
92gb|BC110002.1| Bos taurus cDNA clone MGC:133894 IMAGE:8042009, c... 58 2e-05
93gb|AC158609.10| Mus musculus 6 BAC RP24-89F5 (Roswell Park Cance... 58 2e-05
94gb|AC160000.9| Mus musculus 6 BAC RP24-340J19 (Roswell Park Canc... 58 2e-05
95emb|BX935067.2| Gallus gallus finished cDNA, clone ChEST71i11 58 2e-05
96ref|NM_009449.2| Mus musculus tubulin, alpha 7 (Tuba7), mRNA 58 2e-05
97dbj|AK106047.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
98gb|AC171018.2| Gallus gallus BAC clone CH261-11F14 from chromoso... 58 2e-05
99gb|BC050769.1| Mus musculus tubulin, alpha 7, mRNA (cDNA clone M... 58 2e-05
100gb|BC050770.1| Mus musculus tubulin, alpha 3, mRNA (cDNA clone M... 58 2e-05
101ref|NM_001038163.1| Bos taurus similar to Tubulin alpha-3 chain ... 58 2e-05
102gb|U92646.1|GLU92646 Gecarcinus lateralis alpha-2-tubulin mRNA, ... 58 2e-05
103ref|NM_009446.1| Mus musculus tubulin, alpha 3 (Tuba3), mRNA 58 2e-05
104gb|AC114921.5| Mus musculus BAC clone RP23-202P9 from 6, complet... 58 2e-05
105gb|AC140324.3| Mus musculus BAC clone RP23-402K14 from 6, comple... 58 2e-05
106gb|M96849.1|TRBBEALTUB Trypanosoma cruzi beta and alpha tubulin ... 58 2e-05
107gb|M97956.1|TRBBEALTU Trypanosoma cruzi beta tubulin and alpha t... 58 2e-05
108gb|M13443.1|MUSTUBA7M Mouse alpha-tubulin isotype M-alpha-7 mRNA... 58 2e-05
109gb|M13442.1|MUSTUBA3M Mouse alpha-tubulin isotype M-alpha-3 mRNA... 58 2e-05
110gb|M11448.1|CRETBA2A Chlamydomonas reinhardtii alpha-2 tubulin g... 58 2e-05
111gb|M11447.1|CRETBA1A Chlamydomonas reinhardtii alpha-1 tubulin g... 58 2e-05
112gb|BT016741.1| Zea mays clone Contig574 mRNA sequence 56 6e-05
113ref|XM_426592.1| PREDICTED: Gallus gallus similar to tubulin, al... 56 6e-05
114ref|XM_422048.1| PREDICTED: Gallus gallus similar to tubulin alp... 56 6e-05
115gb|AC135228.5| Oryza sativa chromosome 3 BAC OSJNBb0122C16 genom... 56 6e-05
116gb|AY702009.1| Leishmania donovani strain MHOM/IN/1983/AG83 alph... 56 6e-05
117gb|AC145380.3| Oryza sativa chromosome 3 BAC OSJNBa0013A09 genom... 56 6e-05
118ref|XM_750739.1| Aspergillus fumigatus Af293 tubulin subunit alp... 56 6e-05
119emb|CR708388.2|CNS0G9JK Tetraodon nigroviridis full-length cDNA 56 6e-05
120emb|CR707988.2|CNS0G98G Tetraodon nigroviridis full-length cDNA 56 6e-05
121emb|CR706879.2|CNS0G8DN Tetraodon nigroviridis full-length cDNA 56 6e-05
122emb|CR706253.2|CNS0G7W9 Tetraodon nigroviridis full-length cDNA 56 6e-05
123gb|DQ129864.1| Leishmania donovani chagasi strain MHOM/BR/00/166... 56 6e-05
124emb|X73980.1|ZMTUA4 Z.mays mRNA for alpha-tubulin 56 6e-05
125emb|X12846.1|VCTUBA1 Volvox carteri alpha-1 tubulin gene 56 6e-05
126emb|AJ005599.1|EIAJ5599 Eleusine indica mRNA for alpha-tubulin 1... 56 6e-05
127emb|AJ005598.1|EIAJ5598 Eleusine indica mRNA for alpha-tubulin 1... 56 6e-05
128emb|AJ420856.1|ZMA420856 Zea mays partial mRNA for alpha tubulin... 56 6e-05
129gb|AF182523.1|AF182523 Oryza sativa alpha-tubulin (TubA1) gene, ... 56 6e-05
130dbj|AK119638.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
131dbj|AK119520.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
132dbj|AK119362.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
133dbj|AK119247.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
134dbj|AK102194.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
135gb|AF008120.1|AF008120 Eleusine indica alpha tubulin 1 (TUA1) mR... 56 6e-05
136gb|AF032876.1| Chloromonas sp. ANT1 alpha-tubulin (tuba) gene, c... 56 6e-05
137gb|AF032877.1| Chloromonas sp. ANT3 alpha-tubulin (tuba1) gene, ... 56 6e-05
138gb|U58642.1|PFU58642 Pelvetia fastigiata alpha-tubulin mRNA, clo... 56 6e-05
139gb|M98863.1|SLMALTA Physarum polycephalum alpha-tubulin (altA) m... 56 6e-05
140gb|AF465697.1| Oikopleura dioica putative alpha-tubulin (TUBAG) ... 54 2e-04
141emb|BX072077.1|CNS09RS1 Single read from an extremity of a full-... 54 2e-04
142emb|BX071990.1|CNS09RPM Single read from an extremity of a full-... 54 2e-04
143emb|BX070180.1|CNS09QBC Single read from an extremity of a full-... 54 2e-04
144emb|BX069758.1|CNS09PZM Single read from an extremity of a full-... 54 2e-04
145emb|BX068311.1|CNS09OVF Single read from an extremity of a full-... 54 2e-04
146emb|BX067110.1|CNS09NY2 Single read from an extremity of a full-... 54 2e-04
147emb|BX067109.1|CNS09NY1 Single read from an extremity of a full-... 54 2e-04
148emb|BX066140.1|CNS09N74 Single read from an extremity of a full-... 54 2e-04
149emb|BX065135.1|CNS09MF7 Single read from an extremity of a full-... 54 2e-04
150emb|BX063463.1|CNS09L4R Single read from an extremity of a full-... 54 2e-04
151emb|BX062158.1|CNS09K4I Single read from an extremity of a full-... 54 2e-04
152emb|BX062157.1|CNS09K4H Single read from an extremity of a full-... 54 2e-04
153emb|BX060128.1|CNS09IK4 Single read from an extremity of a full-... 54 2e-04
154emb|BX054935.1|CNS09EJV Single read from an extremity of a full-... 54 2e-04
155emb|BX053543.1|CNS09DH7 Single read from an extremity of a full-... 54 2e-04
156emb|BX053542.1|CNS09DH6 Single read from an extremity of a full-... 54 2e-04
157emb|BX048167.1|CNS099BV Single read from an extremity of a full-... 54 2e-04
158emb|BX047471.1|CNS098SJ Single read from an extremity of a full-... 54 2e-04
159emb|BX043014.1|CNS095CQ Single read from an extremity of a full-... 54 2e-04
160emb|BX038834.1|CNS0924M Single read from an extremity of a full-... 54 2e-04
161emb|BX038833.1|CNS0924L Single read from an extremity of a full-... 54 2e-04
162emb|BX037081.1|CNS090RX Single read from an extremity of a full-... 54 2e-04
163emb|BX034269.1|CNS08YLT Single read from an extremity of a full-... 54 2e-04
164emb|BX032231.1|CNS08X17 Single read from an extremity of a full-... 54 2e-04
165emb|BX030829.1|CNS08VY9 Single read from an extremity of a full-... 54 2e-04
166emb|BX026828.1|CNS08SV4 Single read from an extremity of a full-... 54 2e-04
167emb|BX026451.1|CNS08SKN Single read from an extremity of a full-... 54 2e-04
168emb|BX024049.1|CNS08QPX Single read from an extremity of a full-... 54 2e-04
169emb|BX020290.1|CNS08NTI Single read from an extremity of a full-... 54 2e-04
170emb|BX016722.1|CNS08L2E Single read from an extremity of a full-... 54 2e-04
171emb|BX015447.1|CNS08K2Z Single read from an extremity of a full-... 54 2e-04
172emb|BX012893.1|CNS08I41 Single read from an extremity of a full-... 54 2e-04
173emb|BX007997.1|CNS08EC1 Single read from an extremity of a full-... 54 2e-04
174emb|BX007024.1|CNS08DL0 Single read from an extremity of a full-... 54 2e-04
175emb|BX006882.1|CNS08DH2 Single read from an extremity of a full-... 54 2e-04
176emb|BX006069.1|CNS08CUH Single read from an extremity of a full-... 54 2e-04
177emb|Z22877.1|EGATUBMR E.gracilis alpha-tubulin mRNA encoding tub... 54 2e-04
178ref|NM_001025879.1| Caenorhabditis elegans C47B2.3 (Tubulin) mRN... 54 2e-04
179gb|AF182553.1|AF182553 Euglena gracilis alpha-tubulin mRNA, comp... 54 2e-04
180gb|AF182557.1|AF182557 Euglena gracilis alpha-tubulin gene, comp... 54 2e-04
181gb|AF182556.1|AF182556 Euglena gracilis alpha-tubulin gene, comp... 54 2e-04
182gb|AF182309.1|AF182309 Euglena gracilis alpha-tubulin mRNA, comp... 54 2e-04
183dbj|D14965.1|CELALPHA2T Caenorhabditis elegans gene for alpha-2 ... 54 2e-04
184emb|Z99709.1|CEC47B2 Caenorhabditis elegans Cosmid C47B2, comple... 54 2e-04
185gb|AY855263.1| Pectinaria gouldii alpha tubulin mRNA, partial cds 54 2e-04
186ref|XM_507378.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
187ref|XM_478815.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.001
188ref|XM_506424.2| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
189gb|AC186561.1| Gasterosteus aculeatus clone VMRC28-125N12, compl... 52 0.001
190emb|AJ133710.1|MTR133710 Miscanthus sinensis tua1 gene for alpha... 52 0.001
191emb|CR732300.2|CNS0GRZL Tetraodon nigroviridis full-length cDNA 52 0.001
192emb|CR730004.2|CNS0GQ7U Tetraodon nigroviridis full-length cDNA 52 0.001
193emb|CR727214.2|CNS0GO2C Tetraodon nigroviridis full-length cDNA 52 0.001
194emb|CR725972.2|CNS0GN3U Tetraodon nigroviridis full-length cDNA 52 0.001
195emb|CR725925.2|CNS0GN2J Tetraodon nigroviridis full-length cDNA 52 0.001
196emb|CR725251.2|CNS0GMJT Tetraodon nigroviridis full-length cDNA 52 0.001
197emb|CR721980.2|CNS0GK0Y Tetraodon nigroviridis full-length cDNA 52 0.001
198gb|DQ450539.1| Trypanosoma grayi beta tubulin gene, partial cds;... 52 0.001
199emb|CR704721.2|CNS0G6PP Tetraodon nigroviridis full-length cDNA 52 0.001
200emb|CR704639.2|CNS0G6NF Tetraodon nigroviridis full-length cDNA 52 0.001
201emb|CR704326.2|CNS0G6EQ Tetraodon nigroviridis full-length cDNA 52 0.001
202emb|CR703191.2|CNS0G5J7 Tetraodon nigroviridis full-length cDNA 52 0.001
203emb|CR703052.2|CNS0G5FC Tetraodon nigroviridis full-length cDNA 52 0.001
204emb|CR702388.2|CNS0G4WW Tetraodon nigroviridis full-length cDNA 52 0.001
205emb|CR702277.2|CNS0G4TT Tetraodon nigroviridis full-length cDNA 52 0.001
206emb|CR702224.2|CNS0G4SC Tetraodon nigroviridis full-length cDNA 52 0.001
207emb|CR701916.3|CNS0G4JS Tetraodon nigroviridis full-length cDNA 52 0.001
208emb|CR701694.2|CNS0G4DM Tetraodon nigroviridis full-length cDNA 52 0.001
209emb|CR701674.2|CNS0G4D2 Tetraodon nigroviridis full-length cDNA 52 0.001
210emb|CR701568.2|CNS0G4A4 Tetraodon nigroviridis full-length cDNA 52 0.001
211emb|CR701314.2|CNS0G432 Tetraodon nigroviridis full-length cDNA 52 0.001
212emb|CR700127.1|CNS0G363 Tetraodon nigroviridis full-length cDNA 52 0.001
213emb|CR699445.2|CNS0G2N5 Tetraodon nigroviridis full-length cDNA 52 0.001
214emb|CR691242.2|CNS0FWBA Tetraodon nigroviridis full-length cDNA 52 0.001
215emb|CR691236.2|CNS0FWB4 Tetraodon nigroviridis full-length cDNA 52 0.001
216emb|CR691232.2|CNS0FWB0 Tetraodon nigroviridis full-length cDNA 52 0.001
217emb|CR698796.2|CNS0G254 Tetraodon nigroviridis full-length cDNA 52 0.001
218emb|CR698316.2|CNS0G1RS Tetraodon nigroviridis full-length cDNA 52 0.001
219emb|CR698287.2|CNS0G1QZ Tetraodon nigroviridis full-length cDNA 52 0.001
220emb|CR697176.2|CNS0G0W4 Tetraodon nigroviridis full-length cDNA 52 0.001
221emb|CR695343.1|CNS0FZH7 Tetraodon nigroviridis full-length cDNA 52 0.001
222emb|CR694734.2|CNS0FZ0A Tetraodon nigroviridis full-length cDNA 52 0.001
223emb|CR694327.2|CNS0FYOZ Tetraodon nigroviridis full-length cDNA 52 0.001
224emb|CR693718.1|CNS0FY82 Tetraodon nigroviridis full-length cDNA 52 0.001
225emb|CR693676.2|CNS0FY6W Tetraodon nigroviridis full-length cDNA 52 0.001
226emb|CR693212.1|CNS0FXU0 Tetraodon nigroviridis full-length cDNA 52 0.001
227emb|CR693140.2|CNS0FXS0 Tetraodon nigroviridis full-length cDNA 52 0.001
