ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet50f11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC182490.3| Pan troglodytes BAC clone CH251-430P12 from chrom... 42 0.47
2gb|AC120782.25| Pan troglodytes clone rp43-45g12, complete sequence 42 0.47
3gb|AC023194.9| Homo sapiens, clone RP11-216N21, complete sequence 42 0.47
4gb|AC073869.5| Homo sapiens BAC clone RP11-109E12 from 2, comple... 42 0.47
5gb|U88165.1| Caenorhabditis elegans cosmid F54C1, complete sequence 40 1.9
6emb|AL772197.12| Human DNA sequence from clone RP11-24O6 on chro... 40 1.9
7gb|AC113558.8| Homo sapiens chromosome 18, clone RP11-1130K19, c... 40 1.9
8gb|AC104810.5| Homo sapiens BAC clone RP11-641D2 from 4, complet... 40 1.9
9gb|AC128966.4| Rattus norvegicus BAC CH230-194D11 (Children's H... 40 1.9
10gb|AC009453.13|AC009453 Homo sapiens chromosome 18, clone RP11-5... 40 1.9
11gb|AC018804.9| Homo sapiens BAC clone RP11-397H17 from 2, comple... 40 1.9
12gb|AC104607.15| Drosophila melanogaster X BAC RP98-19G9 (Roswell... 40 1.9
13gb|AC130390.4| Drosophila melanogaster X BAC RP98-21O19 (Roswell... 40 1.9
14gb|AC097108.5| Homo sapiens BAC clone RP11-745K4 from 4, complet... 40 1.9
15gb|AE003448.4| Drosophila melanogaster chromosome X, section 32 ... 40 1.9
16gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome 38 7.4
17gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, comple... 38 7.4
18gb|AC160935.2| Mus musculus BAC clone RP23-456B7 from chromosome... 38 7.4
19gb|AC012162.11| Drosophila melanogaster clone BACR01N10, complet... 38 7.4
20gb|AC182769.3| Cavia porcellus clone CH234-278G5, complete sequence 38 7.4
21ref|XM_532130.2| PREDICTED: Canis familiaris similar to dynein, ... 38 7.4
22gb|AC117242.3| Mus musculus BAC clone RP24-151P1 from chromosome... 38 7.4
23gb|AC146564.2| Medicago truncatula clone mth2-67l12, complete se... 38 7.4
24gb|AC137510.33| Medicago truncatula clone mth2-8m7, complete seq... 38 7.4
25emb|AL445262.7| Human DNA sequence from clone RP11-9D14 on chrom... 38 7.4
26emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 38 7.4
27emb|AL844605.5| Mouse DNA sequence from clone RP24-115D19 on chr... 38 7.4
28dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 38 7.4
29gb|AC090338.6| Homo sapiens chromosome 18, clone RP11-704C2, com... 38 7.4
30gb|AC097634.2| Homo sapiens chromosome 3 clone RP11-154H23, comp... 38 7.4
31gb|AC015617.8| Homo sapiens, clone RP11-45H23, complete sequence 38 7.4
32gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 38 7.4
33emb|BX571675.5| Zebrafish DNA sequence from clone DKEY-235D17 in... 38 7.4
34gb|AC111139.19| Mus musculus chromosome 3, clone RP23-365L12, co... 38 7.4
35gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88... 38 7.4
36gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 38 7.4
37gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 38 7.4
38gb|AC157474.2| Mus musculus BAC clone RP24-565B5 from chromosome... 38 7.4
39gb|AC007339.8| Homo sapiens chromosome 16 clone RP11-305A7, comp... 38 7.4
40gb|AC016674.9| Homo sapiens BAC clone RP11-36C8 from 2, complete... 38 7.4
41dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 38 7.4
42dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 38 7.4
43emb|BX255962.9| Zebrafish DNA sequence from clone CH211-269C21 i... 38 7.4
44emb|BX897712.12| Zebrafish DNA sequence from clone CH211-146A9 i... 38 7.4
45emb|BX469895.7| Zebrafish DNA sequence from clone DKEY-152C18 in... 38 7.4
46gb|AE003707.2| Drosophila melanogaster chromosome 3R, section 45... 38 7.4
47gb|AE003506.3| Drosophila melanogaster chromosome X, section 58 ... 38 7.4
48emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 38 7.4
49gb|AC125020.7| Mus musculus chromosome 12, clone RP24-181E5, com... 38 7.4
50gb|BC088723.1| Xenopus laevis hypothetical LOC496249, mRNA (cDNA... 38 7.4
51emb|BX005467.6| Mouse DNA sequence from clone RP23-74L11 on chro... 38 7.4
52emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 38 7.4
53dbj|AP006665.1| Lotus japonicus genomic DNA, chromosome 2, clone... 38 7.4
54emb|AL662901.18| Mouse DNA sequence from clone RP23-378G22 on ch... 38 7.4 
>gb|AC182490.3| Pan troglodytes BAC clone CH251-430P12 from chromosome 2, complete
              sequence
          Length = 158411

