ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet50g05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC157216.2| Pan troglodytes BAC clone CH251-66E23 from chromo... 42 0.47
2gb|AC156804.2| Pan troglodytes BAC clone CH251-371A18 from chrom... 42 0.47
3emb|AL929240.18| Mouse DNA sequence from clone RP23-245A10 on ch... 42 0.47
4gb|AC154699.2| Mus musculus BAC clone RP24-344D19 from 9, comple... 42 0.47
5emb|CT030695.5| Mouse DNA sequence from clone RP23-259F10 on chr... 42 0.47
6gb|BC071509.1| Danio rerio TMEM9 domain family, member B, mRNA (... 40 1.9
7ref|NM_199732.2| Danio rerio TMEM9 domain family, member B (tmem... 40 1.9
8ref|NM_178659.3| Mus musculus jumonji domain containing 4 (Jmjd4... 40 1.9
9emb|AL592522.12| Mouse DNA sequence from clone RP23-210M6 on chr... 40 1.9
10dbj|AK145394.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 40 1.9
11dbj|AK148888.1| Mus musculus 2 days neonate sympathetic ganglion... 40 1.9
12dbj|AK032477.1| Mus musculus adult male olfactory brain cDNA, RI... 40 1.9
13dbj|AK052144.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 40 1.9
14dbj|AK079104.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 1.9
15dbj|AK038650.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 1.9
16gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete... 38 7.4
17gb|AC186002.3| Pan troglodytes BAC clone CH251-86D23 from chromo... 38 7.4
18gb|AC102299.11| Mus musculus chromosome 7, clone RP24-397O2, com... 38 7.4
19gb|AC185987.2| Pan troglodytes BAC clone CH251-400P17 from chrom... 38 7.4
20gb|AC183602.2| Pan troglodytes BAC clone CH251-350L8 from chromo... 38 7.4
21gb|AC182459.3| Pan troglodytes BAC clone CH251-706C19 from chrom... 38 7.4
22emb|CT009698.8| Mouse DNA sequence from clone RP23-117P22 on chr... 38 7.4
23gb|AC131710.3| Mus musculus BAC clone RP23-187M22 from 15, compl... 38 7.4
24gb|AC124120.5| Mus musculus chromosome 1, clone RP24-64M13, comp... 38 7.4
25emb|AL772307.15| Human DNA sequence from clone RP11-416B15 on ch... 38 7.4
26emb|AL772155.6| Human DNA sequence from clone RP11-149F8 on chro... 38 7.4
27emb|AL591438.6| Human DNA sequence from clone RP11-452D2 on chro... 38 7.4
28emb|AL591479.3| Human DNA sequence from clone RP11-154P18 on chr... 38 7.4
29gb|AC183605.3| Pan troglodytes BAC clone CH251-334E18 from chrom... 38 7.4
30emb|AL592220.6| Human DNA sequence from clone RP11-12P21 on chro... 38 7.4
31gb|BC041865.1| Homo sapiens cDNA clone IMAGE:5271374 38 7.4
32dbj|AB084078.1| Haliotis discus hannai DNA, microsatellite marke... 38 7.4
33gb|AC104821.4| Homo sapiens BAC clone RP11-745L13 from 4, comple... 38 7.4
34emb|CR478352.2| Mouse DNA sequence from clone WI1-1892F9 on chro... 38 7.4
35emb|CR382287.6| Human DNA sequence from clone bP-21216K13 on chr... 38 7.4
36emb|CR382285.2| Human DNA sequence from clone bP-21201H5 on chro... 38 7.4
37gb|AC128693.8| Homo sapiens 3 BAC RP13-563D5 (Roswell Park Cance... 38 7.4
38gb|AC091196.6| Homo sapiens chromosome 11, clone RP11-371C18, co... 38 7.4
39gb|AC154478.2| Mus musculus BAC clone RP24-135B17 from 16, compl... 38 7.4
40gb|AC154759.2| Mus musculus BAC clone RP24-408G4 from 14, comple... 38 7.4
41gb|AE003816.4| Drosophila melanogaster chromosome 2R, section 34... 38 7.4
42emb|AL162252.17| Human DNA sequence from clone RP11-55J24 on chr... 38 7.4
43gb|AC159269.3| Mus musculus BAC clone RP23-426N14 from chromosom... 38 7.4
44gb|AC156573.3| Mus musculus BAC clone RP23-133P6 from chromosome... 38 7.4
45emb|AL672003.6| Mouse DNA sequence from clone RP23-285G5 on chro... 38 7.4
46emb|AL732559.9| Mouse DNA sequence from clone RP23-9A5 on chromo... 38 7.4 
>gb|AC157216.2| Pan troglodytes BAC clone CH251-66E23 from chromosome unknown, complete
              sequence
          Length = 165669