228emb|CR693076.2|CNS0FXQ8 Tetraodon nigroviridis full-length cDNA 52 0.001
229emb|CR693029.2|CNS0FXOX Tetraodon nigroviridis full-length cDNA 52 0.001
230emb|CR692881.1|CNS0FXKT Tetraodon nigroviridis full-length cDNA 52 0.001
231emb|CR692422.2|CNS0FX82 Tetraodon nigroviridis full-length cDNA 52 0.001
232emb|CR691796.2|CNS0FWQO Tetraodon nigroviridis full-length cDNA 52 0.001
233emb|CR691778.2|CNS0FWQ6 Tetraodon nigroviridis full-length cDNA 52 0.001
234emb|CR691638.2|CNS0FWMA Tetraodon nigroviridis full-length cDNA 52 0.001
235emb|CR692064.1|CNS0FWY4 Tetraodon nigroviridis full-length cDNA 52 0.001
236emb|CR691108.2|CNS0FW7K Tetraodon nigroviridis full-length cDNA 52 0.001
237emb|CR686004.1|CNS0FS9S Tetraodon nigroviridis full-length cDNA 52 0.001
238emb|CR685809.2|CNS0FS4D Tetraodon nigroviridis full-length cDNA 52 0.001
239emb|CR690899.2|CNS0FW1R Tetraodon nigroviridis full-length cDNA 52 0.001
240emb|CR688364.2|CNS0FU3C Tetraodon nigroviridis full-length cDNA 52 0.001
241emb|CR688326.2|CNS0FU2A Tetraodon nigroviridis full-length cDNA 52 0.001
242emb|CR690059.2|CNS0FVEF Tetraodon nigroviridis full-length cDNA 52 0.001
243emb|CR689902.2|CNS0FVA2 Tetraodon nigroviridis full-length cDNA 52 0.001
244emb|CR689722.2|CNS0FV52 Tetraodon nigroviridis full-length cDNA 52 0.001
245emb|CR689495.2|CNS0FUYR Tetraodon nigroviridis full-length cDNA 52 0.001
246emb|CR689411.2|CNS0FUWF Tetraodon nigroviridis full-length cDNA 52 0.001
247emb|CR689202.2|CNS0FUQM Tetraodon nigroviridis full-length cDNA 52 0.001
248emb|CR689093.1|CNS0FUNL Tetraodon nigroviridis full-length cDNA 52 0.001
249emb|CR687517.2|CNS0FTFT Tetraodon nigroviridis full-length cDNA 52 0.001
250emb|CR687239.2|CNS0FT83 Tetraodon nigroviridis full-length cDNA 52 0.001
251emb|CR687444.2|CNS0FTDS Tetraodon nigroviridis full-length cDNA 52 0.001
252emb|CR687425.2|CNS0FTD9 Tetraodon nigroviridis full-length cDNA 52 0.001
253emb|CR687369.2|CNS0FTBP Tetraodon nigroviridis full-length cDNA 52 0.001
254emb|CR686733.2|CNS0FSU1 Tetraodon nigroviridis full-length cDNA 52 0.001
255emb|CR686731.2|CNS0FSTZ Tetraodon nigroviridis full-length cDNA 52 0.001
256emb|CR686709.2|CNS0FSTD Tetraodon nigroviridis full-length cDNA 52 0.001
257emb|CR686669.2|CNS0FSS9 Tetraodon nigroviridis full-length cDNA 52 0.001
258emb|CR686654.2|CNS0FSRU Tetraodon nigroviridis full-length cDNA 52 0.001
259emb|CR686040.2|CNS0FSAS Tetraodon nigroviridis full-length cDNA 52 0.001
260emb|CR685211.2|CNS0FRNR Tetraodon nigroviridis full-length cDNA 52 0.001
261emb|CR684915.2|CNS0FRFJ Tetraodon nigroviridis full-length cDNA 52 0.001
262emb|CR681912.2|CNS0FP44 Tetraodon nigroviridis full-length cDNA 52 0.001
263emb|CR683397.2|CNS0FQ9D Tetraodon nigroviridis full-length cDNA 52 0.001
264emb|CR682776.1|CNS0FPS4 Tetraodon nigroviridis full-length cDNA 52 0.001
265emb|CR681636.2|CNS0FOWG Tetraodon nigroviridis full-length cDNA 52 0.001
266emb|CR678581.2|CNS0FMJL Tetraodon nigroviridis full-length cDNA 52 0.001
267emb|CR677686.2|CNS0FLV3 Tetraodon nigroviridis full-length cDNA 52 0.001
268emb|CR674945.1|CNS0FJRB Tetraodon nigroviridis full-length cDNA 52 0.001
269emb|CR663349.2|CNS0FAT7 Tetraodon nigroviridis full-length cDNA 52 0.001
270emb|CR663471.1|CNS0FAWL Tetraodon nigroviridis full-length cDNA 52 0.001
271emb|CR661740.2|CNS0F9KI Tetraodon nigroviridis full-length cDNA 52 0.001
272emb|CR655601.2|CNS0F4TZ Tetraodon nigroviridis full-length cDNA 52 0.001
273emb|CR654701.1|CNS0F44Z Tetraodon nigroviridis full-length cDNA 52 0.001
274emb|CR653990.2|CNS0F3L8 Tetraodon nigroviridis full-length cDNA 52 0.001
275emb|CR649014.2|CNS0EZR0 Tetraodon nigroviridis full-length cDNA 52 0.001
276gb|BC079395.1| Rattus norvegicus similar to Tubulin alpha-3 chai... 52 0.001
277emb|BX067644.1|CNS09OCW Single read from an extremity of a full-... 52 0.001
278emb|BX067643.1|CNS09OCV Single read from an extremity of a full-... 52 0.001
279emb|BX064929.1|CNS09M9H Single read from an extremity of a full-... 52 0.001
280emb|BX056629.1|CNS09FUX Single read from an extremity of a full-... 52 0.001
281emb|BX056628.1|CNS09FUW Single read from an extremity of a full-... 52 0.001
282emb|BX056551.1|CNS09FSR Single read from an extremity of a full-... 52 0.001
283emb|BX050484.1|CNS09B48 Single read from an extremity of a full-... 52 0.001
284emb|BX049723.1|CNS09AJ3 Single read from an extremity of a full-... 52 0.001
285emb|BX034163.1|CNS08YIV Single read from an extremity of a full-... 52 0.001
286emb|BX031518.1|CNS08WHE Single read from an extremity of a full-... 52 0.001
287emb|BX029729.1|CNS08V3P Single read from an extremity of a full-... 52 0.001
288emb|BX029686.1|CNS08V2I Single read from an extremity of a full-... 52 0.001
289emb|BX028326.1|CNS08U0Q Single read from an extremity of a full-... 52 0.001
290emb|BX025929.1|CNS08S65 Single read from an extremity of a full-... 52 0.001
291emb|BX023696.1|CNS08QG4 Single read from an extremity of a full-... 52 0.001
292emb|BX022215.1|CNS08PAZ Single read from an extremity of a full-... 52 0.001
293emb|BX019575.1|CNS08N9N Single read from an extremity of a full-... 52 0.001
294emb|BX020652.1|CNS08O3K Single read from an extremity of a full-... 52 0.001
295emb|BX020137.1|CNS08NP9 Single read from an extremity of a full-... 52 0.001
296emb|BX016320.1|CNS08KR8 Single read from an extremity of a full-... 52 0.001
297emb|BX014126.1|CNS08J2A Single read from an extremity of a full-... 52 0.001
298emb|BX011539.1|CNS08H2F Single read from an extremity of a full-... 52 0.001
299emb|BX009303.1|CNS08FCB Single read from an extremity of a full-... 52 0.001
300emb|BX009302.1|CNS08FCA Single read from an extremity of a full-... 52 0.001
301emb|BX009127.1|CNS08F7F Single read from an extremity of a full-... 52 0.001
302emb|BX009126.1|CNS08F7E Single read from an extremity of a full-... 52 0.001
303emb|BX007758.1|CNS08E5E Single read from an extremity of a full-... 52 0.001
304emb|BX005571.1|CNS08CGN Single read from an extremity of a full-... 52 0.001
305emb|Z11931.1|OSTUBA1M Oryza sativa mRNA for alpha 1 tubulin 52 0.001
306emb|X91808.1|OSTA274 O.sativa mRNA for alpha-tubulin (clone OSTA... 52 0.001
307emb|X91806.1|OSTA111 O.sativa mRNA for alpha-tubulin (clone OSTA... 52 0.001
308ref|NM_001040008.1| Rattus norvegicus similar to Tubulin alpha-3... 52 0.001
309gb|AF199019.1|AF199019 Leishmania major alpha tubulin mRNA, part... 52 0.001
310gb|AF321052.1|AF321052 Colletotrichum lagenarium alpha-tubulin (... 52 0.001
311dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
312gb|AF263274.1|AF263274 Chionodraco rastrospinosus isolate Cra7 a... 52 0.001
313gb|AF255564.1|AF255564 Notothenia coriiceps alpha tubulin mRNA, ... 52 0.001
314gb|AF255563.1|AF255563 Notothenia coriiceps alpha tubulin mRNA, ... 52 0.001
315gb|AF255558.1|AF255558 Notothenia coriiceps alpha tubulin mRNA, ... 52 0.001
316gb|AF255557.1|AF255557 Notothenia coriiceps alpha tubulin mRNA, ... 52 0.001
317dbj|AP003758.4| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
318emb|AJ431263.1|MSI431263 Miscanthus sinensis TUA2 gene for alpha... 52 0.001
319dbj|AP003845.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
320dbj|AK104900.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
321dbj|AK069140.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
322dbj|AK067721.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
323gb|AF008121.1|AF008121 Eleusine indica alpha-tubulin 2 (TUA2) mR... 52 0.001
324gb|DQ241790.1| Ctenopseustis herana alpha-tubulin mRNA, partial cds 50 0.004
325gb|BT016118.1| Drosophila melanogaster LD07757 full insert cDNA 50 0.004
326ref|NM_017379.1| Mus musculus tubulin, alpha 8 (Tuba8), mRNA 50 0.004
327gb|BC017631.1| Mus musculus tubulin, alpha 8, mRNA (cDNA clone M... 50 0.004
328gb|AC115880.11| Mus musculus chromosome 9, clone RP24-365N15, co... 50 0.004
329ref|XR_003178.1| PREDICTED: Mus musculus similar to tubulin, alp... 50 0.004
330ref|XM_543889.2| PREDICTED: Canis familiaris similar to Tubulin ... 50 0.004
331gb|AY145881.1| Giardia intestinalis alpha-1 tubulin gene, comple... 50 0.004
332emb|AL023832.1|CEY19D2B Caenorhabditis elegans YAC Y19D2B, compl... 50 0.004
333emb|CR734617.2|CNS0GTM0 Tetraodon nigroviridis full-length cDNA 50 0.004
334emb|CR734044.2|CNS0GT63 Tetraodon nigroviridis full-length cDNA 50 0.004
335emb|CR734042.2|CNS0GT61 Tetraodon nigroviridis full-length cDNA 50 0.004
336emb|CR733619.2|CNS0GSUA Tetraodon nigroviridis full-length cDNA 50 0.004
337emb|CR732403.1|CNS0GS2G Tetraodon nigroviridis full-length cDNA 50 0.004
338emb|CR731784.2|CNS0GRL9 Tetraodon nigroviridis full-length cDNA 50 0.004
339emb|CR730943.3|CNS0GQXW Tetraodon nigroviridis full-length cDNA 50 0.004
340emb|CR728297.2|CNS0GOWF Tetraodon nigroviridis full-length cDNA 50 0.004
341emb|CR727547.2|CNS0GOBL Tetraodon nigroviridis full-length cDNA 50 0.004
342emb|CR726163.2|CNS0GN95 Tetraodon nigroviridis full-length cDNA 50 0.004
343emb|CR726066.2|CNS0GN6G Tetraodon nigroviridis full-length cDNA 50 0.004
344emb|CR720245.2|CNS0GIOR Tetraodon nigroviridis full-length cDNA 50 0.004
345emb|CR724614.2|CNS0GM24 Tetraodon nigroviridis full-length cDNA 50 0.004
346emb|CR724524.2|CNS0GLZM Tetraodon nigroviridis full-length cDNA 50 0.004
347emb|CR724431.2|CNS0GLX1 Tetraodon nigroviridis full-length cDNA 50 0.004
348emb|CR723801.2|CNS0GLFJ Tetraodon nigroviridis full-length cDNA 50 0.004
349emb|CR723248.2|CNS0GL06 Tetraodon nigroviridis full-length cDNA 50 0.004
350emb|CR722217.2|CNS0GK7J Tetraodon nigroviridis full-length cDNA 50 0.004
351emb|CR720650.2|CNS0GJ00 Tetraodon nigroviridis full-length cDNA 50 0.004
352ref|XM_764293.1| Giardia lamblia ATCC 50803 hypothetical protein... 50 0.004
353ref|XM_764294.1| Giardia lamblia ATCC 50803 alpha-2-tubulin (GLP... 50 0.004
354ref|XM_774476.1| Giardia lamblia ATCC 50803 hypothetical protein... 50 0.004
355ref|XM_774477.1| Giardia lamblia ATCC 50803 alpha-2-tubulin (GLP... 50 0.004
356gb|DQ450532.1| Crithidia deanei alpha tubulin and beta tubulin g... 50 0.004
357emb|CR702998.2|CNS0G5DU Tetraodon nigroviridis full-length cDNA 50 0.004
358emb|CR699584.2|CNS0G2R0 Tetraodon nigroviridis full-length cDNA 50 0.004
359emb|CR698857.2|CNS0G26T Tetraodon nigroviridis full-length cDNA 50 0.004
360emb|CR694115.2|CNS0FYJ3 Tetraodon nigroviridis full-length cDNA 50 0.004
361emb|CR691624.2|CNS0FWLW Tetraodon nigroviridis full-length cDNA 50 0.004
362emb|CR686491.2|CNS0FSNB Tetraodon nigroviridis full-length cDNA 50 0.004
363emb|CR682946.2|CNS0FPWU Tetraodon nigroviridis full-length cDNA 50 0.004