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 46     tacaacaattggcacaaataacagcatgtaact 78
              |||||||| | |||||||| |||||||||||||
Sbjct: 100377 tacaacaaattgcacaaatcacagcatgtaact 100409
to top
>gb|AC120782.25| Pan troglodytes clone rp43-45g12, complete sequence
          Length = 167170

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 46    tacaacaattggcacaaataacagcatgtaact 78
             |||||||| | |||||||| |||||||||||||
Sbjct: 44088 tacaacaaattgcacaaatcacagcatgtaact 44056
to top
>gb|AC023194.9| Homo sapiens, clone RP11-216N21, complete sequence
          Length = 175834

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 90    caaattgataaatgagagataaaat 114
             |||||||||||||||||| ||||||
Sbjct: 89089 caaattgataaatgagagctaaaat 89065
to top
>gb|AC073869.5| Homo sapiens BAC clone RP11-109E12 from 2, complete sequence
          Length = 195280

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 46     tacaacaattggcacaaataacagcatgtaact 78
              |||||||| | |||||||| |||||||||||||
Sbjct: 138998 tacaacaaattgcacaaatcacagcatgtaact 138966
to top
>gb|U88165.1| Caenorhabditis elegans cosmid F54C1, complete sequence
          Length = 31433

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 91    aaattgataaatgagagataaaat 114
             ||||||| ||||||||||||||||
Sbjct: 28407 aaattgaaaaatgagagataaaat 28430
to top
>emb|AL772197.12| Human DNA sequence from clone RP11-24O6 on chromosome X Contains the 5'
             end of the SH3KBP1 gene for SH3-domain kinase binding
             protein 1 (CIN85), two novel genes and one CpG island,
             complete sequence
          Length = 106342

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   aatgggatctggtggcatac 131
             ||||||||||||||||||||
Sbjct: 92537 aatgggatctggtggcatac 92518
to top
>gb|AC113558.8| Homo sapiens chromosome 18, clone RP11-1130K19, complete sequence
          Length = 165957

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    ataaatgagagataaaatgg 116
             ||||||||||||||||||||
Sbjct: 68546 ataaatgagagataaaatgg 68527
to top
>gb|AC104810.5| Homo sapiens BAC clone RP11-641D2 from 4, complete sequence
          Length = 165432

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     atgtaactaatttcagaagc 90
              ||||||||||||||||||||
Sbjct: 135692 atgtaactaatttcagaagc 135711
to top
>gb|AC128966.4| Rattus norvegicus  BAC CH230-194D11 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 214096

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    tttatttggttctggcttat 38
             ||||||||||||||||||||
Sbjct: 87023 tttatttggttctggcttat 87042
to top
>gb|AC009453.13|AC009453 Homo sapiens chromosome 18, clone RP11-59F14, complete sequence
          Length = 168947

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     ataaatgagagataaaatgg 116
              ||||||||||||||||||||
Sbjct: 162091 ataaatgagagataaaatgg 162110
to top
>gb|AC018804.9| Homo sapiens BAC clone RP11-397H17 from 2, complete sequence
          Length = 195514

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 46    tacaacaattggcacaaataacagcatgtaac 77
             |||||||| | |||||||| ||||||||||||
Sbjct: 28664 tacaacaaattgcacaaatcacagcatgtaac 28633
to top
>gb|AC104607.15| Drosophila melanogaster X BAC RP98-19G9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 137639

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 79    aatttcagaagcaaattgataaat 102
             ||||||| ||||||||||||||||
Sbjct: 58880 aatttcaaaagcaaattgataaat 58857
to top
>gb|AC130390.4| Drosophila melanogaster X BAC RP98-21O19 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 184175

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 79     aatttcagaagcaaattgataaat 102
              ||||||| ||||||||||||||||
Sbjct: 172634 aatttcaaaagcaaattgataaat 172611
to top
>gb|AC097108.5| Homo sapiens BAC clone RP11-745K4 from 4, complete sequence
          Length = 207516

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    atgtaactaatttcagaagc 90
             ||||||||||||||||||||
Sbjct: 22775 atgtaactaatttcagaagc 22794
to top
>gb|AE003448.4| Drosophila melanogaster chromosome X, section 32 of 74 of the complete
              sequence
          Length = 318665

