ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet48f08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 86 4e-14
2ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 86 4e-14
3ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 86 4e-14
4ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 86 4e-14
5gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 86 4e-14
6gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 86 4e-14
7gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 86 4e-14
8gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 86 4e-14
9gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 86 4e-14
10gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 86 4e-14
11gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 86 4e-14
12gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 86 4e-14
13gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 4e-14
14gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 4e-14
15gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 4e-14
16gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 86 4e-14
17gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 4e-14
18emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 86 4e-14
19emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 86 4e-14
20emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 86 4e-14
21emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 86 4e-14
22emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 86 4e-14
23emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 86 4e-14
24gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 78 9e-12
25gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 78 9e-12
26emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 76 4e-11
27gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 74 1e-10
28emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 74 1e-10
29emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 74 1e-10
30gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 72 6e-10
31gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 72 6e-10
32emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 72 6e-10
33ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 70 2e-09
34ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 70 2e-09
35emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 70 2e-09
36gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 70 2e-09
37dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 70 2e-09
38emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 70 2e-09
39emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 70 2e-09
40dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 70 2e-09
41dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 70 2e-09
42dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
43dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
44emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 70 2e-09
45emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 70 2e-09
46dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
47dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
48dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
49dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
50dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
51dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 2e-09
52emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 68 9e-09
53emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 68 9e-09
54gb|AY109324.1| Zea mays CL187_1 mRNA sequence 68 9e-09
55gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 68 9e-09
56gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 66 4e-08
57dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 66 4e-08
58ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 64 1e-07
59gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 64 1e-07
60gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 64 1e-07
61gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 64 1e-07
62gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 64 1e-07
63gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 64 1e-07
64gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 64 1e-07
65emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 64 1e-07
66emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 64 1e-07
67dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 64 1e-07
68gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 64 1e-07
69gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 64 1e-07
70emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 64 1e-07
71dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 62 6e-07
72dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 62 6e-07
73dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 62 6e-07
74dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 6e-07
75dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 6e-07
76dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 6e-07
77dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 6e-07
78dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 6e-07
79gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 62 6e-07
80gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 62 6e-07
81dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 62 6e-07
82gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 60 2e-06
83emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 60 2e-06
84emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 60 2e-06
85gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 60 2e-06
86gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 60 2e-06
87ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 58 9e-06
88gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 58 9e-06
89gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 58 9e-06
90gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 58 9e-06
91gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 58 9e-06
92gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 58 9e-06
93emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 58 9e-06
94gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 58 9e-06
95emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 58 9e-06
96emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 58 9e-06
97gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 58 9e-06
98gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 58 9e-06
99gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 58 9e-06
100ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 56 3e-05
101ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 56 3e-05
102gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 56 3e-05
103gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 56 3e-05
104gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 56 3e-05
105gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 3e-05
106gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 3e-05
107gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 3e-05
108gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 3e-05
109gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 3e-05
110gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 3e-05
111gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 3e-05
112gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 56 3e-05
113gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 56 3e-05
114emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 56 3e-05
115emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 56 3e-05
116emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 56 3e-05
117gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 56 3e-05
118gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 56 3e-05
119emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 54 1e-04
120emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 52 5e-04
121emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 52 5e-04
122gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 52 5e-04
123gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 50 0.002
124emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 50 0.002
125emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 50 0.002
126gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 50 0.002
127gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 50 0.002
128gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-... 50 0.002
129gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 50 0.002
130dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 50 0.002
131emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 48 0.008
132dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 48 0.008
133emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 48 0.008
134emb|X16535.1|GMCAB4 G.max DNA for Cab4 48 0.008
135gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 48 0.008
136gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene ... 48 0.008
137gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 48 0.008
138gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 46 0.033
139gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 46 0.033
140gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.033
141dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.033
142dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 46 0.033
143dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.033
144dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.033
145gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 46 0.033
146gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 46 0.033
147gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 46 0.033
148gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 46 0.033
149dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 46 0.033
150gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 44 0.13
151emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 42 0.52
152emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 42 0.52
153gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding prot... 42 0.52
154dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 0.52
155emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 42 0.52
156gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene ... 42 0.52
157gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-... 42 0.52
158dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 42 0.52
159dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 42 0.52
160ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 40 2.1
161gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence 40 2.1
162gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome... 40 2.1
163gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, comple... 40 2.1
164gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 40 2.1
165gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 40 2.1
166gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 40 2.1
167emb|BX470077.5| Zebrafish DNA sequence from clone CH211-136P17 i... 40 2.1
168gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 40 2.1
169gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 40 2.1
170dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.1
171gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 40 2.1
172gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 40 2.1
173dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 2.1
174dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 40 2.1
175emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 40 2.1
176gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 40 2.1
177gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protei... 40 2.1
178gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complet... 40 2.1
179dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 40 2.1
180dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 40 2.1
181dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 40 2.1
182gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, com... 38 8.2
183gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome... 38 8.2
184gb|AC125213.3| Mus musculus BAC clone RP23-136A14 from 7, comple... 38 8.2
185gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete ... 38 8.2
186emb|AL365321.16| Human DNA sequence from clone RP11-324J2 on chr... 38 8.2
187gb|BC056343.1| Mus musculus sortilin 1, mRNA (cDNA clone MGC:739... 38 8.2
188dbj|AK147442.1| Mus musculus adult male brain UNDEFINED_CELL_LIN... 38 8.2
189gb|AC018929.12| Oryza sativa chromosome 10 BAC OSJNBa0027L23 gen... 38 8.2
190gb|BC034129.1| Mus musculus sortilin 1, mRNA (cDNA clone IMAGE:4... 38 8.2
191emb|BX284646.4| Zebrafish DNA sequence from clone CH211-49J11 in... 38 8.2
192dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 8.2
193dbj|AK177805.1| Mus musculus cDNA, clone:Y0G0104F07, strand:minu... 38 8.2
194emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 38 8.2
195emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 38 8.2
196emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 38 8.2
197gb|AF175279.1|AF175279 Mus musculus neurotensin receptor 3 mRNA,... 38 8.2
198gb|AC172744.2| Medicago truncatula chromosome 2 BAC clone mth2-3... 38 8.2
199gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 8.2
200ref|NM_019972.2| Mus musculus sortilin 1 (Sort1), mRNA 38 8.2
201emb|AL954144.6| Zebrafish DNA sequence from clone CH211-206L15, ... 38 8.2
202emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chr... 38 8.2
203emb|AL663032.9| Mouse DNA sequence from clone RP23-27I6 on chrom... 38 8.2
204dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 38 8.2

