ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet51g11 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 87.7 bits (44), Expect = 8e-15 Identities = 109/130 (83%), Gaps = 3/130 (2%) Strand = Plus / Minus Query: 19 catagaatattcataatttacatcgtggtagtacaactcagaccacacaacgacacactt 78 |||||||| ||||||| |||||| ||||||||||| ||| |||||||||| ||||||| Sbjct: 904 catagaattctcataatctacatcatggtagtacaaatcaaaccacacaacctcacactt 845 Query: 79 caccatg---ggtcttcaagacaccttacttgccgggaacgaagttggtggcgaatgccc 135 || |||| |||| | ||||||||| |||||||| |||||||| ||||| ||||||| Sbjct: 844 caacatgactagtctccgggacaccttatttgccggggacgaagtttgtggcaaatgccc 785 Query: 136 aagcattgtt 145 |||| ||||| Sbjct: 784 aagcgttgtt 775
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 83.8 bits (42), Expect = 1e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 92 caagacaccttacttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||||||||||||||||| || |||||||||||||||||||| |||||||| Sbjct: 819 caagacaccttacttgccggggacaaagttggtggcgaatgcccatgcattgtt 766 Score = 44.1 bits (22), Expect = 0.11 Identities = 31/34 (91%) Strand = Plus / Minus Query: 32 taatttacatcgtggtagtacaactcagaccaca 65 ||||||||||| || ||||||||||||| ||||| Sbjct: 883 taatttacatcatgatagtacaactcaggccaca 850
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 77.8 bits (39), Expect = 8e-12 Identities = 42/43 (97%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||||||||||||||||||| |||||||||||||| Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgtt 784
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 65.9 bits (33), Expect = 3e-08 Identities = 42/45 (93%) Strand = Plus / Minus Query: 101 ttacttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 975 ttacttgccggggacgaagttggtggcgaaggcccaggcattgtt 931
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 100 cttacttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||||||||| ||||||||||||||||| ||||| || ||||| Sbjct: 865 cttacttgccgggcacgaagttggtggcgaaggcccaggcgttgtt 820
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 58.0 bits (29), Expect = 8e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 105 ttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||||||||||||||| ||||||| || ||||| Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgtt 1808
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 2529
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 2529
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 809
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 767
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| ||||||| || ||||| Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgtt 79016
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| ||||||| || ||||| Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgtt 21808800
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | |||||||| ||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgtt 1766
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 754
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 809
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 93247 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgtt 96061
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 80955 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgtt 78141
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 754
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 754
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 754
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 805
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 805
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 805
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 805
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 805
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 805
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| ||||||| || ||||| Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgtt 21801829
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 786
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 125
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 786
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 789
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 88 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 130
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | |||||||| ||||| Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgtt 818
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgtt 1054
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| ||||||| || ||||| Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgtt 799
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| ||||||| || ||||| Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgtt 374
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | |||||||| ||||| Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgtt 1766
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 986 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||||||||||||||| |||||| | |||||||| ||||| Sbjct: 847 acttgccgggaacgaagttagtggcgtaagcccaagcgttgtt 805
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| ||||||| || ||||| Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgtt 788
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| |||||||| Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgtt 779
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||||| ||||| || ||||| Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgtt 1151
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 54.0 bits (27), Expect = 1e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||||| ||||| || ||||| Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgtt 1490
>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690 (LHCB2:4) mRNA, complete cds Length = 946 Score = 52.0 bits (26), Expect = 5e-04 Identities = 35/38 (92%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | |||||||||||||| Sbjct: 849 ccggggacgaagttggtggcgtaagcccaagcattgtt 812
>gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence Length = 510 Score = 52.0 bits (26), Expect = 5e-04 Identities = 35/38 (92%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | |||||||||||||| Sbjct: 402 ccggggacgaagttggtggcgtaagcccaagcattgtt 365
>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds Length = 801 Score = 52.0 bits (26), Expect = 5e-04 Identities = 35/38 (92%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | |||||||||||||| Sbjct: 794 ccggggacgaagttggtggcgtaagcccaagcattgtt 757
>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding protein (MGF10.9) mRNA, complete cds Length = 917 Score = 52.0 bits (26), Expect = 5e-04 Identities = 35/38 (92%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | |||||||||||||| Sbjct: 843 ccggggacgaagttggtggcgtaagcccaagcattgtt 806
>gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete sequence Length = 917 Score = 52.0 bits (26), Expect = 5e-04 Identities = 35/38 (92%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | |||||||||||||| Sbjct: 843 ccggggacgaagttggtggcgtaagcccaagcattgtt 806
>gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA, complete cds Length = 897 Score = 52.0 bits (26), Expect = 5e-04 Identities = 35/38 (92%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | |||||||||||||| Sbjct: 799 ccggggacgaagttggtggcgtaagcccaagcattgtt 762
>dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGF10 Length = 84702 Score = 52.0 bits (26), Expect = 5e-04 Identities = 35/38 (92%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | |||||||||||||| Sbjct: 31775 ccggggacgaagttggtggcgtaagcccaagcattgtt 31738
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding protein type I Length = 684 Score = 52.0 bits (26), Expect = 5e-04 Identities = 41/46 (89%) Strand = Plus / Minus Query: 100 cttacttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||||||||| ||||||||| | ||||| |||||||| Sbjct: 591 cttatttgccgggaacgaaattggtggcgtaggcccaggcattgtt 546
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 52.0 bits (26), Expect = 5e-04 Identities = 41/46 (89%) Strand = Plus / Minus Query: 100 cttacttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||||||||| ||||||||| | ||||| |||||||| Sbjct: 742 cttatttgccgggaacgaaattggtggcgtaggcccaggcattgtt 697
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 50.1 bits (25), Expect = 0.002 Identities = 40/45 (88%) Strand = Plus / Minus Query: 101 ttacttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||| ||||| ||||||||||| || || |||||||||||||| Sbjct: 807 ttactttccggggacgaagttggtcgcaaaagcccaagcattgtt 763
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 50.1 bits (25), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 105 ttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||| ||||||||||||||||| ||||| || ||||| Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgtt 827
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 826
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgtt 819
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 827
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 754
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 742
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 718
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgtt 428
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| ||||| || ||||| Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgtt 588
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 588
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| ||||| || ||||| Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgtt 2332
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 1203
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 813
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1042 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||||||||||||||| || || ||||| |||||||| Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgtt 832
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 760
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 826
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgtt 757
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgtt 819
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 813
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgtt 819
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 13920
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 760
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| |||||||||||||| || ||||| |||||||| Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgtt 799
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 812
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 760
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 826
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 826
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 806
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 812
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 826
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgtt 825
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 10793738
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 30025091 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 23604285
>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZE02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 307 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 172 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 130
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 795
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 519 actttccggggacgaagttggtagcgaaggcccatgcattgtt 477
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||| | |||||||| ||||| Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgtt 796
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 706
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 21081
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 19852 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Plus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 16155
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 827
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgtt 819
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1096 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||||||| ||||||||| | ||||| || ||||| Sbjct: 872 acttgccgggaacgaaattggtggcgtaggcccaggcgttgtt 830
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 17461
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 66984
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 130356
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgtt 2677
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 813
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 812
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 46.1 bits (23), Expect = 0.029 Identities = 32/35 (91%) Strand = Plus / Minus Query: 111 ggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||||||||||||| || ||||| |||||||| Sbjct: 863 ggaacgaagttggtggcaaaggcccaggcattgtt 829
>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA Length = 1152 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||| | ||||| |||||||| Sbjct: 962 actttccgggaacaaagttggtggcgtaagcccaggcattgtt 920
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||||| ||||| || ||||| Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgtt 2333
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 1242
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgtt 1057
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgtt 977
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgtt 905
>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding protein of photosystem II Length = 772 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||||||| |||||||| | ||||| |||||||| Sbjct: 705 acttgccgggaacgaaattggtggcataggcccaggcattgtt 663