364emb|CR680216.1|CNS0FNT0 Tetraodon nigroviridis full-length cDNA 50 0.004
365emb|CR675142.2|CNS0FJWS Tetraodon nigroviridis full-length cDNA 50 0.004
366emb|CR674184.2|CNS0FJ66 Tetraodon nigroviridis full-length cDNA 50 0.004
367emb|CR673594.2|CNS0FIPS Tetraodon nigroviridis full-length cDNA 50 0.004
368emb|CR673128.2|CNS0FICU Tetraodon nigroviridis full-length cDNA 50 0.004
369emb|CR671726.2|CNS0FH9W Tetraodon nigroviridis full-length cDNA 50 0.004
370emb|CR671631.2|CNS0FH79 Tetraodon nigroviridis full-length cDNA 50 0.004
371emb|CR671049.2|CNS0FGR3 Tetraodon nigroviridis full-length cDNA 50 0.004
372emb|CR669569.2|CNS0FFLZ Tetraodon nigroviridis full-length cDNA 50 0.004
373emb|CR668873.2|CNS0FF2N Tetraodon nigroviridis full-length cDNA 50 0.004
374emb|CR667397.2|CNS0FDXN Tetraodon nigroviridis full-length cDNA 50 0.004
375emb|CR666666.2|CNS0FDDC Tetraodon nigroviridis full-length cDNA 50 0.004
376emb|CR666483.2|CNS0FD89 Tetraodon nigroviridis full-length cDNA 50 0.004
377emb|CR665574.2|CNS0FCJ0 Tetraodon nigroviridis full-length cDNA 50 0.004
378emb|CR663675.2|CNS0FB29 Tetraodon nigroviridis full-length cDNA 50 0.004
379emb|CR663520.2|CNS0FAXY Tetraodon nigroviridis full-length cDNA 50 0.004
380emb|CR662950.2|CNS0FAI4 Tetraodon nigroviridis full-length cDNA 50 0.004
381emb|CR657903.2|CNS0F6LX Tetraodon nigroviridis full-length cDNA 50 0.004
382emb|CR660454.2|CNS0F8KS Tetraodon nigroviridis full-length cDNA 50 0.004
383emb|CR660087.2|CNS0F8AL Tetraodon nigroviridis full-length cDNA 50 0.004
384emb|CR657825.2|CNS0F6JR Tetraodon nigroviridis full-length cDNA 50 0.004
385emb|CR657656.2|CNS0F6F2 Tetraodon nigroviridis full-length cDNA 50 0.004
386emb|CR657045.2|CNS0F5Y3 Tetraodon nigroviridis full-length cDNA 50 0.004
387emb|CR657478.2|CNS0F6A4 Tetraodon nigroviridis full-length cDNA 50 0.004
388emb|CR656958.2|CNS0F5VO Tetraodon nigroviridis full-length cDNA 50 0.004
389emb|CR654536.1|CNS0F40E Tetraodon nigroviridis full-length cDNA 50 0.004
390emb|CR653452.2|CNS0F36A Tetraodon nigroviridis full-length cDNA 50 0.004
391emb|CR650654.2|CNS0F10K Tetraodon nigroviridis full-length cDNA 50 0.004
392emb|CR640686.2|CNS0ETBO Tetraodon nigroviridis full-length cDNA 50 0.004
393emb|CR639075.1|CNS0ES2X Tetraodon nigroviridis full-length cDNA 50 0.004
394emb|CR638757.1| Tetraodon nigroviridis full-length cDNA 50 0.004
395emb|CR637536.1|CNS0EQW6 Tetraodon nigroviridis full-length cDNA 50 0.004
396emb|CR635876.2|CNS0EPM2 Tetraodon nigroviridis full-length cDNA 50 0.004
397gb|DQ080027.1| Trypanosoma danilewskyi alpha-tubulin mRNA, compl... 50 0.004
398ref|XM_961491.1| PREDICTED: Tribolium castaneum similar to Tubul... 50 0.004
399emb|BX020706.1|CNS08O52 Single read from an extremity of a full-... 50 0.004
400emb|BX020705.1|CNS08O51 Single read from an extremity of a full-... 50 0.004
401emb|AJ245923.1|MMU245923 Mus musculus mRNA for alpha-tubulin 8 (... 50 0.004
402ref|NM_169189.1| Drosophila melanogaster -Tubulin at 84D CG2512-... 50 0.004
403ref|NM_079540.4| Drosophila melanogaster -Tubulin at 84D CG2512-... 50 0.004
404gb|AY084208.1| Drosophila melanogaster SD07763 full insert cDNA 50 0.004
405ref|NM_001024339.1| Rattus norvegicus similar to Tubulin alpha-8... 50 0.004
406dbj|AK009651.1| Mus musculus adult male tongue cDNA, RIKEN full-... 50 0.004
407gb|AY161326.1| Giardia intestinalis clone GDA1 alpha-tubulin gen... 50 0.004
408gb|AY161322.1| Encephalitozoon intestinalis clone EIA1 alpha-tub... 50 0.004
409dbj|AK009439.1| Mus musculus adult male tongue cDNA, RIKEN full-... 50 0.004
410dbj|AK032157.1| Mus musculus adult male olfactory brain cDNA, RI... 50 0.004
411ref|NM_063951.1| Caenorhabditis elegans Y19D2B.1 (Y19D2B.1) mRNA... 50 0.004
412ref|NM_063950.3| Caenorhabditis elegans TuBulin, Alpha family me... 50 0.004
413dbj|AK042117.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 50 0.004
414gb|BC079185.1| Rattus norvegicus similar to Tubulin alpha-8 chai... 50 0.004
415gb|AF331826.1|AF331826 Giardia intestinalis alpha-2 tubulin gene... 50 0.004
416gb|AC011253.4|AC011253 Drosophila melanogaster, chromosome 3R, r... 50 0.004
417gb|AC008312.4|AC008312 Drosophila melanogaster, chromosome 3R, r... 50 0.004
418gb|AY894136.1| Haematococcus pluvialis alpha-tubulin mRNA, compl... 50 0.004
419gb|BT003630.1| Drosophila melanogaster AT26363 full insert cDNA 50 0.004
420gb|AF176672.1|AF176672 Giardia intestinalis alpha-2-tubulin gene... 50 0.004
421gb|AY105284.1| Zea mays PCO143016 mRNA sequence 50 0.004
422gb|AE003671.4| Drosophila melanogaster chromosome 3R, section 13... 50 0.004
423gb|DQ340766.1| Camellia sinensis alpha tubulin 1 (Tua1) mRNA, co... 50 0.004
424gb|AC153584.5| Mus musculus 6 BAC RP23-27C9 (Roswell Park Cancer... 50 0.004
425gb|U92647.1|GLU92647 Gecarcinus lateralis alpha-3-tubulin mRNA, ... 50 0.004
426gb|M14645.1|DROTUBA3 D.melanogaster alpha-tubulin gene (alpha-3)... 50 0.004
427gb|AY542972.1| Bigelowiella natans alpha tubulin 2 mRNA, complet... 48 0.015
428gb|BC061297.1| Xenopus tropicalis tubulin, alpha 1, mRNA (cDNA c... 48 0.015
429emb|CR699707.2|CNS0G2UF Tetraodon nigroviridis full-length cDNA 48 0.015
430emb|CR699975.2|CNS0G31V Tetraodon nigroviridis full-length cDNA 48 0.015
431emb|CR694684.2|CNS0FYYW Tetraodon nigroviridis full-length cDNA 48 0.015
432emb|CR691979.2|CNS0FWVR Tetraodon nigroviridis full-length cDNA 48 0.015
433emb|CR686533.2|CNS0FSOH Tetraodon nigroviridis full-length cDNA 48 0.015
434gb|AF465695.1| Oikopleura dioica putative alpha-tubulin (TUBAE) ... 48 0.015
435emb|BX025755.1|CNS08S1B Single read from an extremity of a full-... 48 0.015
436emb|X08061.1|GGTUBA5 Chicken alpha 5 tubulin gene exons 2-4 48 0.015
437gb|U09612.1|LDU09612 Leishmania donovani Sudanese alpha tubulin ... 48 0.015
438gb|AY026060.1| Oncorhynchus nerka alpha tubulin subunit mRNA, co... 48 0.015
439ref|NM_203798.1| Xenopus tropicalis tubulin, alpha 1 (MGC75767),... 48 0.015
440emb|AJ431262.1|MSI431262 Miscanthus sinensis TUA1 gene for alpha... 48 0.015
441emb|X05469.1|PPTUBA4 Physarum polycephalum alpha-tubulin gene, e... 48 0.015
442dbj|AB096718.1| Physcomitrella patens PpTUA1 mRNA for alpha tubu... 48 0.015
443gb|U92648.1|GLU92648 Gecarcinus lateralis alpha-4-tubulin mRNA, ... 48 0.015
444gb|AF030548.1|AF030548 Oryza sativa tubulin (RiP3) mRNA, complet... 48 0.015
445gb|AC152494.1| Zea mays BAC clone Z418K17, complete sequence 46 0.059
446gb|AC008225.4| Drosophila melanogaster clone BACR03E11, complete... 46 0.059
447gb|AC095016.2| Drosophila melanogaster clone BACR03K19, complete... 46 0.059
448ref|XM_416397.1| PREDICTED: Gallus gallus similar to alpha-tubul... 46 0.059
449gb|BT012506.1| Drosophila melanogaster AT25469 full insert cDNA 46 0.059
450gb|AC165174.2| Zea mays clone ZMMBBb-127F19, complete sequence 46 0.059
451emb|CR716425.2|CNS0GFQQ Tetraodon nigroviridis full-length cDNA 46 0.059
452emb|CR694819.2|CNS0FZ2N Tetraodon nigroviridis full-length cDNA 46 0.059
453ref|XM_970733.1| PREDICTED: Tribolium castaneum similar to Tubul... 46 0.059
454ref|XM_796918.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.059
455ref|XM_796886.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.059
456ref|XM_796858.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.059
457ref|XM_796810.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.059
458ref|XM_775024.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.059
459emb|BX017053.1|CNS08LBL Single read from an extremity of a full-... 46 0.059
460emb|X99623.1|HVATUB1 H.vulgare mRNA for alpha-tubulin 1 46 0.059
461ref|NM_057424.3| Drosophila melanogaster -Tubulin at 84B CG1913-... 46 0.059
462gb|AF466932.1| Zea mays clone BAC 206C17, complete sequence 46 0.059
463emb|X08063.1|GGTUBA7P Chicken alpha 7 tubulin pseudogene 46 0.059
464gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12... 46 0.059
465emb|X07444.1|GGTUBA4B Chicken alpha 4 tubulin gene exon 5 46 0.059
466gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence 46 0.059
467gb|AC004266.1|AC004266 Drosophila melanogaster DNA sequence (P1 ... 46 0.059
468gb|M14643.1|DROTUBA1 D.melanogaster alpha-tubulin gene (alpha-1)... 46 0.059
469gb|BT018929.1| Zea mays clone Contig58.F mRNA sequence 44 0.23
470gb|AC152065.4| Mus musculus BAC clone RP23-16D9 from chromosome ... 44 0.23
471ref|XM_957535.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.23
472ref|XM_327273.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.23
473ref|XM_752275.1| Ustilago maydis 521 tubulin subunit alpha-1A (U... 44 0.23
474emb|AJ437641.1|MSI437641 Miscanthus sinensis var. condensatus TU... 44 0.23
475emb|AJ437640.1|MSI437640 Miscanthus transmorrisonensis macronucl... 44 0.23
476emb|AJ437639.1|MSI437639 Miscanthus transmorrisonensis macronucl... 44 0.23
477emb|AJ437638.1|MSI437638 Miscanthus sinensis macronuclear TUA6 g... 44 0.23
478emb|AJ133709.1|MSI133709 Miscanthus sinensis tua1 gene for alpha... 44 0.23
479emb|Z81070.1|CEF26E4 Caenorhabditis elegans Cosmid F26E4, comple... 44 0.23
480gb|DQ450533.1| Crithidia fasciculata alpha tubulin genes, partia... 44 0.23
481emb|CR704090.2|CNS0G686 Tetraodon nigroviridis full-length cDNA 44 0.23
482emb|CR702506.2|CNS0G506 Tetraodon nigroviridis full-length cDNA 44 0.23
483emb|CR700007.2|CNS0G32R Tetraodon nigroviridis full-length cDNA 44 0.23
484emb|CR697310.2|CNS0G0ZU Tetraodon nigroviridis full-length cDNA 44 0.23
485emb|CR696771.2|CNS0G0KV Tetraodon nigroviridis full-length cDNA 44 0.23
486emb|CR691038.2|CNS0FW5M Tetraodon nigroviridis full-length cDNA 44 0.23
487emb|CR686039.1|CNS0FSAR Tetraodon nigroviridis full-length cDNA 44 0.23
488emb|CR687304.2|CNS0FT9W Tetraodon nigroviridis full-length cDNA 44 0.23
489emb|CR685192.2|CNS0FRN8 Tetraodon nigroviridis full-length cDNA 44 0.23
490emb|CR681834.2|CNS0FP1Y Tetraodon nigroviridis full-length cDNA 44 0.23
491ref|XM_961314.1| PREDICTED: Tribolium castaneum similar to tubul... 44 0.23
492ref|XM_970621.1| PREDICTED: Tribolium castaneum similar to tubul... 44 0.23
493emb|BX033081.1|CNS08XOT Single read from an extremity of a full-... 44 0.23
494emb|BX024444.1|CNS08R0W Single read from an extremity of a full-... 44 0.23
495emb|X63178.1|ZMALTUB6 Z.mays mRNA for alpha-tubulin 6 44 0.23
496ref|NM_001016694.2| Xenopus tropicalis tubulin, alpha 1 (testis ... 44 0.23
497emb|AJ420858.1|ZMA420858 Zea mays partial tua6 gene for alpha tu... 44 0.23
498emb|AJ420857.1|ZMA420857 Zea mays partial mRNA for alpha tubulin... 44 0.23
499emb|AJ301661.1|UMA301661 Ustilago maydis tub1 gene for alpha tub... 44 0.23
500dbj|AB226162.1| Aspergillus oryzae cDNA, contig sequence: AoEST3020 44 0.23

