ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet50b07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chloroph... 458 e-126
2ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group... 163 3e-37
3ref|XM_478692.1| Oryza sativa (japonica cultivar-group), mRNA 163 3e-37
4ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group... 163 3e-37
5ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group... 163 3e-37
6ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group... 163 3e-37
7dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 163 3e-37
8dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 163 3e-37
9dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 3e-37
10dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 3e-37
11dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 3e-37
12dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 3e-37
13dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 3e-37
14dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 3e-37
15gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding prot... 163 3e-37
16gb|AY103995.1| Zea mays PCO102677 mRNA sequence 159 5e-36
17emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding p... 151 1e-33
18gb|AF139466.2|AF139466 Vigna radiata chlorophyll a/b binding pro... 76 6e-11
19emb|BX822730.1|CNS0A5TB Arabidopsis thaliana Full-length cDNA Co... 60 3e-06
20ref|NM_111728.2| Arabidopsis thaliana LHCB4.2 AT3G08940 (LHCB4.2... 52 8e-04
21ref|NM_180214.1| Arabidopsis thaliana LHCB4.2; chlorophyll bindi... 52 8e-04
22gb|AC010871.7|ATAC010871 Arabidopsis thaliana chromosome III BAC... 52 8e-04
23gb|AY081608.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 52 8e-04
24gb|AY065140.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 52 8e-04
25emb|BX822436.1|CNS0A619 Arabidopsis thaliana Full-length cDNA Co... 52 8e-04
26emb|BX823814.1|CNS0A5CT Arabidopsis thaliana Full-length cDNA Co... 52 8e-04
27emb|BX823751.1|CNS0A5AT Arabidopsis thaliana Full-length cDNA Co... 52 8e-04
28emb|BX823498.1|CNS0A5AS Arabidopsis thaliana Full-length cDNA Co... 52 8e-04
29emb|BX823817.1|CNS0A4NR Arabidopsis thaliana Full-length cDNA Co... 52 8e-04
30emb|BX823629.1|CNS0A4ND Arabidopsis thaliana Full-length cDNA Co... 52 8e-04
31gb|AF134127.1| Arabidopsis thaliana Lhcb4.2 protein (Lhcb4.2) mR... 52 8e-04
32gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 46 0.050
33ref|NM_120231.3| Arabidopsis thaliana chlorophyll binding AT5G01... 44 0.20
34gb|BT000363.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.20
35emb|AL161946.1|ATF7A7 Arabidopsis thaliana DNA chromosome 5, BAC... 44 0.20
36gb|AY133566.1| Arabidopsis thaliana At5g01530/F7A7_50 mRNA, comp... 44 0.20
37gb|AY092980.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.20
38gb|AY081680.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.20
39gb|AY059861.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 44 0.20
40gb|AY057641.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, comp... 44 0.20
41dbj|AK221043.1| Arabidopsis thaliana mRNA for Lhcb4- protein, pa... 44 0.20
42gb|AY048300.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, comp... 44 0.20
43gb|AF370474.1|AF370474 Arabidopsis thaliana chlorophyll a/b-bind... 44 0.20
44emb|BX823387.1|CNS0A5AY Arabidopsis thaliana Full-length cDNA Co... 44 0.20
45emb|BX833597.1|CNS0A1R6 Arabidopsis thaliana Full-length cDNA Co... 44 0.20
46emb|BX831442.1|CNS0A1WM Arabidopsis thaliana Full-length cDNA Co... 44 0.20
47emb|BX830127.1|CNS0A1XL Arabidopsis thaliana Full-length cDNA Co... 44 0.20
48emb|BX830573.1|CNS0A06T Arabidopsis thaliana Full-length cDNA Co... 44 0.20
49emb|BX831299.1|CNS09ZIA Arabidopsis thaliana Full-length cDNA Co... 44 0.20
50emb|BX831064.1|CNS09ZJ3 Arabidopsis thaliana Full-length cDNA Co... 44 0.20
51emb|BX830905.1|CNS09ZE8 Arabidopsis thaliana Full-length cDNA Co... 44 0.20
52emb|BX830685.1|CNS09ZE5 Arabidopsis thaliana Full-length cDNA Co... 44 0.20
53emb|X71878.1|ATLHCB4 A.thaliana Lhcb4 gene 44 0.20
54ref|XM_480317.1| Oryza sativa (japonica cultivar-group), mRNA 42 0.78
55gb|AY245372.1| Iris fulva clone LFR3-3 IRRE retrotransposon, par... 42 0.78
56dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.78
57gb|AY995800.1| Synthetic construct codon optimized envelope prot... 42 0.78
58dbj|AP005164.3| Oryza sativa (japonica cultivar-group) genomic D... 42 0.78
59gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 42 0.78
60ref|NM_184305.2| Oryza sativa (japonica cultivar-group), mRNA 40 3.1
61ref|XM_477163.1| Oryza sativa (japonica cultivar-group), mRNA 40 3.1
62gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, co... 40 3.1
63gb|AY313897.1| Danio rerio ion channel NompC (nompc) mRNA, compl... 40 3.1
64emb|Y16952.3|AME16952 Amycolatopsis balhimycina biosynthetic gen... 40 3.1
65emb|BX842653.1| Bdellovibrio bacteriovorus complete genome, stra... 40 3.1
66dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.1
67ref|NM_204787.1| Gallus gallus proteoglycan (PG-M), mRNA 40 3.1
68dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 3.1
69dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.1
70dbj|AP005764.5| Oryza sativa (japonica cultivar-group) genomic D... 40 3.1
71ref|XM_556128.1| Anopheles gambiae str. PEST ENSANGP00000028624 ... 40 3.1
72dbj|AK065008.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 3.1
73ref|NM_183349.1| Danio rerio transient receptor potential cation... 40 3.1
74gb|AC133110.2| Homo sapiens BAC clone RP11-761N10 from 4, comple... 40 3.1
75dbj|D13542.1|CHKPRGL Chicken mRNA for proteoglycan, complete cds 40 3.1 
>emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chlorophyll a/b-binding protein
          Length = 470