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 3      gacaggcacatgtaatggtaa 23
              |||||||||||||||||||||
Sbjct: 164356 gacaggcacatgtaatggtaa 164336
to top
>gb|AC156804.2| Pan troglodytes BAC clone CH251-371A18 from chromosome unknown, complete
              sequence
          Length = 232130

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 3      gacaggcacatgtaatggtaa 23
              |||||||||||||||||||||
Sbjct: 185108 gacaggcacatgtaatggtaa 185128
to top
>emb|AL929240.18| Mouse DNA sequence from clone RP23-245A10 on chromosome 2, complete
             sequence
          Length = 180092

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 27    atggtttgatgtacactgtac 47
             |||||||||||||||||||||
Sbjct: 52597 atggtttgatgtacactgtac 52617
to top
>gb|AC154699.2| Mus musculus BAC clone RP24-344D19 from 9, complete sequence
          Length = 150348

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 15     taatggtaattgatggtttga 35
              |||||||||||||||||||||
Sbjct: 142681 taatggtaattgatggtttga 142661
to top
>emb|CT030695.5| Mouse DNA sequence from clone RP23-259F10 on chromosome 9, complete
             sequence
          Length = 173589

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 15    taatggtaattgatggtttga 35
             |||||||||||||||||||||
Sbjct: 46396 taatggtaattgatggtttga 46376
to top
>gb|BC071509.1| Danio rerio TMEM9 domain family, member B, mRNA (cDNA clone MGC:86880
            IMAGE:6904275), complete cds
          Length = 1569

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 38   tacactgtacaatactatacacaa 61
            ||||||||||||||| ||||||||
Sbjct: 1188 tacactgtacaatacaatacacaa 1165
to top
>ref|NM_199732.2| Danio rerio TMEM9 domain family, member B (tmem9b), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 38   tacactgtacaatactatacacaa 61
            ||||||||||||||| ||||||||
Sbjct: 1188 tacactgtacaatacaatacacaa 1165
to top
>ref|NM_178659.3| Mus musculus jumonji domain containing 4 (Jmjd4), mRNA
          Length = 3904

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  tttgcagcacagcacaccac 127
            ||||||||||||||||||||
Sbjct: 2843 tttgcagcacagcacaccac 2824
to top
>emb|AL592522.12| Mouse DNA sequence from clone RP23-210M6 on chromosome 11 Contains the
              genes for two novel 7 transmembrane receptor (rhodopsin
              family) domain-containing proteins, a high mobility group
              box 1 (Hmgb1) pseudogene, the Cias1 gene for cold
              autoinflammatory syndrome 1 homolog (human), a novel gene
              (4933439C10Rik), the gene for a novel protein (D130067D09),
              a ribosomal protein L18 (Rpl18) pseudogene, an ariadne
              homolog 2 (Drosophila) (Arih2) pseudogene, the gene for a
              novel zinc finger domain-containing protein, the 3' end of
              the gene for a novel protein and one CpG island, complete
              sequence
          Length = 157300

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 108    tttgcagcacagcacaccac 127
              ||||||||||||||||||||
Sbjct: 152821 tttgcagcacagcacaccac 152840
to top
>dbj|AK145394.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:I0C0034A12 product:hypothetical
            protein, full insert sequence
          Length = 4322

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  tttgcagcacagcacaccac 127
            ||||||||||||||||||||
Sbjct: 2863 tttgcagcacagcacaccac 2844
to top
>dbj|AK148888.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
           full-length enriched library, clone:7120459P04
           product:hypothetical protein, full insert sequence
          Length = 1824

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 108 tttgcagcacagcacaccac 127
           ||||||||||||||||||||
Sbjct: 607 tttgcagcacagcacaccac 588
to top
>dbj|AK032477.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430559I23 product:hypothetical
            jmjC domain containing protein, full insert sequence
          Length = 4333

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  tttgcagcacagcacaccac 127
            ||||||||||||||||||||
Sbjct: 2773 tttgcagcacagcacaccac 2754
to top
>dbj|AK052144.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length enriched
            library, clone:D230050M15 product:hypothetical jmjC
            domain containing protein, full insert sequence
          Length = 3251

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  tttgcagcacagcacaccac 127
            ||||||||||||||||||||
Sbjct: 2835 tttgcagcacagcacaccac 2816
to top
>dbj|AK079104.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330196M01 product:hypothetical jmjC
            domain containing protein, full insert sequence
          Length = 3904

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  tttgcagcacagcacaccac 127
            ||||||||||||||||||||
Sbjct: 2843 tttgcagcacagcacaccac 2824
to top
>dbj|AK038650.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched
            library, clone:A230052H09 product:inferred: unnamed
            protein product {Homo sapiens}, full insert sequence
          Length = 3536