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
            |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
            |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 806 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 752



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                    
Query: 109   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
             |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 93208 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 93262



 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 109   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
             |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 96100 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 96052



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                    
Query: 109   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
             |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 80994 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 80940



 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 109   ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
             |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 78102 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 78150



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggc 771



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 164 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 110



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 771



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 828 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 91  ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 145



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 52/55 (94%)
 Strand = Plus / Minus

                                                                   
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
            |||||||| |||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 1093 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 1039



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 77.8 bits (39), Expect = 9e-12
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||||||||||| ||||||||||| || ||||||||||
Sbjct: 864 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 810



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 77.8 bits (39), Expect = 9e-12
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                   
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
            |||||| |||||||||||||||||||||| ||||||||||| || ||||||||||
Sbjct: 1188 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                      
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
            |||||| |||||||||||||| ||||||| ||||||||||| |||||||| |||||||
Sbjct: 1673 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatgt 1616



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||||||||||||||| ||||||||||| |||||
Sbjct: 627 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 579



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                             
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
            |||||||| |||||||||||||||||||||| ||||||||||| |||||
Sbjct: 2371 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 2323



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                             
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
            |||||||| |||||||||||||||||||||| ||||||||||| |||||
Sbjct: 2372 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 2324



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                        
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
            |||||||| | ||||| |||||||||||||| ||||||||||| |||||||| |||||||
Sbjct: 8576 ttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagcgatgt 8635



 Score = 48.1 bits (24), Expect = 0.008
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||||| | ||||| ||||| |||||||| ||||||||||| || |||||
Sbjct: 212 ttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtc 161



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||||| |||||||||||||| ||||||| ||||||||||| ||||||||
Sbjct: 845 ttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtc 794



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||||| |||||||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 370 ttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 791 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 779 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
            |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 1240 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 111   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
             |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 13883 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                       
Query: 111      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
                |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 30025128 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                       
Query: 111      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
                |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 23604322 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||||||| ||||||| ||||||||||  |||||||||||
Sbjct: 835 ttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggc 781



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 51/55 (92%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                  
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| |||| ||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 827 ttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 111   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
             |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 21118 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 111   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
             |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 67021 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 850 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 849 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                   
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
            |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 1279 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||||||||||| || |||||||| || ||||||||||
Sbjct: 968 ccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcga 914



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 379 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 857 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
            |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| ||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgt 1746



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| ||||
Sbjct: 855 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgt 798



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
            |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| ||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgt 1746



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 67.9 bits (34), Expect = 9e-09
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
            |||||| |||||||||||||||||||||| |||||||||   || |||||||||||||
Sbjct: 1527 ccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcgatgt 1470