>emb|AJ276013.1|HVU276013 Hordeum vulgare partial mRNA for alpha-tubulin 5 (atub5 gene)
          Length = 794

 Score =  553 bits (279), Expect = e-154
 Identities = 279/279 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   acagtacaaaaactcttcgttcattattatgtggcactgaaccgtcagagcatacgaatc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769 acagtacaaaaactcttcgttcattattatgtggcactgaaccgtcagagcatacgaatc 710

                                                                       
Query: 61  aatctgacaagttttttactctgctaaccaccgaacatcacagatgcaacagcaaaacag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 709 aatctgacaagttttttactctgctaaccaccgaacatcacagatgcaacagcaaaacag 650

                                                                       
Query: 121 ggacagagaagaaggaacggcatagaagtgcacaacactgccacccaaattaagcacgac 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 649 ggacagagaagaaggaacggcatagaagtgcacaacactgccacccaaattaagcacgac 590

                                                                       
Query: 181 cgatcaactcagtactcatcaacttcgtcgtcgtcgtcttcaccctcagctccgacctcc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 589 cgatcaactcagtactcatcaacttcgtcgtcgtcgtcttcaccctcagctccgacctcc 530

                                                  
Query: 241 tcgtagtccttctccagcgcggccaggtcctccctggcc 279
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 529 tcgtagtccttctccagcgcggccaggtcctccctggcc 491



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 65/72 (90%)
 Strand = Plus / Plus

                                                                           
Query: 208     tcgtcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccagg 267
               ||||||||||| ||  | || || |||||||||||||||||||||||||||||||| |||
Sbjct: 6244293 tcgtcgtcgtcctcgacttcggcgccgacctcctcgtagtccttctccagcgcggcgagg 6244352

                           
Query: 268     tcctccctggcc 279
               ||||||||||||
Sbjct: 6244353 tcctccctggcc 6244364



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                                
Query: 225      ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
                |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 29235102 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 29235055



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 205     tcgtcgtcgtcgtcttcacc 224
               ||||||||||||||||||||
Sbjct: 1687672 tcgtcgtcgtcgtcttcacc 1687653



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 65/72 (90%)
 Strand = Plus / Plus

                                                                           
Query: 208     tcgtcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccagg 267
               ||||||||||| ||  | || || |||||||||||||||||||||||||||||||| |||
Sbjct: 6243506 tcgtcgtcgtcctcgacttcggcgccgacctcctcgtagtccttctccagcgcggcgagg 6243565

                           
Query: 268     tcctccctggcc 279
               ||||||||||||
Sbjct: 6243566 tcctccctggcc 6243577



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                                
Query: 225      ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
                |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 29326478 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 29326431



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 205     tcgtcgtcgtcgtcttcacc 224
               ||||||||||||||||||||
Sbjct: 1687670 tcgtcgtcgtcgtcttcacc 1687651



to top

>gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNAa0090D11, complete sequence
          Length = 115403

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 65/72 (90%)
 Strand = Plus / Plus

                                                                         
Query: 208   tcgtcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccagg 267
             ||||||||||| ||  | || || |||||||||||||||||||||||||||||||| |||
Sbjct: 82904 tcgtcgtcgtcctcgacttcggcgccgacctcctcgtagtccttctccagcgcggcgagg 82963

                         
Query: 268   tcctccctggcc 279
             ||||||||||||
Sbjct: 82964 tcctccctggcc 82975



to top

>gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0024O21, complete sequence
          Length = 155651

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 65/72 (90%)
 Strand = Plus / Plus

                                                                         
Query: 208   tcgtcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccagg 267
             ||||||||||| ||  | || || |||||||||||||||||||||||||||||||| |||
Sbjct: 57501 tcgtcgtcgtcctcgacttcggcgccgacctcctcgtagtccttctccagcgcggcgagg 57560

                         
Query: 268   tcctccctggcc 279
             ||||||||||||
Sbjct: 57561 tcctccctggcc 57572



to top

>dbj|AK071837.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023117K20, full
            insert sequence
          Length = 1584

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 47/48 (97%)
 Strand = Plus / Minus

                                                            
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1377 ccgacctcctcgtagtccttctccagcgcggcgaggtcctccctggcc 1330



to top

>emb|AJ276012.1|HVU276012 Hordeum vulgare partial mRNA for alpha-tubulin 4 (atub4 gene)
          Length = 1050

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 223 ccctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
           ||||| || |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 830 ccctctgcgccgacctcctcgtagtccttctccagggcggccaggtcctc 781



to top

>emb|AJ586804.1| Setaria viridis tua1 gene for alpha tubulin, exons 1-4
          Length = 2372

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 223  ccctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||| |||||||||||||||||||||||||| || |||||||||||
Sbjct: 2328 ccctcagcgccgacctcctcgtagtccttctccagggccgccaggtcctc 2279



to top

>gb|AC137924.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0095K08,
              complete sequence
          Length = 180999

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Plus

                                                       
Query: 232    ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
              |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 115693 ccgacctcctcgtagtccttctccagcgcggcgaggtcctc 115733



to top

>emb|X91807.1|OSTA136 O.sativa mRNA for alpha-tubulin (clone OSTA-136)
          Length = 1677

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1388 ccgacctcctcgtagtccttctccagcgcggcgaggtcctc 1348



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                        
Query: 232     ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
               |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 7882255 ccgacctcctcgtagtccttctccagcgcggcgaggtcctc 7882215



to top

>dbj|AK105080.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-A05, full
           insert sequence
          Length = 359

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 232 ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
           |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 85  ccgacctcctcgtagtccttctccagcgcggcgaggtcctc 45



to top

>dbj|AK102560.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033097H22, full
            insert sequence
          Length = 1760