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 108  tttgcagcacagcacaccac 127
            ||||||||||||||||||||
Sbjct: 2342 tttgcagcacagcacaccac 2323
to top
>gb|AC007852.9| Drosophila melanogaster clone BACR33A10, complete sequence
          Length = 186333

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 9      cacatgtaatggtaattga 27
              |||||||||||||||||||
Sbjct: 101174 cacatgtaatggtaattga 101192
to top
>gb|AC186002.3| Pan troglodytes BAC clone CH251-86D23 from chromosome 9, complete
              sequence
          Length = 162651

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    ttatttgcagcacagcaca 123
              |||||||||||||||||||
Sbjct: 144652 ttatttgcagcacagcaca 144670
to top
>gb|AC102299.11| Mus musculus chromosome 7, clone RP24-397O2, complete sequence
          Length = 167677

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    ttccttcatcaacataagg 94
             |||||||||||||||||||
Sbjct: 30552 ttccttcatcaacataagg 30534
to top
>gb|AC185987.2| Pan troglodytes BAC clone CH251-400P17 from chromosome 9, complete
             sequence
          Length = 161307

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 16360 ttatttgcagcacagcaca 16378
to top
>gb|AC183602.2| Pan troglodytes BAC clone CH251-350L8 from chromosome 9, complete
             sequence
          Length = 165959

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 24709 ttatttgcagcacagcaca 24727
to top
>gb|AC182459.3| Pan troglodytes BAC clone CH251-706C19 from chromosome 4, complete
              sequence
          Length = 166951

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    ttatttgcagcacagcaca 123
              |||||||||||||||||||
Sbjct: 141208 ttatttgcagcacagcaca 141226
to top
>emb|CT009698.8| Mouse DNA sequence from clone RP23-117P22 on chromosome 16, complete
             sequence
          Length = 210485

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   cagcacagcacaccacacc 130
             |||||||||||||||||||
Sbjct: 62163 cagcacagcacaccacacc 62181
to top
>gb|AC131710.3| Mus musculus BAC clone RP23-187M22 from 15, complete sequence
          Length = 224591

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 134   tgcatagagatcatgggtg 152
             |||||||||||||||||||
Sbjct: 16840 tgcatagagatcatgggtg 16858
to top
>gb|AC124120.5| Mus musculus chromosome 1, clone RP24-64M13, complete sequence
          Length = 242227

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 44    gtacaatactatacacaaa 62
             |||||||||||||||||||
Sbjct: 89189 gtacaatactatacacaaa 89207
to top
>emb|AL772307.15| Human DNA sequence from clone RP11-416B15 on chromosome 9 Contains a
             pseudogene similar to part of ribosomal protein L7a
             (RPL7A) and a CpG island, complete sequence
          Length = 161380

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 79369 ttatttgcagcacagcaca 79351
to top
>emb|AL772155.6| Human DNA sequence from clone RP11-149F8 on chromosome 9 Contains a novel
              gene, two novel pseudogenes, a  pseudogene similar to part
              of myosin V family protein, a tumor suppressor deleted in
              oral cancer-related 1 (DOC-1R) pseudogene, a pseudogene
              similar to part of prostaglandin E receptor 4 (subtype EP4)
              (PTGER4) and a CpG island, complete sequence
          Length = 163569

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    ttatttgcagcacagcaca 123
              |||||||||||||||||||
Sbjct: 135383 ttatttgcagcacagcaca 135401
to top
>emb|AL591438.6| Human DNA sequence from clone RP11-452D2 on chromosome 9 Contains a
             pseudogene similar to part of ribosomal protein L7a
             (RPL7A), a novel pseudogene and a CpG island, complete
             sequence
          Length = 176097

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 76957 ttatttgcagcacagcaca 76975
to top
>emb|AL591479.3| Human DNA sequence from clone RP11-154P18 on chromosome 9 Contains two
             novel pseudogene, a CDRT15 protein pseudogene, a
             pseudogene similar to part of meprin A, alpha (PABA
             peptide hydrolase) (MEP1A) and two CpG islands, complete
             sequence
          Length = 178933

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 28085 ttatttgcagcacagcaca 28067
to top
>gb|AC183605.3| Pan troglodytes BAC clone CH251-334E18 from chromosome 4, complete
              sequence
          Length = 191017

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    ttatttgcagcacagcaca 123
              |||||||||||||||||||
Sbjct: 174665 ttatttgcagcacagcaca 174647
to top
>emb|AL592220.6| Human DNA sequence from clone RP11-12P21 on chromosome 9 Contains a tumor
              suppressor deleted in oral cancer-related 1 (DOC-1R)
              pseudogene, a novel pseudogene and a CpG island, complete
              sequence
          Length = 163556