 Score =  458 bits (231), Expect = e-126
 Identities = 237/239 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   caacaaaggatctttgcgataccctctcatccatcactcgtcatacaaaaccaaagcacg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 359 caacaaaggatctttgcgataccctctcatccatcactcgtcatacaaaaccaaagcacg 300

                                                                       
Query: 61  ttcgttacacggacgcgcgttcgtccattttgcagctgagctgacagaaactgctcgacc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 299 ttcgttacacggacgcgcgttcgtccattttgcagctgagctgacagaaactgctcgacc 240

                                                                       
Query: 121 accgaccacttaagaggagccgaaggtgtcaaagatggtggtgtgcagcgggtcgctgag 180
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 239 accgaccacttaagaggagccgaaggtgtcgaagatggtggtgtgcagcgggtcgctgag 180

                                                                      
Query: 181 gtgggtggcccagttgttgagcggacccttgccggtggcggcggcctgcacggcgaagc 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 179 gtgggtggcccagttgttgagcggacccttgccggtggcggcggcctgcaccgcgaagc 121
to top
>ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1156

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 902 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 843

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 842 gggccccttgccggtggcggcggcctgcacggcgaagc 805
to top
>ref|XM_478692.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1152

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 897 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 838

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 837 gggccccttgccggtggcggcggcctgcacggcgaagc 800
to top
>ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1162

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggcggcctgcacggcgaagc 807
to top
>ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1183

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggcggcctgcacggcgaagc 807
to top
>ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1221

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 918 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 859

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 858 gggccccttgccggtggcggcggcctgcacggcgaagc 821
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Plus

                                                                            
Query: 142      gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
                ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 22263067 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 22263126

                                                      
Query: 202      cggacccttgccggtggcggcggcctgcacggcgaagc 239
                 || ||||||||||||||||||||||||||||||||||
Sbjct: 22263127 gggccccttgccggtggcggcggcctgcacggcgaagc 22263164



 Score = 40.1 bits (20), Expect = 3.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                           
Query: 61      ttcgttacacggacgcgcgttcgtccat 88
               ||||||||||||||| ||||||||||||
Sbjct: 7208546 ttcgttacacggacg-gcgttcgtccat 7208572
to top
>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0567H04
          Length = 181420

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Plus

                                                                         
Query: 142   gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
             ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 68313 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 68372

                                                   
Query: 202   cggacccttgccggtggcggcggcctgcacggcgaagc 239
              || ||||||||||||||||||||||||||||||||||
Sbjct: 68373 gggccccttgccggtggcggcggcctgcacggcgaagc 68410
to top
>dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B02, full
           insert sequence
          Length = 1234

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggcggcctgcacggcgaagc 807
to top
>dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F11, full
           insert sequence
          Length = 1152

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 897 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 838

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 837 gggccccttgccggtggcggcggcctgcacggcgaagc 800
to top
>dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D03, full
           insert sequence
          Length = 1169