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1398 ccgacctcctcgtagtccttctccagcgcggcgaggtcctc 1358



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                        
Query: 232     ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
               |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 7952342 ccgacctcctcgtagtccttctccagcgcggcgaggtcctc 7952302



to top

>gb|BT016755.1| Zea mays clone Contig588 mRNA sequence
          Length = 1906

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                    
Query: 233  cgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1460 cgacctcctcgtagtccttctccagggcggccaggtcctc 1421



to top

>gb|BT016625.1| Zea mays clone Contig458 mRNA sequence
          Length = 1771

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 1419 ctcagcaccgacctcctcgtagtccttctcgagcgccgccaggtcctc 1372



to top

>gb|BT017959.1| Zea mays clone EL01N0523A02.c mRNA sequence
          Length = 668

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 225 ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
           |||||| ||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 282 ctcagcaccgacctcctcgtagtccttctcgagcgccgccaggtcctc 235



to top

>emb|X15704.1|ZMALPTUB Zea mays tandem genes for alpha1-tubulin and alpha2-tubulin
          Length = 9244

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 8849 ctcagcaccgacctcctcgtagtccttctcgagcgccgccaggtcctc 8802



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||| ||||| ||||| |||||
Sbjct: 4985 ctcagcaccaacctcctcgtagtccttctcgagcgctgccagatcctc 4938



to top

>emb|X63176.1|ZMALTUB3 Z.mays mRNA for alpha-tubulin 3
          Length = 1708

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                    
Query: 233  cgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1406 cgacctcctcgtagtccttctccagggcggccaggtcctc 1367



to top

>emb|AJ586805.1| Setaria viridis tua2 gene for alpha tubulin, exons 1-4
          Length = 2616

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 2518 ctcagcgccgacctcctcgtagtccttctcgagcgcagccaggtcctc 2471



to top

>dbj|AB036814.1| Chlorella vulgaris tubA mRNA for alpha-tubulin, partial cds
          Length = 690

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 225 ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
           |||||| |||||||||||||||||||||||||| || |||||||||||
Sbjct: 409 ctcagcgccgacctcctcgtagtccttctccagggcagccaggtcctc 362



to top

>gb|AY103579.1| Zea mays PCO151041 mRNA sequence
          Length = 1764

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                    
Query: 233  cgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1467 cgacctcctcgtagtccttctccagggcggccaggtcctc 1428



to top

>gb|M60171.1|MZETUBA Zea mays alpha-3-tubulin gene, complete cds
          Length = 4397

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                    
Query: 233  cgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 3516 cgacctcctcgtagtccttctccagggcggccaggtcctc 3477



to top

>gb|AF255561.1|AF255561 Notothenia coriiceps alpha tubulin mRNA, partial cds
          Length = 733

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||||||||||||||| ||||||| |||||| ||||||
Sbjct: 557 acctcctcgtagtccttctccagggcggccatgtcctctctggcc 513



to top

>gb|U92645.1|GLU92645 Gecarcinus lateralis alpha-1-tubulin mRNA, complete cds
          Length = 1935

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||||||||||||||||| |||||||| |||||| ||||||
Sbjct: 1365 acctcctcgtagtccttctccaacgcggccaagtcctctctggcc 1321



to top

>gb|BT016539.1| Zea mays clone Contig372 mRNA sequence
          Length = 1712

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 1436 ctcagcaccgacctcctcgtagtccttctcgagcgcagccagatcctc 1389



to top

>gb|BT016903.1| Zea mays clone Contig736 mRNA sequence
          Length = 571

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 225 ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
           |||||| ||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 271 ctcagcaccgacctcctcgtagtccttctcgagcgcagccagatcctc 318



to top

>gb|AY508717.1| Laodelphax striatellus alpha 1-tubulin mRNA, complete cds
          Length = 1550

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctccct 275
            ||||| |||||||||||||||||||| ||||||| |||||||||
Sbjct: 1433 ccgacttcctcgtagtccttctccagagcggccaagtcctccct 1390



to top

>emb|X86079.1|SCTUB1A S.commune tub-1A gene
          Length = 2588

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                    
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcct 271
            ||||||||||||||||||||||||||||| || |||||||
Sbjct: 2037 ccgacctcctcgtagtccttctccagcgccgcaaggtcct 1998



to top

>gb|AY103544.1| Zea mays PCO076329 mRNA sequence
          Length = 1967

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 1543 ctcagcaccgacctcctcgtagtccttctcaagcgccgccagatcctc 1496



to top

>gb|U58641.1|PFU58641 Pelvetia fastigiata alpha-tubulin mRNA, clone PTalpha1, complete cds
          Length = 1747

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgc 260
            ||||||||||||||| ||||||||||||||||||||
Sbjct: 1390 ctcagctccgacctcttcgtagtccttctccagcgc 1355



to top

>gb|BT024131.1| Zea mays clone EL01N0448H02 mRNA sequence
          Length = 1514

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                           
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcct 271
            |||||| |||||||||||||||||||| || ||||| ||||||||||
Sbjct: 1207 ctcagcaccgacctcctcgtagtccttttcgagcgccgccaggtcct 1161



to top

>gb|AF082027.1| Notothenia coriiceps alpha tubulin (GTalphaC) and alpha tubulin
            (GTbalphaA) genes, complete cds; and alpha tubulin
            (GTbalphaB) gene, partial cds
          Length = 10727

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| ||||||||||| || |||||||| ||||||| |||||||||||||
Sbjct: 5897 ctccaacctcctcgtaatctttctccagagcggccatgtcctccctggcc 5946



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| ||||||||||| || |||||||| ||||||| |||||| ||||||
Sbjct: 3276 ctccaacctcctcgtaatctttctccagagcggccatgtcctctctggcc 3227



to top

>emb|CR695348.2|CNS0FZHC Tetraodon nigroviridis full-length cDNA
          Length = 1519

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1375 ctcccacctcctcgtaatccttctccagagctgccatgtcctccctggcc 1326



to top

>emb|CR688765.2|CNS0FUEH Tetraodon nigroviridis full-length cDNA
          Length = 1526

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1398 ctcccacctcctcgtaatccttctccagagctgccatgtcctccctggcc 1349



to top

>emb|CR684455.2|CNS0FR2R Tetraodon nigroviridis full-length cDNA
          Length = 1516

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1387 ctcccacctcctcgtaatccttctccagagctgccatgtcctccctggcc 1338



to top

>emb|BX061027.1|CNS09J93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 227 ccgacctcctcgtaatccttctccagcgcggcca 260



to top

>emb|BX061200.1|CNS09JDW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 233 ccgacctcctcgtaatccttctccagcgcggcca 266



to top

>emb|BX044537.1|CNS096J1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC18BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 240 ccgacctcctcgtaatccttctccagcgcggcca 273



to top

>emb|BX041329.1|CNS0941X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 251 ccgacctcctcgtaatccttctccagcgcggcca 284



to top

>emb|BX026756.1|CNS08ST4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 220 ccgacctcctcgtaatccttctccagcgcggcca 253



to top

>emb|BX022059.1|CNS08P6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 242 ccgacctcctcgtaatccttctccagcgcggcca 275



to top

>emb|BX018245.1|CNS08M8P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 569

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 231 ccgacctcctcgtaatccttctccagcgcggcca 264



to top

>emb|BX015702.1|CNS08KA2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 247 ccgacctcctcgtaatccttctccagcgcggcca 280



to top

>emb|BX014360.1|CNS08J8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 114

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 232 ccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||| |||||||||||||||||||
Sbjct: 74  ccgacctcctcgtaatccttctccagcgcggcca 107



to top

>gb|AF255562.1|AF255562 Notothenia coriiceps alpha tubulin mRNA, complete cds
          Length = 1536

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| ||||||||||| || |||||||| ||||||| |||||||||||||
Sbjct: 1362 ctccaacctcctcgtaatctttctccagagcggccatgtcctccctggcc 1313



to top

>gb|AF255560.1|AF255560 Notothenia coriiceps alpha tubulin mRNA, partial cds
          Length = 1062

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 226 tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           |||||||| ||||||||||| || |||||||| ||||||| |||||| ||||||
Sbjct: 932 tcagctccaacctcctcgtaatctttctccagagcggccatgtcctctctggcc 879



to top

>ref|XM_309723.2| Anopheles gambiae str. PEST ENSANGP00000002667 (ENSANGG00000002212),
            partial mRNA
          Length = 1353

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 232  ccgacctcctcgtagtccttctccagcgcggcca 265
            |||||||||||||| |||||||||||||||||||
Sbjct: 1307 ccgacctcctcgtaatccttctccagcgcggcca 1274



to top

>dbj|D16504.1|CHLTUA1 Chlorella vulgaris tua1 gene for alpha-tubulin, complete cds
          Length = 5077

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||| ||||||||||||||||| ||||||||||||||
Sbjct: 4643 acctcttcgtagtccttctccagggcggccaggtcctc 4606



to top

>ref|XM_414991.1| PREDICTED: Gallus gallus similar to tubulin alpha-3 chain - chicken
           (fragment) (LOC416695), mRNA
          Length = 825

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           |||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 785 acctcctcataatccttctccagggcagccaggtcctccctggcc 741



to top

>ref|XM_414990.1| PREDICTED: Gallus gallus similar to Hypothetical protein MGC69264
            (LOC416694), mRNA
          Length = 1876

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 1377 acctcctcataatccttctccagggcagccaggtcctccctggcc 1333



to top

>gb|AF455115.1| Trypanosoma cruzi alpha tubulin mRNA, complete cds
          Length = 1749

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||| ||||| || |||||
Sbjct: 1352 ccgacctcctcgtagtccttctccagggcggcgagatcctc 1312



to top

>gb|AY182002.1| Chlamydomonas reinhardtii alpha tubulin-2 gene, complete cds
          Length = 1792

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||| ||||||||||||| || |||||||||||
Sbjct: 1743 ccgacctcctcgaagtccttctccagggcagccaggtcctc 1703



to top

>ref|XM_797406.1| Trypanosoma cruzi strain CL Brener alpha tubulin
            (Tc00.1047053411235.9) partial mRNA
          Length = 1356

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||| ||||| || |||||
Sbjct: 1307 ccgacctcctcgtagtccttctccagggcggcgagatcctc 1267



to top

>emb|CR732697.2|CNS0GSAL Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR732182.2|CNS0GRWB Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR711696.2|CNS0GC3G Tetraodon nigroviridis full-length cDNA
          Length = 573

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 289 acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 245



to top

>emb|CR725161.2|CNS0GMHB Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR723578.2|CNS0GL9C Tetraodon nigroviridis full-length cDNA
          Length = 1363

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1303 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1259



to top

>emb|CR720335.2|CNS0GIR9 Tetraodon nigroviridis full-length cDNA
          Length = 358

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 78  acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 34



to top

>emb|CR719023.2|CNS0GHQT Tetraodon nigroviridis full-length cDNA
          Length = 1359

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR718721.2|CNS0GHIF Tetraodon nigroviridis full-length cDNA
          Length = 1447

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 1169 acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 1125



to top

>emb|CR715696.2|CNS0GF6K Tetraodon nigroviridis full-length cDNA
          Length = 1629

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 1359 acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 1315



to top

>emb|CR714456.2|CNS0GE84 Tetraodon nigroviridis full-length cDNA
          Length = 1441

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 1169 acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 1125



to top

>emb|CR714452.2|CNS0GE80 Tetraodon nigroviridis full-length cDNA
          Length = 1633

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 1361 acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 1317



to top

>emb|CR712506.2|CNS0GCPY Tetraodon nigroviridis full-length cDNA
          Length = 1633

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 1361 acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 1317



to top

>emb|CR713080.2|CNS0GD5W Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 609 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 565



to top

>emb|CR711238.2|CNS0GBQQ Tetraodon nigroviridis full-length cDNA
          Length = 536

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 328 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 284



to top

>gb|DQ450538.1| Trypanosoma cyclops beta tubulin gene, partial cds; alpha tubulin
            gene, complete cds; and beta tubulin gene, partial cds
          Length = 3876