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 79     aatttcagaagcaaattgataaat 102
              ||||||| ||||||||||||||||
Sbjct: 199523 aatttcaaaagcaaattgataaat 199500
to top
>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 20      ttatttggttctggcttat 38
               |||||||||||||||||||
Sbjct: 1424852 ttatttggttctggcttat 1424834
to top
>gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, complete sequence
          Length = 162139

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 99    aaatgagagataaaatggg 117
             |||||||||||||||||||
Sbjct: 57607 aaatgagagataaaatggg 57625
to top
>gb|AC160935.2| Mus musculus BAC clone RP23-456B7 from chromosome 9, complete sequence
          Length = 178690

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 101   atgagagataaaatgggat 119
             |||||||||||||||||||
Sbjct: 49273 atgagagataaaatgggat 49255
to top
>gb|AC012162.11| Drosophila melanogaster clone BACR01N10, complete sequence
          Length = 169856

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 81    tttcagaagcaaattgata 99
             |||||||||||||||||||
Sbjct: 71686 tttcagaagcaaattgata 71668
to top
>gb|AC182769.3| Cavia porcellus clone CH234-278G5, complete sequence
          Length = 118835

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 79    aatttcagaagcaaattgataaa 101
             ||||||||||||||||| |||||
Sbjct: 85507 aatttcagaagcaaatttataaa 85529
to top
>ref|XM_532130.2| PREDICTED: Canis familiaris similar to dynein, axonemal, heavy chain
            8 (LOC474895), mRNA
          Length = 14292

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 93   attgataaatgagagataa 111
            |||||||||||||||||||
Sbjct: 9828 attgataaatgagagataa 9810
to top
>gb|AC117242.3| Mus musculus BAC clone RP24-151P1 from chromosome 6, complete sequence
          Length = 209736

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 100    aatgagagataaaatggga 118
              |||||||||||||||||||
Sbjct: 176149 aatgagagataaaatggga 176131
to top
>gb|AC146564.2| Medicago truncatula clone mth2-67l12, complete sequence
          Length = 128650

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 96    gataaatgagagataaaatggga 118
             ||||||||| |||||||||||||
Sbjct: 76654 gataaatgatagataaaatggga 76676
to top
>gb|AC137510.33| Medicago truncatula clone mth2-8m7, complete sequence
          Length = 108759

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 96    gataaatgagagataaaatggga 118
             ||||||||| |||||||||||||
Sbjct: 56762 gataaatgatagataaaatggga 56784
to top
>emb|AL445262.7| Human DNA sequence from clone RP11-9D14 on chromosome 13, complete
             sequence
          Length = 23121

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 97    ataaatgagagataaaatg 115
             |||||||||||||||||||
Sbjct: 19801 ataaatgagagataaaatg 19819
to top
>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2144856 attacaacaattggcacaa 2144838
to top
>emb|AL844605.5| Mouse DNA sequence from clone RP24-115D19 on chromosome 2, complete
             sequence
          Length = 188958

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    ttggttctggcttattcta 42
             |||||||||||||||||||
Sbjct: 53065 ttggttctggcttattcta 53047
to top
>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2215454 attacaacaattggcacaa 2215436
to top
>gb|AC090338.6| Homo sapiens chromosome 18, clone RP11-704C2, complete sequence
          Length = 200525

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 88     agcaaattgataaatgaga 106
              |||||||||||||||||||
Sbjct: 147144 agcaaattgataaatgaga 147126
to top
>gb|AC097634.2| Homo sapiens chromosome 3 clone RP11-154H23, complete sequence
          Length = 193553

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    actaatttcagaagcaaat 94
             |||||||||||||||||||
Sbjct: 72951 actaatttcagaagcaaat 72969
to top
>gb|AC015617.8| Homo sapiens, clone RP11-45H23, complete sequence
          Length = 160541

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    agcaaattgataaatgaga 106
             |||||||||||||||||||
Sbjct: 98272 agcaaattgataaatgaga 98290
to top
>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2140563 attacaacaattggcacaa 2140545
to top
>emb|BX571675.5| Zebrafish DNA sequence from clone DKEY-235D17 in linkage group 11,
              complete sequence
          Length = 207497

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 50     acaattggcacaaataaca 68
              |||||||||||||||||||
Sbjct: 106714 acaattggcacaaataaca 106696
to top
>gb|AC111139.19| Mus musculus chromosome 3, clone RP23-365L12, complete sequence
          Length = 188633

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 95    tgataaatgagagataaaa 113
             |||||||||||||||||||
Sbjct: 67640 tgataaatgagagataaaa 67658
to top
>gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88E-88E, BAC clone
             BACR32A03, complete sequence
          Length = 182601