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 911 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 852

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 851 gggccccttgccggtggcggcggcctgcacggcgaagc 814
to top
>dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C12, full
           insert sequence
          Length = 1183

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggcggcctgcacggcgaagc 807
to top
>dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H13, full
           insert sequence
          Length = 1156

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 902 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 843

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 842 gggccccttgccggtggcggcggcctgcacggcgaagc 805
to top
>dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-F01, full
           insert sequence
          Length = 1221

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 918 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 859

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 858 gggccccttgccggtggcggcggcctgcacggcgaagc 821
to top
>gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding protein (RCABP69) mRNA,
           complete cds
          Length = 1178

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 902 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 843

                                                 
Query: 202 cggacccttgccggtggcggcggcctgcacggcgaagc 239
            || ||||||||||||||||||||||||||||||||||
Sbjct: 842 gggccccttgccggtggcggcggcctgcacggcgaagc 805
to top
>gb|AY103995.1| Zea mays PCO102677 mRNA sequence
          Length = 1225

 Score =  159 bits (80), Expect = 5e-36
 Identities = 95/100 (95%)
 Strand = Plus / Minus

                                                                       
Query: 140 ccgaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttg 199
           ||||| ||||| |||||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 918 ccgaacgtgtcgaagatggtggtgtggagcgggtcgctcaggtgggtggcccagttgttg 859

                                                   
Query: 200 agcggacccttgccggtggcggcggcctgcacggcgaagc 239
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 858 agcggccccttgccggtggcggcggcctgcacggcgaagc 819
to top
>emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding protein CP29
          Length = 1162

 Score =  151 bits (76), Expect = 1e-33
 Identities = 94/100 (94%)
 Strand = Plus / Minus

                                                                       
Query: 140 ccgaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttg 199
           ||||| ||||| |||||||| ||||| ||||||||||| |||||||||||||||||||||
Sbjct: 873 ccgaacgtgtcgaagatggtagtgtggagcgggtcgctcaggtgggtggcccagttgttg 814

                                                   
Query: 200 agcggacccttgccggtggcggcggcctgcacggcgaagc 239
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 813 agcggccccttgccggtggcggcggcctgcacggcgaagc 774
to top
>gb|AF139466.2|AF139466 Vigna radiata chlorophyll a/b binding protein CP29 (CipCp29) mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 1118

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 142 gaaggtgtcaaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 201
           ||||||||||| |||||| ||||| || ||||| || | |||||||||||||||||||||
Sbjct: 918 gaaggtgtcaatgatggttgtgtgaagtgggtcactcaagtgggtggcccagttgttgag 859

                             
Query: 202 cggacccttgccggtggc 219
            || |||||||| |||||
Sbjct: 858 tgggcccttgccagtggc 841
to top
>emb|BX822730.1|CNS0A5TB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB5ZH12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 971

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| ||||||||||||||||||||
Sbjct: 850 atggtggtgtgaagtgggtcactaaggtgagtggcccagttgttgagcgg 801
to top
>ref|NM_111728.2| Arabidopsis thaliana LHCB4.2 AT3G08940 (LHCB4.2) transcript variant
           AT3G08940.2 mRNA, complete cds
          Length = 1109

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 880 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 831
to top
>ref|NM_180214.1| Arabidopsis thaliana LHCB4.2; chlorophyll binding AT3G08940
           (LHCB4.2) transcript variant AT3G08940.1 mRNA, complete
           cds
          Length = 1194

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 965 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 916
to top
>gb|AC010871.7|ATAC010871 Arabidopsis thaliana chromosome III BAC T16O11 genomic sequence,
             complete sequence
          Length = 80381

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 155   atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
             ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 37905 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 37954
to top
>gb|AY081608.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At3g08940) mRNA, complete cds
          Length = 881

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 839 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 790
to top
>gb|AY065140.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At3g08940; T16O11.12) mRNA, complete cds
          Length = 1023

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 880 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 831
to top
>emb|BX822436.1|CNS0A619 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB38ZB11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1004

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 861 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 812
to top
>emb|BX823814.1|CNS0A5CT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS78ZG07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 688

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 542 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 493
to top
>emb|BX823751.1|CNS0A5AT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 981

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 860 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 811
to top
>emb|BX823498.1|CNS0A5AS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS44ZD12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 990

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 870 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 821
to top
>emb|BX823817.1|CNS0A4NR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS7ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 691

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 545 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 496
to top
>emb|BX823629.1|CNS0A4ND Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZA12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 992

