>emb|AL355140.25| Human DNA sequence from clone RP11-548B3 on chromosome 9 Contains the
             gene for Friedreich ataxia region gene X123, the 3' end of
             the APBA1 gene for myloid beta (A4) precursor
             protein-binding, family A, member 1 (X11), a novel gene
             and two CpG islands, complete sequence
          Length = 185096

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 46    aattaacatttcaagacaatct 67
             ||||||||||||||||||||||
Sbjct: 46899 aattaacatttcaagacaatct 46878

>gb|AC093562.3| Homo sapiens chromosome 1 clone RP11-553F10, complete sequence
          Length = 205171

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    tatgtactaatagcaaggcag 92
             |||||||||||||||||||||
Sbjct: 47238 tatgtactaatagcaaggcag 47258

>emb|AL359980.9| Human DNA sequence from clone RP5-1027O15 on chromosome 11, complete
             sequence
          Length = 83218

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 119   caaaatctcaaaaagatctct 139
             |||||||||||||||||||||
Sbjct: 32667 caaaatctcaaaaagatctct 32687

>ref|XM_966849.1| PREDICTED: Tribolium castaneum similar to CG14517-PA (LOC660633),
           mRNA
          Length = 909

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 199 ttgtgcatgtaattcagaaac 219
           |||||||||||||||||||||
Sbjct: 341 ttgtgcatgtaattcagaaac 321

>gb|AC106849.5| Homo sapiens chromosome 11, clone CTD-2154J7, complete sequence
          Length = 81277

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 119   caaaatctcaaaaagatctct 139
             |||||||||||||||||||||
Sbjct: 66343 caaaatctcaaaaagatctct 66363

>gb|AC110058.4| Homo sapiens chromosome 11, clone CTD2-3012A18, complete sequence
          Length = 158915

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 119   caaaatctcaaaaagatctct 139
             |||||||||||||||||||||
Sbjct: 39886 caaaatctcaaaaagatctct 39866

>gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 27343, complete genome
          Length = 1010023

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 119    caaaatctcaaaaagatctct 139
              |||||||||||||||||||||
Sbjct: 515690 caaaatctcaaaaagatctct 515710

>gb|AC021699.5|AC021699 Homo sapiens chromosome 11, clone RP11-277B22, complete sequence
          Length = 163386

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 119    caaaatctcaaaaagatctct 139
              |||||||||||||||||||||
Sbjct: 103893 caaaatctcaaaaagatctct 103913

>gb|AC110569.8| Mus musculus chromosome 15, clone RP23-309J17, complete sequence
          Length = 213398

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 45     aaattaacatttcaagacaa 64
              ||||||||||||||||||||
Sbjct: 211018 aaattaacatttcaagacaa 210999

>emb|AL357512.15| Human DNA sequence from clone RP11-541J2 on chromosome 1 Contains a
             nicotinamide nucleotide adenylyltransferase 1 (NMNAT1)
             pseudogene and a high-mobility group box 3 (HMGB3)
             pseudogene, complete sequence
          Length = 184024

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   aagtgacaaaatctcaaaaa 132
             ||||||||||||||||||||
Sbjct: 19760 aagtgacaaaatctcaaaaa 19741

>gb|AC153815.7| Mus musculus 6 BAC RP23-205F19 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 230983

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    cccacaatccttgctcccat 194
              ||||||||||||||||||||
Sbjct: 227067 cccacaatccttgctcccat 227086

>gb|AC162464.7| Mus musculus 6 BAC RP24-131E12 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 175087

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   cccacaatccttgctcccat 194
             ||||||||||||||||||||
Sbjct: 67969 cccacaatccttgctcccat 67988

>gb|AC078854.16| Homo sapiens 3q BAC RP11-480B17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 162313

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   tgggcttgtgcatgtaattc 213
             ||||||||||||||||||||
Sbjct: 96340 tgggcttgtgcatgtaattc 96359

>gb|AC139197.10| Mus musculus chromosome 15, clone RP24-119N11, complete sequence
          Length = 172693

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    aaattaacatttcaagacaa 64
             ||||||||||||||||||||
Sbjct: 63177 aaattaacatttcaagacaa 63158

>gb|AC012104.6|AC012104 Mus musculus chromosome , clone CT7-478J15, complete sequence
          Length = 124373

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    cccacaatccttgctcccat 194
              ||||||||||||||||||||
Sbjct: 116187 cccacaatccttgctcccat 116206

>dbj|AB113354.2| Sus scrofa 433 kb genomic segment, located between the non-classical
             and classical SLA class I gene cluster, clone: BAC 499E6
          Length = 154749

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   ctctaaggcctgccctgtga 155
             ||||||||||||||||||||
Sbjct: 83267 ctctaaggcctgccctgtga 83286

>gb|AC104867.18| Mus musculus chromosome 18, clone RP24-320L19, complete sequence
          Length = 148876

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   gtgacaaaatctcaaaaaga 134
             ||||||||||||||||||||
Sbjct: 59705 gtgacaaaatctcaaaaaga 59686

>gb|AC001226.1|AC001226 Genomic sequence from Human 13, complete sequence
          Length = 106988

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 28    gatgtcgttaagtctgtaaattaa 51
             |||||| |||||||||||||||||
Sbjct: 49530 gatgtctttaagtctgtaaattaa 49553


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,435,078
Number of Sequences: 3902068
Number of extensions: 2435078
Number of successful extensions: 46313
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46284
Number of HSP's gapped (non-prelim): 29
length of query: 251
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 229
effective length of database: 17,147,199,772
effective search space: 3926708747788
effective search space used: 3926708747788
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)