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 118 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcgg 162
           |||||||||||||||||||||| ||||||||||| || |||||||
Sbjct: 850 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 806



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||| |||||||||||||| ||||||| || ||||||||||| ||||||||
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggc 840



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 616 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 573



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 745



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 158 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 115



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 823 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 780



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 118 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||||||||||||||||||| ||||||||||| || ||||| ||||
Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcga 648



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 734 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 691



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 120   aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
             |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 16127 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 16170



 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 120   aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
             |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 22526 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 22483



 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 120   aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
             ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 19880 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 19837



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 120  aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
            |||||||||||||||||||| ||||||||||| ||||| |||||
Sbjct: 1005 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 962



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                       
Query: 111      ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
                |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 10793775 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 111   ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
             |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 17498 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                     
Query: 111    ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
              |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 130393 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 843 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 850 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 118 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 814 cgaagttggtggcgaaggcccaagcattgttgttgactgggtc 772



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| | |||||||||||| ||||||| ||||||||||| || ||||||||||
Sbjct: 833 ccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||||
Sbjct: 829 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||
Sbjct: 857 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 808



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
           |||||| ||||||| ||||| || ||||| ||||||||||| || |||||||||||||
Sbjct: 812 ccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatgt 755



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||| |||||||||||||| ||||||| ||||||||||| || |||||
Sbjct: 866 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 817



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
           |||||| | |||||||||||||| ||||| || |||||||| || |||||||||||||
Sbjct: 803 ccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgatgt 746



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||| |||||||||||||| ||||||| || |||||||| ||||||||
Sbjct: 816 ccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtc 767



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 748



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| ||||||||||||| |||||||| || |||||||| |||||
Sbjct: 838 ttccggggacgaagttggtggcaaaggcccatgcattgttgttgactgg 790



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 864 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 816



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 516 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 468



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 810



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
            |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 1096 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 1048



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||| |||| ||||||||| ||||||| || ||||||||||| ||||||||
Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggc 833



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| |||||||||| ||||||||||| || |||||||| |||||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactgg 748



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||| |||||||||||||| | ||||| ||||||||||| || ||||||||
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggc 337



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
           ||||| ||||| |||||||| ||||||||||| ||||||||||| ||||
Sbjct: 335 aagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaatgt 287



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 746 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 745



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 834 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 791



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||| ||||||| ||||||||||| || ||||||||
Sbjct: 835 aagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcgg 162
            |||||| |||||||||||||| | ||||| ||||||||||| || |||||||
Sbjct: 2714 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcgg 2663



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||| ||||||||||| ||||||||||| ||||| |||||
Sbjct: 994 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 951



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 933 aagttggtggcaaaggcccaagcgttgttgttgactggatcggc 890



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||  ||||||| ||||||||||| |||||||||||
Sbjct: 836 aagttggtggcataggcccatgcgttgttgttgactgggtcggc 793



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||| |||||||||||||| || |||||||| |||||||||||
Sbjct: 800 aagtttgtggcgaaggcccaagcattgttgttaactgggtcggc 757



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgtt 151
            |||||||| |||||||||||||  ||||||| |||||||||||
Sbjct: 1037 ttccggggacgaagttggtggcataggcccaggcgttgttgtt 995



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||||||||| ||||||| ||||||||||| || ||||| ||||
Sbjct: 822 aagttggtggcgtaggcccaggcgttgttgttgacagggtcagcga 777



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||||||||  ||||||| ||||||||||| || ||||||||||
Sbjct: 794 aagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 118 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||||||||||  ||||||| ||||||||||| || ||||||||
Sbjct: 275 cgaagttggtggcataggcccaggcgttgttgttaacggggtcggc 230



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||||||||| || ||||| ||||||||||| ||||||||
Sbjct: 837 aagttggtggcaaaagcccaggcgttgttgttgactgggtc 797



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           |||||| |||||||||||||  ||||||| ||||||||| | || ||||||||
Sbjct: 881 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 829



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
            |||||| |||||||||||||  ||||||| ||||||||| | || ||||||||
Sbjct: 1959 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 1907



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| | |||||||||||  ||||||| || ||||||||||||||
Sbjct: 819 ttccggggacaaagttggtggcataggcccatgcattgttgttcactgg 771



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||| ||||| |||||||| ||||||||||| ||||||||
Sbjct: 823 aagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783



to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||| ||||| |||||||| ||||||||||| ||||||||
Sbjct: 335 aagtttgtggcaaaggcccaggcgttgttgttaactgggtc 295



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
            |||||||| | ||||| |||||||||||||| || ||||| || |||||||| ||||
Sbjct: 1001 ttccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcga 945