>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein Length = 953 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| || ||||| |||||| |||||||||||||||| Sbjct: 858 actttccggggacaaagtttgtggcgtatgcccaagcattgtt 816
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 806
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 811
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 813
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 835
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 835
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| |||||||| Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgtt 757
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 837
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgtt 342
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 811
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 820
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 811
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgtt 837
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1011 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||||||| | ||||| || ||||| |||||||||||||| Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgtt 816
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||| ||| | ||||| |||||||| |||||||||||||| Sbjct: 814 acttgcctggagcaaagtttgtggcgaaggcccaagcattgtt 772
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 748 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||| ||||| |||||||||||||||| Sbjct: 621 actttccgggaacaaagtttgtggcatatgcccaagcattgtt 579
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| ||| ||| || ||||| Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgtt 780
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 46.1 bits (23), Expect = 0.029 Identities = 38/43 (88%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgtt 792
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 44.1 bits (22), Expect = 0.11 Identities = 34/38 (89%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| ||||||||||||||| | ||||| |||||||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgtt 855
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 44.1 bits (22), Expect = 0.11 Identities = 34/38 (89%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||||||||||||||||| | ||||| || ||||| Sbjct: 3017 ccgggaacgaagttggtggcgtaggcccatgcgttgtt 2980
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 44.1 bits (22), Expect = 0.11 Identities = 40/46 (86%) Strand = Plus / Minus Query: 100 cttacttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 1681 cttagttgccggggacgaagttggtggcgtaggcccatgcgttgtt 1636
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 44.1 bits (22), Expect = 0.11 Identities = 34/38 (89%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||| || ||||| |||||||| |||||||||||||| Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgtt 962
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 44.1 bits (22), Expect = 0.11 Identities = 34/38 (89%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcattgtt 145 ||||||||||||||||||||| | ||||| || ||||| Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgtt 802
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 42.1 bits (21), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 105 ttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgtt 820
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 42.1 bits (21), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 105 ttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgtt 829
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 42.1 bits (21), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 105 ttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||| ||||||||||||||| | ||||| || ||||| Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgtt 534
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 40.1 bits (20), Expect = 1.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 114 acgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||||| || ||||| |||||||| Sbjct: 661 acgaagttggtggcaaacgcccaggcattgtt 630
>gb|AC114321.2| Homo sapiens chromosome 5 clone RP11-710L15, complete sequence Length = 158109 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 22 agaatattcataatttacat 41 |||||||||||||||||||| Sbjct: 23377 agaatattcataatttacat 23358
>gb|AC122720.2| Homo sapiens chromosome 5 clone RP11-67M9, complete sequence Length = 160505 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 22 agaatattcataatttacat 41 |||||||||||||||||||| Sbjct: 128656 agaatattcataatttacat 128637
>gb|DP000004.1| Lemur catta target 1 genomic scaffold Length = 1399362 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 tgcatagaatattcataatt 36 |||||||||||||||||||| Sbjct: 279084 tgcatagaatattcataatt 279103
>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold Length = 1570569 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 tgcatagaatattcataatt 36 |||||||||||||||||||| Sbjct: 308536 tgcatagaatattcataatt 308555
>gb|AC123970.3| Lemur catta clone LB2-159J16, complete sequence Length = 183268 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 tgcatagaatattcataatt 36 |||||||||||||||||||| Sbjct: 13133 tgcatagaatattcataatt 13152
>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein (CipLhcb2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1033 Score = 40.1 bits (20), Expect = 1.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 114 acgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||||| | |||||||||||||| Sbjct: 841 acgaagttggtggcataagcccaagcattgtt 810
>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a, complete sequence Length = 48924 Score = 40.1 bits (20), Expect = 1.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 114 acgaagttggtggcgaatgcccaagcattgtt 145 |||||||| ||||| || |||||||||||||| Sbjct: 40690 acgaagttagtggcaaaagcccaagcattgtt 40659
>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb1 mRNA, complete cds Length = 801 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| ||| ||| |||||||| Sbjct: 799 actttccgggaacaaagttggtggcatatgaccatgcattgtt 757
>gb|AC103624.9| Mus musculus chromosome 5, clone RP24-258B22, complete sequence Length = 172330 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 11 tgattttgcatagaatatt 29 ||||||||||||||||||| Sbjct: 164128 tgattttgcatagaatatt 164146
>gb|AC103896.3| Papio anubis clone RP41-441D23, complete sequence Length = 156540 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 22 agaatattcataatttaca 40 ||||||||||||||||||| Sbjct: 138388 agaatattcataatttaca 138370
>gb|AC114459.6| Rattus norvegicus 4 BAC CH230-388N23 (Children's Hospital Oakland Research Institute) complete sequence Length = 190345 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 22 agaatattcataatttaca 40 ||||||||||||||||||| Sbjct: 50063 agaatattcataatttaca 50081