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 864 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 815
to top
>gb|AF134127.1| Arabidopsis thaliana Lhcb4.2 protein (Lhcb4.2) mRNA, complete cds
          Length = 1040

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 883 atggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 834
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 46.1 bits (23), Expect = 0.050
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 213     cggtggcggcggcctgcacggcg 235
               |||||||||||||||||||||||
Sbjct: 1028816 cggtggcggcggcctgcacggcg 1028794
to top
>ref|NM_120231.3| Arabidopsis thaliana chlorophyll binding AT5G01530 mRNA, complete
           cds
          Length = 1222

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 996 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 943
to top
>gb|BT000363.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530) mRNA, complete cds
          Length = 966

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 849 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 796
to top
>emb|AL161946.1|ATF7A7 Arabidopsis thaliana DNA chromosome 5, BAC clone F7A7 (ESSA project)
          Length = 86690

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                   
Query: 154   gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
             |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 17878 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 17825
to top
>gb|AY133566.1| Arabidopsis thaliana At5g01530/F7A7_50 mRNA, complete cds
          Length = 873

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 849 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 796
to top
>gb|AY092980.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530) mRNA, complete cds
          Length = 1094

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 884 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 831
to top
>gb|AY081680.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530) mRNA, complete cds
          Length = 947

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 849 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 796
to top
>gb|AY059861.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530; F7A7_50) mRNA, complete cds
          Length = 1023

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 885 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 832
to top
>gb|AY057641.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, complete cds
          Length = 1113

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 884 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 831
to top
>dbj|AK221043.1| Arabidopsis thaliana mRNA for Lhcb4- protein, partial cds, clone:
           RAFL22-74-I16
          Length = 212

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 95  gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 42
to top
>gb|AY048300.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, complete cds
          Length = 1074

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 886 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 833
to top
>gb|AF370474.1|AF370474 Arabidopsis thaliana chlorophyll a/b-binding protein CP29 (F7A7_50)
           mRNA, complete cds
          Length = 1064

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 909 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 856
to top
>emb|BX823387.1|CNS0A5AY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS31ZA02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 918

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 155 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 204
           ||||||||||  || ||||| || ||||| || |||||||||||||||||
Sbjct: 865 atggtggtgttaagtgggtcactaaggtgagtcgcccagttgttgagcgg 816
to top
>emb|BX833597.1|CNS0A1R6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZB03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 970

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 870 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|BX831442.1|CNS0A1WM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS90ZH01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 954

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 854 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 801
to top
>emb|BX830127.1|CNS0A1XL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 847 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 794
to top
>emb|BX830573.1|CNS0A06T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB90ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1043

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 973 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 920
to top
>emb|BX831299.1|CNS09ZIA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS77ZA02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 871 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 818
to top
>emb|BX831064.1|CNS09ZJ3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1077

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 870 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|BX830905.1|CNS09ZE8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 941

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 870 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|BX830685.1|CNS09ZE5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZD06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 940

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 154 gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
           |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 870 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|X71878.1|ATLHCB4 A.thaliana Lhcb4 gene
          Length = 2100

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 154  gatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 207
            |||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 1979 gatggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 1926
to top
>ref|XM_480317.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 444

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 218 gcggcggcctgcacggcgaag 238
           |||||||||||||||||||||
Sbjct: 47  gcggcggcctgcacggcgaag 67
to top
>gb|AY245372.1| Iris fulva clone LFR3-3 IRRE retrotransposon, partial sequence
          Length = 3850

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 171  ggtcgctgaggtgggtggccc 191
            |||||||||||||||||||||
Sbjct: 2333 ggtcgctgaggtgggtggccc 2353
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 218     gcggcggcctgcacggcgaag 238
               |||||||||||||||||||||
Sbjct: 4290927 gcggcggcctgcacggcgaag 4290947
to top
>gb|AY995800.1| Synthetic construct codon optimized envelope protein (env) gene,
            complete cds
          Length = 2655

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 210  tgccggtggcggcggcctgca 230
            |||||||||||||||||||||
Sbjct: 2524 tgccggtggcggcggcctgca 2504
to top
>dbj|AP005164.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0054L03
          Length = 183623

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 218   gcggcggcctgcacggcgaag 238
             |||||||||||||||||||||
Sbjct: 53721 gcggcggcctgcacggcgaag 53741
to top
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 208     cttgccggtggcggcggcctg 228
               |||||||||||||||||||||
Sbjct: 2347780 cttgccggtggcggcggcctg 2347800
to top
>ref|NM_184305.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1511