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
           |||||||  |||||||||||||| ||||||| |||||||||
Sbjct: 841 ttccgggaacgaagttggtggcgtaggcccaggcgttgttg 801



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 40/44 (90%), Gaps = 1/44 (2%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||| ||||||||||| ||||| |||||
Sbjct: 825 aagttggtggc-aaggcccaagcgttgttgttgactggatcggc 783



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 118  cgaagttggtggcgaaggcccacgcgttgttg 149
            |||||||||||||| ||||||| |||||||||
Sbjct: 3010 cgaagttggtggcgtaggcccatgcgttgttg 2979



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||||| | |||||||||||| ||| ||| || |||||||| ||||||||
Sbjct: 866 ttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtc 815



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
            |||||||| | ||||| |||||  ||||||| || |||||||||||||||||
Sbjct: 1120 ttccggggacaaagtttgtggcataggcccaagcattgttgttcactgggtc 1069



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||||| | ||||| |||||||| ||||| ||||||||||| || |||||
Sbjct: 793 ttccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtc 742



to top

>gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene Cab-3T, complete cds
          Length = 339

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||| ||||| ||||||||  |||||||||| |||||||||||
Sbjct: 323 aagtttgtggcaaaggcccagacgttgttgttaactgggtcggc 280



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 48.1 bits (24), Expect = 0.008
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           |||||||| | |||||||||||  ||||||| || |||||||| ||||||||
Sbjct: 987 ttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtc 936



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcga 165
           |||||| | ||||||||||| || ||||| || |||||||| || ||||||||||
Sbjct: 465 ccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 111   ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
             |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 78979 ccggggacgaagttggtggcgtatgcccaggcgttgttg 79017



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 111      ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
                |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 21808837 ccggggacgaagttggtggcgtatgcccaggcgttgttg 21808799



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 111      ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
                |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 21801866 ccggggacgaagttggtggcgtatgcccaggcgttgttg 21801828



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 111  ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
            ||||||| ||||||||||||| | ||||| |||||||||
Sbjct: 1387 ccgggggtgaagttggtggcgtaagcccaggcgttgttg 1349



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 836 ccggggacgaagttggtggcgtatgcccaggcgttgttg 798



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 411 ccggggacgaagttggtggcgtatgcccaggcgttgttg 373



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 571 ccggggacgaagttggtggcgtaagcccaggcgttgttg 533



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
           |||||| |||||||||||||| | ||||| |||||||||
Sbjct: 825 ccggggacgaagttggtggcgtatgcccaggcgttgttg 787



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 118 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 168
           ||||||||||||| | |  ||||||||||||||| || |||||||| ||||
Sbjct: 987 cgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgt 937



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 141 gcgttgttgttcactgggtcggc 163
           |||||||||||||||||||||||
Sbjct: 651 gcgttgttgttcactgggtcggc 629



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 133  aggcccacgcgttgttgttcactgggtcggc 163
            ||||||| ||||||||||| |||||||||||
Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggc 2195



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||| || ||||| || ||||||||||| || |||||||| ||||||||
Sbjct: 853 ccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtc 804



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 40/45 (88%), Gaps = 1/45 (2%)
 Strand = Plus / Plus

                                                        
Query: 120 aagttggtggcgaaggccc-acgcgttgttgttcactgggtcggc 163
           |||||||| |||||||||| | ||||||||||| ||||| |||||
Sbjct: 67  aagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 120  aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
            ||||| ||||| ||||||||||| |||||||| || |||||
Sbjct: 1015 aagtttgtggcaaaggcccacgcattgttgttaacggggtc 975



to top

>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102,
           3' end and flank
          Length = 302

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||| ||||| ||||||||||| |||||||| || |||||
Sbjct: 173 aagtttgtggcaaaggcccacgcattgttgttaacggggtc 133



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 120   aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
             |||||||||||  ||||||| || |||||||| ||||||||
Sbjct: 65575 aagttggtggcataggcccaggcattgttgttaactgggtc 65615



to top

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgg 157
           |||||||| | |||||||||||  ||||||| || |||||||| |||||
Sbjct: 577 ttccggggacaaagttggtggcataggcccatgcattgttgtttactgg 529



to top

>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds
          Length = 351

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||| |||||| ||| ||| ||||||||||| ||||||||
Sbjct: 335 aagttagtggcgtaggaccaggcgttgttgtttactgggtc 295



to top

>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end
          Length = 351

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||| ||||| || ||||| ||||||||||| ||||||||
Sbjct: 335 aagtttgtggcaaaagcccaggcgttgttgtttactgggtc 295