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 112   aatgggatctggtggcata 130
             |||||||||||||||||||
Sbjct: 94898 aatgggatctggtggcata 94880
to top
>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2151287 attacaacaattggcacaa 2151269
to top
>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2204365 attacaacaattggcacaa 2204347
to top
>gb|AC157474.2| Mus musculus BAC clone RP24-565B5 from chromosome 9, complete sequence
          Length = 192701

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 101    atgagagataaaatgggat 119
              |||||||||||||||||||
Sbjct: 186030 atgagagataaaatgggat 186012
to top
>gb|AC007339.8| Homo sapiens chromosome 16 clone RP11-305A7, complete sequence
          Length = 183646

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 81     tttcagaagcaaattgata 99
              |||||||||||||||||||
Sbjct: 139486 tttcagaagcaaattgata 139504
to top
>gb|AC016674.9| Homo sapiens BAC clone RP11-36C8 from 2, complete sequence
          Length = 69948

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 18    ctttatttggttctggcttattc 40
             |||||||||||||||||| ||||
Sbjct: 21468 ctttatttggttctggctgattc 21446
to top
>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2165730 attacaacaattggcacaa 2165712
to top
>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2139022 attacaacaattggcacaa 2139004
to top
>emb|BX255962.9| Zebrafish DNA sequence from clone CH211-269C21 in linkage group 25,
              complete sequence
          Length = 151830

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 91     aaattgataaatgagagat 109
              |||||||||||||||||||
Sbjct: 121451 aaattgataaatgagagat 121469
to top
>emb|BX897712.12| Zebrafish DNA sequence from clone CH211-146A9 in linkage group 4,
             complete sequence
          Length = 119220

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 79    aatttcagaagcaaattgataaa 101
             ||||||||| |||||||||||||
Sbjct: 72993 aatttcagacgcaaattgataaa 72971
to top
>emb|BX469895.7| Zebrafish DNA sequence from clone DKEY-152C18 in linkage group 19,
              complete sequence
          Length = 179493

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 133    ctgtaaagaacaatagagt 151
              |||||||||||||||||||
Sbjct: 110203 ctgtaaagaacaatagagt 110221
to top
>gb|AE003707.2| Drosophila melanogaster chromosome 3R, section 45 of 118 of the complete
              sequence
          Length = 228284

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 112    aatgggatctggtggcata 130
              |||||||||||||||||||
Sbjct: 216588 aatgggatctggtggcata 216570
to top
>gb|AE003506.3| Drosophila melanogaster chromosome X, section 58 of 74 of the complete
              sequence
          Length = 302073

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 81     tttcagaagcaaattgata 99
              |||||||||||||||||||
Sbjct: 253018 tttcagaagcaaattgata 253036
to top
>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2242137 attacaacaattggcacaa 2242119
to top
>gb|AC125020.7| Mus musculus chromosome 12, clone RP24-181E5, complete sequence
          Length = 200586

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    tatttggttctggcttatt 39
             |||||||||||||||||||
Sbjct: 37177 tatttggttctggcttatt 37195
to top
>gb|BC088723.1| Xenopus laevis hypothetical LOC496249, mRNA (cDNA clone MGC:99374
           IMAGE:7205306), complete cds
          Length = 1461

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  aattggcacaaataacagc 70
           |||||||||||||||||||
Sbjct: 944 aattggcacaaataacagc 926
to top
>emb|BX005467.6| Mouse DNA sequence from clone RP23-74L11 on chromosome X, complete
              sequence
          Length = 233590

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     actaatttcagaagcaaat 94
              |||||||||||||||||||
Sbjct: 220260 actaatttcagaagcaaat 220242
to top
>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 44      attacaacaattggcacaa 62
               |||||||||||||||||||
Sbjct: 2103220 attacaacaattggcacaa 2103202
to top
>dbj|AP006665.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT31L13, TM0360,
             complete sequence
          Length = 91632

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 98    taaatgagagataaaatgg 116
             |||||||||||||||||||
Sbjct: 10810 taaatgagagataaaatgg 10828
to top
>emb|AL662901.18| Mouse DNA sequence from clone RP23-378G22 on chromosome 11, complete
             sequence
          Length = 50764

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 98    taaatgagagataaaatgg 116
             |||||||||||||||||||
Sbjct: 10619 taaatgagagataaaatgg 10637


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,670,042
Number of Sequences: 3902068
Number of extensions: 1670042
Number of successful extensions: 122928
Number of sequences better than 10.0: 54
Number of HSP's better than 10.0 without gapping: 54
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 122457
Number of HSP's gapped (non-prelim): 471
length of query: 154
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 132
effective length of database: 17,147,199,772
effective search space: 2263430369904
effective search space used: 2263430369904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top