>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial sequence; nuclear gene for chloroplast product Length = 255 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| |||||||||||||| | ||||| |||||||| Sbjct: 183 acttcccgggcacgaagttggtggcataagcccaggcattgtt 141
>gb|AC068663.5| Mus musculus strain C57BL6/J chromosome 5 clone RP23-280D18, complete sequence Length = 221134 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 22 agaatattcataatttaca 40 ||||||||||||||||||| Sbjct: 209114 agaatattcataatttaca 209096
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || ||||| || ||||| Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgtt 809
>ref|XM_724503.1| Plasmodium yoelii yoelii str. 17XNL peptidyl prolyl cis-trans isomerase (PY01794) partial mRNA Length = 2700 Score = 38.2 bits (19), Expect = 7.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tttgcatagaatattcataattt 37 ||||| ||||||||||||||||| Sbjct: 1513 tttgcttagaatattcataattt 1491
>gb|AC069228.26| Homo sapiens 12 BAC RP11-315E17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 142687 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 gcatagaatattcataatt 36 ||||||||||||||||||| Sbjct: 62350 gcatagaatattcataatt 62368
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 38.2 bits (19), Expect = 7.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 105 ttgccgggaacgaagttggtggc 127 |||||||| |||||||||||||| Sbjct: 884 ttgccggggacgaagttggtggc 862
>gb|AC158232.2| Mus musculus BAC clone RP24-200M15 from chromosome 12, complete sequence Length = 187225 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 79 caccatgggtcttcaagac 97 ||||||||||||||||||| Sbjct: 170427 caccatgggtcttcaagac 170409
>gb|AC073840.8| Homo sapiens BAC clone RP11-429O22 from 4, complete sequence Length = 187640 Score = 38.2 bits (19), Expect = 7.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tttgcatagaatattcataattt 37 ||||||||||||||||| ||||| Sbjct: 182286 tttgcatagaatattcagaattt 182264
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 38.2 bits (19), Expect = 7.0 Identities = 38/43 (88%), Gaps = 1/43 (2%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| || |||||||| ||||| Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgtt 798
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 38.2 bits (19), Expect = 7.0 Identities = 38/43 (88%), Gaps = 1/43 (2%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 830 actttccggggacgaa-ttggtggcgaaggcccaagcgttgtt 789
>gb|AC023787.8| Homo sapiens BAC clone RP11-546M8 from 2, complete sequence Length = 144620 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 aagataaccatgattttgc 19 ||||||||||||||||||| Sbjct: 132694 aagataaccatgattttgc 132712
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 38.2 bits (19), Expect = 7.0 Identities = 28/31 (90%) Strand = Plus / Minus Query: 115 cgaagttggtggcgaatgcccaagcattgtt 145 |||||||||||||||| ||||| || ||||| Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgtt 665
>gb|AC092615.3| Homo sapiens BAC clone RP11-204D19 from 2, complete sequence Length = 180346 Score = 38.2 bits (19), Expect = 7.0 Identities = 22/23 (95%) Strand = Plus / Plus Query: 34 atttacatcgtggtagtacaact 56 |||||||||||||| |||||||| Sbjct: 78908 atttacatcgtggttgtacaact 78930
>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, complete cds; nuclear gene for chloroplast product Length = 941 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| || ||||| ||||| |||||||||||||||| Sbjct: 848 actttccggggacaaagtttgtggcatatgcccaagcattgtt 806
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||||||| | ||||| || ||||| Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgtt 806
>gb|AC035150.1|AC035150 Homo sapiens chromosome 19, BAC CIT978SKB_99E8 (BC67347), complete sequence Length = 90141 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 tgcatagaatattcataat 35 ||||||||||||||||||| Sbjct: 57748 tgcatagaatattcataat 57766
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| | ||||| |||||||| Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgtt 771
>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding protein Length = 2236 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||||||||| ||| ||| |||||||| Sbjct: 2115 actttccgggaacaaagttggtggcatatgaccatgcattgtt 2073
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 38.2 bits (19), Expect = 7.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 105 ttgccgggaacgaagttggtggc 127 |||||||| |||||||||||||| Sbjct: 1962 ttgccggggacgaagttggtggc 1940
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| ||||||||||| ||||| ||||| || ||||| Sbjct: 373 actttccggggacgaagttggtagcgaaggcccatgcgttgtt 331
>gb|AC150773.2| Xenopus tropicalis clone CH216-69F7, complete sequence Length = 115925 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 24 aatattcataatttacatc 42 ||||||||||||||||||| Sbjct: 75400 aatattcataatttacatc 75418
>gb|AC006213.1|AC006213 Homo sapiens, clone hRPK.15_A_1, complete sequence Length = 160754 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 tgcatagaatattcataat 35 ||||||||||||||||||| Sbjct: 64219 tgcatagaatattcataat 64201
>gb|AC174722.2| Mus musculus chromosome 5, clone wi1-1220K19, complete sequence Length = 33943 Score = 38.2 bits (19), Expect = 7.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 11 tgattttgcatagaatatt 29 ||||||||||||||||||| Sbjct: 33912 tgattttgcatagaatatt 33894
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||||||||| || |||||||||||| | ||||| || ||||| Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgtt 796
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| |||||||| ||||| ||||| | |||||||||||||| Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgtt 1508
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 38.2 bits (19), Expect = 7.0 Identities = 37/43 (86%) Strand = Plus / Minus Query: 103 acttgccgggaacgaagttggtggcgaatgcccaagcattgtt 145 |||| ||||| || ||||||||||| | |||||||||||||| Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgtt 948
>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3663 Score = 38.2 bits (19), Expect = 7.0 Identities = 31/35 (88%) Strand = Plus / Minus Query: 108 ccgggaacgaagttggtggcgaatgcccaagcatt 142 ||||| |||||||| ||||| ||||||||||||| Sbjct: 3342 ccggggacgaagtttgtggcatatgcccaagcatt 3308 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,087,986 Number of Sequences: 3902068 Number of extensions: 1087986 Number of successful extensions: 72641 Number of sequences better than 10.0: 174 Number of HSP's better than 10.0 without gapping: 173 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 72305 Number of HSP's gapped (non-prelim): 338 length of query: 146 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 125 effective length of database: 17,151,101,840 effective search space: 2143887730000 effective search space used: 2143887730000 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
