| Clone Name | rbaet51a01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, complete sequence Length = 219825 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 cagagccacatgcaccacgg 142 |||||||||||||||||||| Sbjct: 121552 cagagccacatgcaccacgg 121533
>emb|AL606907.9| Mouse DNA sequence from clone RP23-230F2 on chromosome 4, complete sequence Length = 208265 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 cagagccacatgcaccacgg 142 |||||||||||||||||||| Sbjct: 109991 cagagccacatgcaccacgg 109972
>gb|AC151775.1| Ornithorhynchus anatinus chromosome UNK clone OABb-307A1, complete sequence Length = 195598 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 cttatacaccacagagcaa 50 ||||||||||||||||||| Sbjct: 192783 cttatacaccacagagcaa 192801
>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence Length = 2107794 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 132 atgcaccacggcatccacg 150 ||||||||||||||||||| Sbjct: 1266407 atgcaccacggcatccacg 1266425
>gb|AC113280.12| Mus musculus chromosome 1, clone RP23-391E12, complete sequence Length = 217982 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 tacaccacagagcaatagt 54 ||||||||||||||||||| Sbjct: 110212 tacaccacagagcaatagt 110194
>gb|AC020912.6| Homo sapiens chromosome 19 clone CTD-2583G20, complete sequence Length = 163225 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 112 agatacattagcagagcca 130 ||||||||||||||||||| Sbjct: 12583 agatacattagcagagcca 12565
>dbj|AK051419.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130047L09 product:unclassifiable, full insert sequence Length = 3511 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 84 tgacactgaaacaggctac 102 ||||||||||||||||||| Sbjct: 2257 tgacactgaaacaggctac 2239
>gb|AE009511.1| Brucella melitensis 16M chromosome I, section 68 of 195 of the complete sequence Length = 8159 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 132 atgcaccacggcatccacg 150 ||||||||||||||||||| Sbjct: 4404 atgcaccacggcatccacg 4386
>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome Length = 4202352 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 90 tgaaacaggctaccatcca 108 ||||||||||||||||||| Sbjct: 2658411 tgaaacaggctaccatcca 2658393
>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence Length = 2124241 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 132 atgcaccacggcatccacg 150 ||||||||||||||||||| Sbjct: 1284373 atgcaccacggcatccacg 1284391
>ref|XM_319428.2| Anopheles gambiae str. PEST ENSANGP00000014413 (ENSANGG00000011924), partial mRNA Length = 1177 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 82 tttgacactgaaacaggct 100 ||||||||||||||||||| Sbjct: 925 tttgacactgaaacaggct 943
>gb|AC104921.9| Mus musculus chromosome 7, clone RP23-474B13, complete sequence Length = 182487 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 84 tgacactgaaacaggctac 102 ||||||||||||||||||| Sbjct: 148572 tgacactgaaacaggctac 148590
>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain 2308 Length = 2121359 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 132 atgcaccacggcatccacg 150 ||||||||||||||||||| Sbjct: 1281523 atgcaccacggcatccacg 1281541
>gb|U01149.1|QUCSRC3 Coturnix coturnix c-src protein (c-src) gene, complete cds Length = 2089 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 actttgacactgaaacagg 98 ||||||||||||||||||| Sbjct: 1872 actttgacactgaaacagg 1854
>dbj|D89171.1| Schizosaccharomyces pombe mRNA, partial cds, clone: SY 0720 Length = 1198 Score = 38.2 bits (19), Expect = 7.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 113 gatacattagcagagccac 131 ||||||||||||||||||| Sbjct: 603 gatacattagcagagccac 585 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 934,521 Number of Sequences: 3902068 Number of extensions: 934521 Number of successful extensions: 61215 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 15 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 61161 Number of HSP's gapped (non-prelim): 54 length of query: 152 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 131 effective length of database: 17,151,101,840 effective search space: 2246794341040 effective search space used: 2246794341040 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)