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 2117 ccgacctcctcgtagtccttctcgagggcggcaaggtcctc 2077



to top

>emb|CR705383.2|CNS0G783 Tetraodon nigroviridis full-length cDNA
          Length = 573

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| ||||||| |||||||| ||||
Sbjct: 292 acctcctcgtaatccttctccagagcggccatgtcctcccgggcc 248



to top

>emb|CR700121.2|CNS0G35X Tetraodon nigroviridis full-length cDNA
          Length = 1426

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1330 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1286



to top

>emb|CR698293.2|CNS0G1R5 Tetraodon nigroviridis full-length cDNA
          Length = 971

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 911 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 867



to top

>emb|CR694522.2|CNS0FYUE Tetraodon nigroviridis full-length cDNA
          Length = 1541

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| || ||||||||||| ||||||| |||||||||||||
Sbjct: 1394 acctcctcataatccttctccagagcggccatgtcctccctggcc 1350



to top

>emb|CR693716.2|CNS0FY80 Tetraodon nigroviridis full-length cDNA
          Length = 1361

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1303 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1259



to top

>emb|CR694076.1|CNS0FYI0 Tetraodon nigroviridis full-length cDNA
          Length = 1373

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR688815.2|CNS0FUFV Tetraodon nigroviridis full-length cDNA
          Length = 970

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 910 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 866



to top

>emb|CR686078.2|CNS0FSBU Tetraodon nigroviridis full-length cDNA
          Length = 1361

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1304 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1260



to top

>emb|CR685355.2|CNS0FRRR Tetraodon nigroviridis full-length cDNA
          Length = 968

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 908 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 864



to top

>emb|CR683675.2|CNS0FQH3 Tetraodon nigroviridis full-length cDNA
          Length = 766

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 709 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 665



to top

>emb|CR677878.2|CNS0FM0E Tetraodon nigroviridis full-length cDNA
          Length = 1359

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR672515.2|CNS0FHVT Tetraodon nigroviridis full-length cDNA
          Length = 1358

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR669356.2|CNS0FFG2 Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR665919.2|CNS0FCSL Tetraodon nigroviridis full-length cDNA
          Length = 1359

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR663313.2|CNS0FAS7 Tetraodon nigroviridis full-length cDNA
          Length = 1359

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|CR660191.2|CNS0F8DH Tetraodon nigroviridis full-length cDNA
          Length = 1358

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1301 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1257



to top

>emb|CR642960.2|CNS0EV2U Tetraodon nigroviridis full-length cDNA
          Length = 1359

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| ||||||||||| || |||| |||||||||||||
Sbjct: 1302 acctcctcgtaatccttctccagagcagccatgtcctccctggcc 1258



to top

>emb|X86080.1|SCTUB1B S.commune tub-1B gene
          Length = 2296

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||| || ||||| |||||
Sbjct: 2091 ccgacctcctcgtagtccttctccagagccgccagatcctc 2051



to top

>emb|X07442.1|GGTUBA3C Chicken alpha 3 tubulin gene exon 4
          Length = 1380

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 1085 acctcctcataatccttctccagggcagccaggtcctccctggcc 1041



to top

>gb|BC089547.1| Mus musculus tubulin, alpha 3, mRNA (cDNA clone MGC:107295
            IMAGE:6771690), complete cds
          Length = 1526

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1362 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1318



to top

>dbj|AK132775.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4922505K03 product:tubulin, alpha 3, full
            insert sequence
          Length = 1494

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1376 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1332



to top

>dbj|AK006344.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:1700025I19 product:tubulin alpha 7, full
            insert sequence
          Length = 1492

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1354 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1310



to top

>gb|BC110002.1| Bos taurus cDNA clone MGC:133894 IMAGE:8042009, complete cds
          Length = 1540

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| |||||||||||||| |||||||| |||| ||||
Sbjct: 1382 acctcctcgtaatccttctccagcgccgccaggtcttcccgggcc 1338



to top

>gb|AC158609.10| Mus musculus 6 BAC RP24-89F5 (Roswell Park Cancer Institute (C57BL/6J
            Male) Mouse BAC Library) complete sequence
          Length = 217329

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 5366 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 5410



to top

>gb|AC160000.9| Mus musculus 6 BAC RP24-340J19 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 198476

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 235   acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
             ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 77506 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 77462



to top

>emb|BX935067.2| Gallus gallus finished cDNA, clone ChEST71i11
          Length = 1876

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 1377 acctcctcataatccttctccagggcagccaggtcctccctggcc 1333



to top

>ref|NM_009449.2| Mus musculus tubulin, alpha 7 (Tuba7), mRNA
          Length = 1514

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1352 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1308



to top

>dbj|AK106047.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-E08, full
            insert sequence
          Length = 1685

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||||||||| |||||||| || |||||
Sbjct: 1373 ccgacctcctcgtagtccttctcgagcgcggcgagatcctc 1333



to top

>gb|AC171018.2| Gallus gallus BAC clone CH261-11F14 from chromosome ul, complete sequence
          Length = 216886

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                           
Query: 235    acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
              |||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 168026 acctcctcataatccttctccagggcagccaggtcctccctggcc 168070



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                           
Query: 235    acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
              |||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 164671 acctcctcataatccttctccagggcagccaggtcctccctggcc 164627



to top

>gb|BC050769.1| Mus musculus tubulin, alpha 7, mRNA (cDNA clone MGC:58314
            IMAGE:6771187), complete cds
          Length = 1514

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1352 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1308



to top

>gb|BC050770.1| Mus musculus tubulin, alpha 3, mRNA (cDNA clone MGC:58315
            IMAGE:6774775), complete cds
          Length = 1510

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1362 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1318



to top

>ref|NM_001038163.1| Bos taurus similar to Tubulin alpha-3 chain (Alpha-tubulin 3)
            (MGC133894), mRNA
          Length = 1540

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||||||||| |||||||||||||| |||||||| |||| ||||
Sbjct: 1382 acctcctcgtaatccttctccagcgccgccaggtcttcccgggcc 1338



to top

>gb|U92646.1|GLU92646 Gecarcinus lateralis alpha-2-tubulin mRNA, complete cds
          Length = 1524

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||| ||||| || ||||||||||||||
Sbjct: 1311 ccgacctcctcgtagtctttctcgagggcggccaggtcctc 1271



to top

>ref|NM_009446.1| Mus musculus tubulin, alpha 3 (Tuba3), mRNA
          Length = 1482

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1364 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1320



to top

>gb|AC114921.5| Mus musculus BAC clone RP23-202P9 from 6, complete sequence
          Length = 207908

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                           
Query: 235    acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
              ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 147461 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 147417



to top

>gb|AC140324.3| Mus musculus BAC clone RP23-402K14 from 6, complete sequence
          Length = 200190

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                           
Query: 235    acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
              ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 104758 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 104714



to top

>gb|M96849.1|TRBBEALTUB Trypanosoma cruzi beta and alpha tubulin genes, 3'end and complete
            cds
          Length = 4243

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||| ||||| || |||||
Sbjct: 3507 ccgacctcctcgtagtccttctccagggcggcgagatcctc 3467



to top

>gb|M97956.1|TRBBEALTU Trypanosoma cruzi beta tubulin and alpha tubulin genes, complete cds
          Length = 4243

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||| ||||| || |||||
Sbjct: 3507 ccgacctcctcgtagtccttctccagggcggcgagatcctc 3467



to top

>gb|M13443.1|MUSTUBA7M Mouse alpha-tubulin isotype M-alpha-7 mRNA, complete cds
          Length = 1424

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1343 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1299



to top

>gb|M13442.1|MUSTUBA3M Mouse alpha-tubulin isotype M-alpha-3 mRNA, complete cds
          Length = 1482

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            ||||| || ||||||||||||||||| ||||||||||||| ||||
Sbjct: 1364 acctcttcatagtccttctccagcgctgccaggtcctcccgggcc 1320



to top

>gb|M11448.1|CRETBA2A Chlamydomonas reinhardtii alpha-2 tubulin gene, complete cds
          Length = 2150

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||| ||||||||||||| || |||||||||||
Sbjct: 1904 ccgacctcctcgaagtccttctccagggcagccaggtcctc 1864



to top

>gb|M11447.1|CRETBA1A Chlamydomonas reinhardtii alpha-1 tubulin gene, complete cds
          Length = 2246

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 232  ccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||| ||||||||||||| || |||||||||||
Sbjct: 1883 ccgacctcctcgaagtccttctccagggcagccaggtcctc 1843



to top

>gb|BT016741.1| Zea mays clone Contig574 mRNA sequence
          Length = 1677

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||| ||||| ||||| |||||
Sbjct: 1432 ctcagcaccaacctcctcgtagtccttctcgagcgctgccagatcctc 1385



to top

>ref|XM_426592.1| PREDICTED: Gallus gallus similar to tubulin, alpha 2; tubulin alpha 2
            (LOC429035), mRNA
          Length = 2004

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccc 274
            ||||||||||| ||||||||||| ||||||| ||||||||
Sbjct: 1490 acctcctcgtaatccttctccagggcggccatgtcctccc 1451



to top

>ref|XM_422048.1| PREDICTED: Gallus gallus similar to tubulin alpha-5 chain - chicken
            (LOC424201), mRNA
          Length = 1686

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctccc 274
            ||||||||||| ||||||||||| ||||||| ||||||||
Sbjct: 1643 acctcctcgtaatccttctccagggcggccatgtcctccc 1604



to top

>gb|AC135228.5| Oryza sativa chromosome 3 BAC OSJNBb0122C16 genomic sequence, complete
             sequence
          Length = 129440

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 225   ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
             |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 66917 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 66870



to top

>gb|AY702009.1| Leishmania donovani strain MHOM/IN/1983/AG83 alpha tubulin mRNA,
           partial cds
          Length = 1128

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 225 ctcagctccgacctcctcgtagtccttctccagcgc 260
           |||||| || ||||||||||||||||||||||||||
Sbjct: 708 ctcagcgccaacctcctcgtagtccttctccagcgc 673



to top

>gb|AC145380.3| Oryza sativa chromosome 3 BAC OSJNBa0013A09 genomic sequence, complete
              sequence
          Length = 139788

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                              
Query: 225    ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
              |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 120898 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 120945



to top

>ref|XM_750739.1| Aspergillus fumigatus Af293 tubulin subunit alpha-2 (Afu2g14990)
            partial mRNA
          Length = 1356

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 233  cgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||| |||||||||||||  ||||||||||||||
Sbjct: 1312 cgacctcctcatagtccttctccaaagcggccaggtcctc 1273



to top

>emb|CR708388.2|CNS0G9JK Tetraodon nigroviridis full-length cDNA
          Length = 762

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccc 274
           ||||||||||| ||||||||||| ||||||| ||||||||
Sbjct: 481 acctcctcgtaatccttctccagagcggccatgtcctccc 442



to top

>emb|CR707988.2|CNS0G98G Tetraodon nigroviridis full-length cDNA
          Length = 535

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccc 274
           ||||||||||| ||||||||||| ||||||| ||||||||
Sbjct: 251 acctcctcgtaatccttctccagagcggccatgtcctccc 212



to top

>emb|CR706879.2|CNS0G8DN Tetraodon nigroviridis full-length cDNA
          Length = 979

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccc 274
           ||||||||||| ||||||||||| ||||||| ||||||||
Sbjct: 707 acctcctcgtaatccttctccagagcggccatgtcctccc 668



to top

>emb|CR706253.2|CNS0G7W9 Tetraodon nigroviridis full-length cDNA
          Length = 704

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 235 acctcctcgtagtccttctccagcgcggccaggtcctccc 274
           ||||||||||| ||||||||||| ||||||| ||||||||
Sbjct: 419 acctcctcgtaatccttctccagagcggccatgtcctccc 380



to top

>gb|DQ129864.1| Leishmania donovani chagasi strain MHOM/BR/00/1669 alpha-tubulin
            (Tub) gene, complete cds
          Length = 1356