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 206 cccttgccggtggcggcggc 225
           ||||||||||||||||||||
Sbjct: 807 cccttgccggtggcggcggc 788
to top
>ref|XM_477163.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 267

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                      
Query: 61 ttcgttacacggacgcgcgttcgtccat 88
          ||||||||||||||| ||||||||||||
Sbjct: 27 ttcgttacacggacg-gcgttcgtccat 1
to top
>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence
          Length = 152414

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 175   gctgaggtgggtggcccagttgtt 198
             ||||||||||||||||||| ||||
Sbjct: 23315 gctgaggtgggtggcccagatgtt 23292
to top
>gb|AY313897.1| Danio rerio ion channel NompC (nompc) mRNA, complete cds
          Length = 5533

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 103  gacagaaactgctcgaccaccgac 126
            ||||||||||||| ||||||||||
Sbjct: 4952 gacagaaactgctggaccaccgac 4929
to top
>emb|Y16952.3|AME16952 Amycolatopsis balhimycina biosynthetic gene cluster for balhimycin,
             strain DSM 5908
          Length = 66669

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 214   ggtggcggcggcctgcacggcgaa 237
             |||||||||||||||| |||||||
Sbjct: 14787 ggtggcggcggcctgcgcggcgaa 14764
to top
>emb|BX842653.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 8/11
          Length = 347636

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     aaaccaaagcacgttcgtta 67
              ||||||||||||||||||||
Sbjct: 227818 aaaccaaagcacgttcgtta 227837
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 206     cccttgccggtggcggcggc 225
               ||||||||||||||||||||
Sbjct: 2202083 cccttgccggtggcggcggc 2202064
to top
>ref|NM_204787.1| Gallus gallus proteoglycan (PG-M), mRNA
          Length = 12307

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 91   tgcagctgagctgacagaaactgc 114
            |||||| |||||||||||||||||
Sbjct: 7500 tgcagcagagctgacagaaactgc 7523
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 216    tggcggcggcctgcacggcg 235
              ||||||||||||||||||||
Sbjct: 879231 tggcggcggcctgcacggcg 879212
to top
>dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0480E02
          Length = 141862

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    cccttgccggtggcggcggc 225
              ||||||||||||||||||||
Sbjct: 123195 cccttgccggtggcggcggc 123176
to top
>dbj|AP005764.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0016A21
          Length = 144076

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                         
Query: 61    ttcgttacacggacgcgcgttcgtccat 88
             ||||||||||||||| ||||||||||||
Sbjct: 49030 ttcgttacacggacg-gcgttcgtccat 49056
to top
>ref|XM_556128.1| Anopheles gambiae str. PEST ENSANGP00000028624 (ENSANGG00000023739),
            partial mRNA
          Length = 1989

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 151  aaagatggtggtgtgcagcgggtcgctg 178
            ||||||| ||||||||||||||| ||||
Sbjct: 1263 aaagatgatggtgtgcagcgggttgctg 1236
to top
>dbj|AK065008.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001E21, full
           insert sequence
          Length = 1512

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 206 cccttgccggtggcggcggc 225
           ||||||||||||||||||||
Sbjct: 807 cccttgccggtggcggcggc 788
to top
>ref|NM_183349.1| Danio rerio transient receptor potential cation channel, subfamily N,
            member 1 (trpn1), mRNA
          Length = 5533

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 103  gacagaaactgctcgaccaccgac 126
            ||||||||||||| ||||||||||
Sbjct: 4952 gacagaaactgctggaccaccgac 4929
to top
>gb|AC133110.2| Homo sapiens BAC clone RP11-761N10 from 4, complete sequence
          Length = 59902

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 177  tgaggtgggtggcccagttg 196
            ||||||||||||||||||||
Sbjct: 9918 tgaggtgggtggcccagttg 9899
to top
>dbj|D13542.1|CHKPRGL Chicken mRNA for proteoglycan, complete cds
          Length = 12307

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 91   tgcagctgagctgacagaaactgc 114
            |||||| |||||||||||||||||
Sbjct: 7500 tgcagcagagctgacagaaactgc 7523


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,009,165
Number of Sequences: 3902068
Number of extensions: 2009165
Number of successful extensions: 67883
Number of sequences better than 10.0: 75
Number of HSP's better than 10.0 without gapping: 73
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 67511
Number of HSP's gapped (non-prelim): 376
length of query: 239
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 217
effective length of database: 17,147,199,772
effective search space: 3720942350524
effective search space used: 3720942350524
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top