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 105    ttatttgcagcacagcaca 123
              |||||||||||||||||||
Sbjct: 135397 ttatttgcagcacagcaca 135415
to top
>gb|BC041865.1| Homo sapiens cDNA clone IMAGE:5271374
          Length = 2593

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 105 ttatttgcagcacagcaca 123
           |||||||||||||||||||
Sbjct: 983 ttatttgcagcacagcaca 965
to top
>dbj|AB084078.1| Haliotis discus hannai DNA, microsatellite marker Hdh1761
          Length = 451

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 112 cagcacagcacaccacacc 130
           |||||||||||||||||||
Sbjct: 369 cagcacagcacaccacacc 387
to top
>gb|AC104821.4| Homo sapiens BAC clone RP11-745L13 from 4, complete sequence
          Length = 93879

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 73440 ttatttgcagcacagcaca 73422
to top
>emb|CR478352.2| Mouse DNA sequence from clone WI1-1892F9 on chromosome X, complete
            sequence
          Length = 28067

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 134  tgcatagagatcatgggtg 152
            |||||||||||||||||||
Sbjct: 5942 tgcatagagatcatgggtg 5960
to top
>emb|CR382287.6| Human DNA sequence from clone bP-21216K13 on chromosome 21, complete
             sequence
          Length = 278310

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 38478 ttatttgcagcacagcaca 38460
to top
>emb|CR382285.2| Human DNA sequence from clone bP-21201H5 on chromosome 21, complete
            sequence
          Length = 178865

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 105  ttatttgcagcacagcaca 123
            |||||||||||||||||||
Sbjct: 8470 ttatttgcagcacagcaca 8488
to top
>gb|AC128693.8| Homo sapiens 3 BAC RP13-563D5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 143617

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   cagcacagcacaccacacc 130
             |||||||||||||||||||
Sbjct: 86388 cagcacagcacaccacacc 86406
to top
>gb|AC091196.6| Homo sapiens chromosome 11, clone RP11-371C18, complete sequence
          Length = 132211

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   cagcacagcacaccacacc 130
             |||||||||||||||||||
Sbjct: 90840 cagcacagcacaccacacc 90858
to top
>gb|AC154478.2| Mus musculus BAC clone RP24-135B17 from 16, complete sequence
          Length = 178478

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 112    cagcacagcacaccacacc 130
              |||||||||||||||||||
Sbjct: 137972 cagcacagcacaccacacc 137990
to top
>gb|AC154759.2| Mus musculus BAC clone RP24-408G4 from 14, complete sequence
          Length = 145942

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     tacaatactatacacaaat 63
              |||||||||||||||||||
Sbjct: 114286 tacaatactatacacaaat 114268
to top
>gb|AE003816.4| Drosophila melanogaster chromosome 2R, section 34 of 73 of the complete
              sequence
          Length = 287287

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 9      cacatgtaatggtaattga 27
              |||||||||||||||||||
Sbjct: 229347 cacatgtaatggtaattga 229329
to top
>emb|AL162252.17| Human DNA sequence from clone RP11-55J24 on chromosome 9, complete
             sequence
          Length = 176845

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   ttatttgcagcacagcaca 123
             |||||||||||||||||||
Sbjct: 28432 ttatttgcagcacagcaca 28414
to top
>gb|AC159269.3| Mus musculus BAC clone RP23-426N14 from chromosome 12, complete
             sequence
          Length = 184137

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   cagcacagcacaccacacc 130
             |||||||||||||||||||
Sbjct: 85623 cagcacagcacaccacacc 85641
to top
>gb|AC156573.3| Mus musculus BAC clone RP23-133P6 from chromosome 15, complete sequence
          Length = 198278

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 134    tgcatagagatcatgggtg 152
              |||||||||||||||||||
Sbjct: 141081 tgcatagagatcatgggtg 141099
to top
>emb|AL672003.6| Mouse DNA sequence from clone RP23-285G5 on chromosome X, complete
              sequence
          Length = 221912

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 112    cagcacagcacaccacacc 130
              |||||||||||||||||||
Sbjct: 132880 cagcacagcacaccacacc 132898
to top
>emb|AL732559.9| Mouse DNA sequence from clone RP23-9A5 on chromosome 2, complete
             sequence
          Length = 167364

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    cttcatcaacataaggcca 97
             |||||||||||||||||||
Sbjct: 87591 cttcatcaacataaggcca 87609


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,444,523
Number of Sequences: 3902068
Number of extensions: 1444523
Number of successful extensions: 104111
Number of sequences better than 10.0: 46
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 103992
Number of HSP's gapped (non-prelim): 119
length of query: 154
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 132
effective length of database: 17,147,199,772
effective search space: 2263430369904
effective search space used: 2263430369904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top