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgc 260
            |||||| || ||||||||||||||||||||||||||
Sbjct: 1314 ctcagcgccaacctcctcgtagtccttctccagcgc 1279



to top

>emb|X73980.1|ZMTUA4 Z.mays mRNA for alpha-tubulin
          Length = 959

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 225 ctcagctccgacctcctcgtagtccttctccagcgc 260
           |||||| ||||||||||||||||||||||| |||||
Sbjct: 729 ctcagcaccgacctcctcgtagtccttctcgagcgc 694



to top

>emb|X12846.1|VCTUBA1 Volvox carteri alpha-1 tubulin gene
          Length = 3153

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| |||||||||||| ||||||||||||| || ||||| |||||
Sbjct: 2467 ctcagcgccgacctcctcgaagtccttctccagagctgccagatcctc 2420



to top

>emb|AJ005599.1|EIAJ5599 Eleusine indica mRNA for alpha-tubulin 1 (EiRtua1), complete cds
          Length = 1577

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| || || || ||||||||
Sbjct: 1389 ctcagcgccgacctcctcgtagtccttctcaagggcagcaaggtcctc 1342



to top

>emb|AJ005598.1|EIAJ5598 Eleusine indica mRNA for alpha-tubulin 1 (EiStua1), complete cds
          Length = 1636

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| || || || ||||||||
Sbjct: 1408 ctcagcgccgacctcctcgtagtccttctcaagggcagcaaggtcctc 1361



to top

>emb|AJ420856.1|ZMA420856 Zea mays partial mRNA for alpha tubulin (tua4 gene)
          Length = 630

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 225 ctcagctccgacctcctcgtagtccttctccagcgc 260
           |||||| ||||||||||||||||||||||| |||||
Sbjct: 400 ctcagcaccgacctcctcgtagtccttctcgagcgc 365



to top

>gb|AF182523.1|AF182523 Oryza sativa alpha-tubulin (TubA1) gene, promoter and complete cds
          Length = 4305

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 3609 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 3562



to top

>dbj|AK119638.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F05, full
            insert sequence
          Length = 1721

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 1439 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 1392



to top

>dbj|AK119520.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-D01, full
            insert sequence
          Length = 1367

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 1085 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 1038



to top

>dbj|AK119362.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-131-G09, full
            insert sequence
          Length = 1721

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 1439 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 1392



to top

>dbj|AK119247.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-121-C05, full
            insert sequence
          Length = 1721

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 1439 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 1392



to top

>dbj|AK102194.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087C05, full
            insert sequence
          Length = 1745

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| || |||||||||||||||||||||| |||||| || |||||
Sbjct: 1440 ctcagcgccaacctcctcgtagtccttctccaacgcggcgagatcctc 1393



to top

>gb|AF008120.1|AF008120 Eleusine indica alpha tubulin 1 (TUA1) mRNA, complete cds
          Length = 1693

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| ||||||||||||||||||||||| || || || ||||||||
Sbjct: 1409 ctcagcgccgacctcctcgtagtccttctcaagggcagcaaggtcctc 1362



to top

>gb|AF032876.1| Chloromonas sp. ANT1 alpha-tubulin (tuba) gene, complete cds
          Length = 3158

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| |||||||||||| ||||||||||||| || || ||||||||
Sbjct: 2679 ctcagcaccgacctcctcgaagtccttctccagggcagcgaggtcctc 2632



to top

>gb|AF032877.1| Chloromonas sp. ANT3 alpha-tubulin (tuba1) gene, complete cds
          Length = 2909

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||| |||||||| ||| ||||||||||||| |||||||| |||||
Sbjct: 2278 ctcagcaccgacctcttcgaagtccttctccagtgcggccagatcctc 2231



to top

>gb|U58642.1|PFU58642 Pelvetia fastigiata alpha-tubulin mRNA, clone PTalpha2, complete cds
          Length = 1706

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 225  ctcagctccgacctcctcgtagtccttctccagcgc 260
            ||||||||| ||||| ||||||||||||||||||||
Sbjct: 1384 ctcagctccaacctcttcgtagtccttctccagcgc 1349



to top

>gb|M98863.1|SLMALTA Physarum polycephalum alpha-tubulin (altA) mRNA, complete cds
          Length = 1431

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 229  gctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||||||||||||||| || ||||| || |||||
Sbjct: 1336 gctccgacctcctcgtagtccttctcgagggcggcgagatcctc 1293



to top

>gb|AF465697.1| Oikopleura dioica putative alpha-tubulin (TUBAG) gene, complete cds
          Length = 1959

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 231  tccgacctcctcgtagtccttctccagcgcggcca 265
            |||||||||||||||||||||||| || |||||||
Sbjct: 1917 tccgacctcctcgtagtccttctcgagggcggcca 1883



to top

>emb|BX072077.1|CNS09RS1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 149 tccgacctcctcgtagtccttctcgagggcggcca 183



to top

>emb|BX071990.1|CNS09RPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 182 tccgacctcctcgtagtccttctcgagggcggcca 216



to top

>emb|BX070180.1|CNS09QBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 278

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 120 tccgacctcctcgtagtccttctcgagggcggcca 154



to top

>emb|BX069758.1|CNS09PZM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 202 tccgacctcctcgtagtccttctcgagggcggcca 236



to top

>emb|BX068311.1|CNS09OVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 437

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 195 tccgacctcctcgtagtccttctcgagggcggcca 229



to top

>emb|BX067110.1|CNS09NY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 62  tccgacctcctcgtagtccttctcgagggcggcca 96



to top

>emb|BX067109.1|CNS09NY1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 703 tccgacctcctcgtagtccttctcgagggcggcca 669



to top

>emb|BX066140.1|CNS09N74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 203 tccgacctcctcgtagtccttctcgagggcggcca 237



to top

>emb|BX065135.1|CNS09MF7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 358

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 201 tccgacctcctcgtagtccttctcgagggcggcca 235



to top

>emb|BX063463.1|CNS09L4R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 189 tccgacctcctcgtagtccttctcgagggcggcca 223



to top

>emb|BX062158.1|CNS09K4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 197 tccgacctcctcgtagtccttctcgagggcggcca 231



to top

>emb|BX062157.1|CNS09K4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 996 tccgacctcctcgtagtccttctcgagggcggcca 962



to top

>emb|BX060128.1|CNS09IK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 199 tccgacctcctcgtagtccttctcgagggcggcca 233



to top

>emb|BX054935.1|CNS09EJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 118 tccgacctcctcgtagtccttctcgagggcggcca 152



to top

>emb|BX053543.1|CNS09DH7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 193 tccgacctcctcgtagtccttctcgagggcggcca 227



to top

>emb|BX053542.1|CNS09DH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 732 tccgacctcctcgtagtccttctcgagggcggcca 698



to top

>emb|BX048167.1|CNS099BV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 213 tccgacctcctcgtagtccttctcgagggcggcca 247



to top

>emb|BX047471.1|CNS098SJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 211 tccgacctcctcgtagtccttctcgagggcggcca 245



to top

>emb|BX043014.1|CNS095CQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 206

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 94  tccgacctcctcgtagtccttctcgagggcggcca 128



to top

>emb|BX038834.1|CNS0924M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 233 tccgacctcctcgtagtccttctcgagggcggcca 267



to top

>emb|BX038833.1|CNS0924L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 629 tccgacctcctcgtagtccttctcgagggcggcca 595



to top

>emb|BX037081.1|CNS090RX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 193 tccgacctcctcgtagtccttctcgagggcggcca 227



to top

>emb|BX034269.1|CNS08YLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 219 tccgacctcctcgtagtccttctcgagggcggcca 253



to top

>emb|BX032231.1|CNS08X17 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 145 tccgacctcctcgtagtccttctcgagggcggcca 179



to top

>emb|BX030829.1|CNS08VY9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 200 tccgacctcctcgtagtccttctcgagggcggcca 234



to top

>emb|BX026828.1|CNS08SV4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 544

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 191 tccgacctcctcgtagtccttctcgagggcggcca 225



to top

>emb|BX026451.1|CNS08SKN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 184 tccgacctcctcgtagtccttctcgagggcggcca 218



to top

>emb|BX024049.1|CNS08QPX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 202 tccgacctcctcgtagtccttctcgagggcggcca 236



to top

>emb|BX020290.1|CNS08NTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 197 tccgacctcctcgtagtccttctcgagggcggcca 231



to top

>emb|BX016722.1|CNS08L2E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 527

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 226 tccgacctcctcgtagtccttctcgagggcggcca 260



to top

>emb|BX015447.1|CNS08K2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 182 tccgacctcctcgtagtccttctcgagggcggcca 216



to top

>emb|BX012893.1|CNS08I41 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 193 tccgacctcctcgtagtccttctcgagggcggcca 227



to top

>emb|BX007997.1|CNS08EC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 170 tccgacctcctcgtagtccttctcgagggcggcca 204



to top

>emb|BX007024.1|CNS08DL0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 777

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 193 tccgacctcctcgtagtccttctcgagggcggcca 227



to top

>emb|BX006882.1|CNS08DH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 193 tccgacctcctcgtagtccttctcgagggcggcca 227



to top

>emb|BX006069.1|CNS08CUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 231 tccgacctcctcgtagtccttctccagcgcggcca 265
           |||||||||||||||||||||||| || |||||||
Sbjct: 201 tccgacctcctcgtagtccttctcgagggcggcca 235



to top

>emb|Z22877.1|EGATUBMR E.gracilis alpha-tubulin mRNA encoding tubulin
          Length = 1536

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 235  acctcctcgtagtccttctccagcgcggcca 265
            ||||||||||||||||||||||| |||||||
Sbjct: 1333 acctcctcgtagtccttctccagggcggcca 1303



to top

>ref|NM_001025879.1| Caenorhabditis elegans C47B2.3 (Tubulin) mRNA, complete cds
          Length = 1739

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||| |||||||||||||| || || |||| ||||||
Sbjct: 1577 tcagctccgacctcttcgtagtccttctcgagagcagccaagtcctc 1531



to top

>gb|AF182553.1|AF182553 Euglena gracilis alpha-tubulin mRNA, complete cds
          Length = 1519

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 235  acctcctcgtagtccttctccagcgcggcca 265
            ||||||||||||||||||||||| |||||||
Sbjct: 1321 acctcctcgtagtccttctccagggcggcca 1291



to top

>gb|AF182557.1|AF182557 Euglena gracilis alpha-tubulin gene, complete cds
          Length = 2711

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 235  acctcctcgtagtccttctccagcgcggcca 265
            ||||||||||||||||||||||| |||||||
Sbjct: 2099 acctcctcgtagtccttctccagggcggcca 2069



to top

>gb|AF182556.1|AF182556 Euglena gracilis alpha-tubulin gene, complete cds
          Length = 5167

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 235  acctcctcgtagtccttctccagcgcggcca 265
            ||||||||||||||||||||||| |||||||
Sbjct: 3206 acctcctcgtagtccttctccagggcggcca 3176



to top

>gb|AF182309.1|AF182309 Euglena gracilis alpha-tubulin mRNA, complete cds
          Length = 1519

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 235  acctcctcgtagtccttctccagcgcggcca 265
            ||||||||||||||||||||||| |||||||
Sbjct: 1321 acctcctcgtagtccttctccagggcggcca 1291



to top

>dbj|D14965.1|CELALPHA2T Caenorhabditis elegans gene for alpha-2 tubulin, complete cds
          Length = 2900

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||| |||||||||||||| || || |||| ||||||
Sbjct: 2190 tcagctccgacctcttcgtagtccttctcgagagcagccaagtcctc 2144



to top

>emb|Z99709.1|CEC47B2 Caenorhabditis elegans Cosmid C47B2, complete sequence
          Length = 28871

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
            |||||||||||||| |||||||||||||| || || |||| ||||||
Sbjct: 5141 tcagctccgacctcttcgtagtccttctcgagagcagccaagtcctc 5187



to top

>gb|AY855263.1| Pectinaria gouldii alpha tubulin mRNA, partial cds
          Length = 679

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 230 ctccgacctcctcgtagtccttctccagcgcggccaggtcctc 272
           |||||||||| ||||||||||||||||| || ||||| |||||
Sbjct: 512 ctccgacctcttcgtagtccttctccagggcagccagatcctc 470



to top

>ref|XM_507378.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1699_E05.40 mRNA
          Length = 1727

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccaggtcc 270
            ||||||||| ||||||| || ||||| ||||| ||||||||||| || || |||| ||||
Sbjct: 1429 tcgtcgtctgcaccctcggcgccgacttcctcatagtccttctcaagggcagccaagtcc 1370

              
Query: 271  tc 272
            ||
Sbjct: 1369 tc 1368



to top

>ref|XM_478815.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1628

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccaggtcc 270
            ||||||||| ||||||| || ||||| ||||| ||||||||||| || || |||| ||||
Sbjct: 1450 tcgtcgtctgcaccctcggcgccgacttcctcatagtccttctcaagggcagccaagtcc 1391

              
Query: 271  tc 272
            ||
Sbjct: 1390 tc 1389



to top

>ref|XM_506424.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1699_E05.40 mRNA
          Length = 1647

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccaggtcc 270
            ||||||||| ||||||| || ||||| ||||| ||||||||||| || || |||| ||||
Sbjct: 1457 tcgtcgtctgcaccctcggcgccgacttcctcatagtccttctcaagggcagccaagtcc 1398

              
Query: 271  tc 272
            ||
Sbjct: 1397 tc 1396



to top

>gb|AC186561.1| Gasterosteus aculeatus clone VMRC28-125N12, complete sequence
          Length = 147166

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 230    ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
              ||||||||||||| || ||||||||||| || |||| |||||| ||||||
Sbjct: 107766 ctccgacctcctcataatccttctccagagctgccatgtcctctctggcc 107717



to top

>emb|AJ133710.1|MTR133710 Miscanthus sinensis tua1 gene for alpha-tubulin
          Length = 3069

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcgtcgtcttcaccctcagctccgacctcctcgtagtccttctccagcgcggccaggtcc 270
            ||||| ||| ||||||| || ||||||||||| ||||||||||| || || |||| ||||
Sbjct: 3002 tcgtcatctgcaccctctgcgccgacctcctcatagtccttctcaagagcagccaagtcc 2943

              
Query: 271  tc 272
            ||
Sbjct: 2942 tc 2941



to top

>emb|CR732300.2|CNS0GRZL Tetraodon nigroviridis full-length cDNA
          Length = 1581

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1419 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1370



to top

>emb|CR730004.2|CNS0GQ7U Tetraodon nigroviridis full-length cDNA
          Length = 1483

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1409 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1356



to top

>emb|CR727214.2|CNS0GO2C Tetraodon nigroviridis full-length cDNA
          Length = 1572

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1413 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1364



to top

>emb|CR725972.2|CNS0GN3U Tetraodon nigroviridis full-length cDNA
          Length = 1509

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1392 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1343



to top

>emb|CR725925.2|CNS0GN2J Tetraodon nigroviridis full-length cDNA
          Length = 1496

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1371 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1322



to top

>emb|CR725251.2|CNS0GMJT Tetraodon nigroviridis full-length cDNA
          Length = 1493

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1412 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1359



to top

>emb|CR721980.2|CNS0GK0Y Tetraodon nigroviridis full-length cDNA
          Length = 1493

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1411 tcagctcctacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1358



to top

>gb|DQ450539.1| Trypanosoma grayi beta tubulin gene, partial cds; alpha tubulin gene,
            complete cds; and beta tubulin gene, partial cds
          Length = 3826

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 235  acctcctcgtagtccttctccagcgcggccaggtcctc 272
            ||||||||||||||||||||||| || || ||||||||
Sbjct: 2096 acctcctcgtagtccttctccagtgcagcaaggtcctc 2059



to top

>emb|CR704721.2|CNS0G6PP Tetraodon nigroviridis full-length cDNA
          Length = 1466

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1338 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1289



to top

>emb|CR704639.2|CNS0G6NF Tetraodon nigroviridis full-length cDNA
          Length = 1541

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1398 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1349



to top

>emb|CR704326.2|CNS0G6EQ Tetraodon nigroviridis full-length cDNA
          Length = 1585

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1421 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1372



to top

>emb|CR703191.2|CNS0G5J7 Tetraodon nigroviridis full-length cDNA
          Length = 1517

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1386 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1337



to top

>emb|CR703052.2|CNS0G5FC Tetraodon nigroviridis full-length cDNA
          Length = 1459

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1392 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1339



to top

>emb|CR702388.2|CNS0G4WW Tetraodon nigroviridis full-length cDNA
          Length = 1557

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1409 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1360



to top

>emb|CR702277.2|CNS0G4TT Tetraodon nigroviridis full-length cDNA
          Length = 1524

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1395 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1346



to top

>emb|CR702224.2|CNS0G4SC Tetraodon nigroviridis full-length cDNA
          Length = 1558

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1410 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1361



to top

>emb|CR701916.3|CNS0G4JS Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1386 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1337



to top

>emb|CR701694.2|CNS0G4DM Tetraodon nigroviridis full-length cDNA
          Length = 1212

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1079 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1030



to top

>emb|CR701674.2|CNS0G4D2 Tetraodon nigroviridis full-length cDNA
          Length = 1580

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1417 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1368



to top

>emb|CR701568.2|CNS0G4A4 Tetraodon nigroviridis full-length cDNA
          Length = 1576

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1412 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1363



to top

>emb|CR701314.2|CNS0G432 Tetraodon nigroviridis full-length cDNA
          Length = 1412

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1343 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1290



to top

>emb|CR700127.1|CNS0G363 Tetraodon nigroviridis full-length cDNA
          Length = 1463

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1398 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1345



to top

>emb|CR699445.2|CNS0G2N5 Tetraodon nigroviridis full-length cDNA
          Length = 1533

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1389 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1340



to top

>emb|CR691242.2|CNS0FWBA Tetraodon nigroviridis full-length cDNA
          Length = 1539

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1393 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1344



to top

>emb|CR691236.2|CNS0FWB4 Tetraodon nigroviridis full-length cDNA
          Length = 1533

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1390 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1341



to top

>emb|CR691232.2|CNS0FWB0 Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1345 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1296



to top

>emb|CR698796.2|CNS0G254 Tetraodon nigroviridis full-length cDNA
          Length = 1566

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1403 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1354



to top

>emb|CR698316.2|CNS0G1RS Tetraodon nigroviridis full-length cDNA
          Length = 1418

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1287 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1238



to top

>emb|CR698287.2|CNS0G1QZ Tetraodon nigroviridis full-length cDNA
          Length = 1532

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1390 ctcctacctcctcataatccttctccagagctgccatgtcctccctggcc 1341



to top

>emb|CR697176.2|CNS0G0W4 Tetraodon nigroviridis full-length cDNA
          Length = 518

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 230 ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 354 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 305



to top

>emb|CR695343.1|CNS0FZH7 Tetraodon nigroviridis full-length cDNA
          Length = 1577

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1419 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1370



to top

>emb|CR694734.2|CNS0FZ0A Tetraodon nigroviridis full-length cDNA
          Length = 1472

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1401 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1348



to top

>emb|CR694327.2|CNS0FYOZ Tetraodon nigroviridis full-length cDNA
          Length = 1537

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1409 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1360



to top

>emb|CR693718.1|CNS0FY82 Tetraodon nigroviridis full-length cDNA
          Length = 1526

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1385 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1336



to top

>emb|CR693676.2|CNS0FY6W Tetraodon nigroviridis full-length cDNA
          Length = 1127

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 230 ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 980 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 931



to top

>emb|CR693212.1|CNS0FXU0 Tetraodon nigroviridis full-length cDNA
          Length = 1002

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 230 ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
           |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 844 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 795



to top

>emb|CR693140.2|CNS0FXS0 Tetraodon nigroviridis full-length cDNA
          Length = 1537

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1394 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1345



to top

>emb|CR693076.2|CNS0FXQ8 Tetraodon nigroviridis full-length cDNA
          Length = 1572

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1409 ctcctacctcctcataatccttctccagagctgccatgtcctccctggcc 1360



to top

>emb|CR693029.2|CNS0FXOX Tetraodon nigroviridis full-length cDNA
          Length = 1517

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| ||||||||||| ||||||||||| || |||| ||| |||||||||
Sbjct: 1388 ctcccacctcctcgtaatccttctccagagctgccatgtcatccctggcc 1339



to top

>emb|CR692881.1|CNS0FXKT Tetraodon nigroviridis full-length cDNA
          Length = 1519

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1385 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1336



to top

>emb|CR692422.2|CNS0FX82 Tetraodon nigroviridis full-length cDNA
          Length = 1480

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1402 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1349



to top

>emb|CR691796.2|CNS0FWQO Tetraodon nigroviridis full-length cDNA
          Length = 1501

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1393 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1344



to top

>emb|CR691778.2|CNS0FWQ6 Tetraodon nigroviridis full-length cDNA
          Length = 1516

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1385 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1336



to top

>emb|CR691638.2|CNS0FWMA Tetraodon nigroviridis full-length cDNA
          Length = 1530

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1396 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1347



to top

>emb|CR692064.1|CNS0FWY4 Tetraodon nigroviridis full-length cDNA
          Length = 1484

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1368 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1319



to top

>emb|CR691108.2|CNS0FW7K Tetraodon nigroviridis full-length cDNA
          Length = 1532

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1397 ctcccacctcctcataatccttctccagagccgccatgtcctccctggcc 1348



to top

>emb|CR686004.1|CNS0FS9S Tetraodon nigroviridis full-length cDNA
          Length = 1509

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1385 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1336



to top

>emb|CR685809.2|CNS0FS4D Tetraodon nigroviridis full-length cDNA
          Length = 1093

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1011 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 958



to top

>emb|CR690899.2|CNS0FW1R Tetraodon nigroviridis full-length cDNA
          Length = 1515

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1386 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1337



to top

>emb|CR688364.2|CNS0FU3C Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1351 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1302



to top

>emb|CR688326.2|CNS0FU2A Tetraodon nigroviridis full-length cDNA
          Length = 1468

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 226  tcagctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||||||| ||||||||||| ||||||||||| || |||| ||| || ||||||
Sbjct: 1399 tcagctcccacctcctcgtaatccttctccagggctgccatgtcttctctggcc 1346



to top

>emb|CR690059.2|CNS0FVEF Tetraodon nigroviridis full-length cDNA
          Length = 1515

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1383 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1334



to top

>emb|CR689902.2|CNS0FVA2 Tetraodon nigroviridis full-length cDNA
          Length = 1537

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1402 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1353



to top

>emb|CR689722.2|CNS0FV52 Tetraodon nigroviridis full-length cDNA
          Length = 1519

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1388 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1339



to top

>emb|CR689495.2|CNS0FUYR Tetraodon nigroviridis full-length cDNA
          Length = 1527

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1398 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1349



to top

>emb|CR689411.2|CNS0FUWF Tetraodon nigroviridis full-length cDNA
          Length = 1495

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1365 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1316



to top

>emb|CR689202.2|CNS0FUQM Tetraodon nigroviridis full-length cDNA
          Length = 1567

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1411 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1362



to top

>emb|CR689093.1|CNS0FUNL Tetraodon nigroviridis full-length cDNA
          Length = 1493

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1378 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1329



to top

>emb|CR687517.2|CNS0FTFT Tetraodon nigroviridis full-length cDNA
          Length = 1473

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1367 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1318



to top

>emb|CR687239.2|CNS0FT83 Tetraodon nigroviridis full-length cDNA
          Length = 1529

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 230  ctccgacctcctcgtagtccttctccagcgcggccaggtcctccctggcc 279
            |||| |||||||| || ||||||||||| || |||| |||||||||||||
Sbjct: 1398 ctcccacctcctcataatccttctccagagctgccatgtcctccctggcc 1349


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,542,658
Number of Sequences: 3902068
Number of extensions: 2542658
Number of successful extensions: 80916
Number of sequences better than 10.0: 667
Number of HSP's better than 10.0 without gapping: 670
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 79312
Number of HSP's gapped (non-prelim): 1595
length of query: 279
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 257
effective length of database: 17,147,199,772
effective search space: 4406830341404
effective search space used: 4406830341404
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top