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 120  aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
            ||||| |||||  ||||||| ||||||||||| ||||||||
Sbjct: 1886 aagtttgtggcataggcccaagcgttgttgttaactgggtc 1926



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score = 42.1 bits (21), Expect = 0.52
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 120  aagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
            ||||| |||||| ||| ||| ||||||||||| ||||||||
Sbjct: 2663 aagtttgtggcgtaggaccaggcgttgttgttaactgggtc 2623



to top

>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690
           (LHCB2:4) mRNA, complete cds
          Length = 946

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 148
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 851 ttccggggacgaagttggtggcgtaagcccaagcattgtt 812



to top

>gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence
          Length = 510

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 148
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 404 ttccggggacgaagttggtggcgtaagcccaagcattgtt 365



to top

>gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
              OSJNBa0082F22, complete sequence
          Length = 176038

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     ccgatggacagacggatggc 91
              ||||||||||||||||||||
Sbjct: 109238 ccgatggacagacggatggc 109219



 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     ccgatggacagacggatggc 91
              ||||||||||||||||||||
Sbjct: 106454 ccgatggacagacggatggc 106435



to top

>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence
          Length = 202733

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    gtacaagtacacatgcatat 66
             ||||||||||||||||||||
Sbjct: 22438 gtacaagtacacatgcatat 22419



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 113 gggggcgaagttggtggcgaaggcccacgcgttgtt 148
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 782 gggggtgaacttggtggcgaaggcgaacgcgttgtt 747



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 113 gggggcgaagttggtggcgaaggcccacgcgttgtt 148
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 783 gggggtgaacttggtggcgaaggcgaacgcgttgtt 748



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 113 gggggcgaagttggtggcgaaggcccacgcgttgtt 148
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 777 gggggtgaacttggtggcgaaggcgaacgcgttgtt 742



to top

>emb|BX470077.5| Zebrafish DNA sequence from clone CH211-136P17 in linkage group 5,
              complete sequence
          Length = 165851

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     gctgctaaacacatttaact 109
              ||||||||||||||||||||
Sbjct: 103691 gctgctaaacacatttaact 103672



to top

>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds
          Length = 801

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 148
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 796 ttccggggacgaagttggtggcgtaagcccaagcattgtt 757



to top

>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding
           protein (MGF10.9) mRNA, complete cds
          Length = 917

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 148
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 845 ttccggggacgaagttggtggcgtaagcccaagcattgtt 806



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 72       ccgatggacagacggatggc 91
                ||||||||||||||||||||
Sbjct: 13146461 ccgatggacagacggatggc 13146442



 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 72       ccgatggacagacggatggc 91
                ||||||||||||||||||||
Sbjct: 13143677 ccgatggacagacggatggc 13143658



to top

>gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete sequence
          Length = 917

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 148
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 845 ttccggggacgaagttggtggcgtaagcccaagcattgtt 806



to top

>gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA, complete cds
          Length = 897

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 109 ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 148
           |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 801 ttccggggacgaagttggtggcgtaagcccaagcattgtt 762



to top

>dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGF10
          Length = 84702

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 109   ttccgggggcgaagttggtggcgaaggcccacgcgttgtt 148
             |||||||| |||||||||||||| | ||||| || |||||
Sbjct: 31777 ttccggggacgaagttggtggcgtaagcccaagcattgtt 31738



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 118  cgaagttggtggcgaaggcccacgcgttgttg 149
            |||||||||||||| | ||||| |||||||||
Sbjct: 1838 cgaagttggtggcgtatgcccatgcgttgttg 1807



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
            |||||||| | ||||| |||||  ||||||| ||||||||||| || |||||
Sbjct: 1300 ttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 1249



to top

>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10,
           3' end and flank
          Length = 367

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||| |||||| ||| ||| ||||||||||| ||||| |||||
Sbjct: 215 aagtttgtggcgtaggaccaagcgttgttgttaactggatcggc 172



to top

>gb|K00974.1|PETCAB4 Petunia major chlorophyll a/b binding protein (Cab) clone pCab4, 3'
           end
          Length = 387

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 120 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggc 163
           ||||| |||||| ||| ||| || |||||||| |||||||||||
Sbjct: 380 aagtttgtggcgtaggaccaagcattgttgttaactgggtcggc 337



to top

>gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complete sequence
          Length = 205880

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     gtacaagtacacatgcatat 66
              ||||||||||||||||||||
Sbjct: 125910 gtacaagtacacatgcatat 125891



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 113 gggggcgaagttggtggcgaaggcccacgcgttgtt 148
           ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 811 gggggtgaacttggtggcgaaggcgaacgcgttgtt 776



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 113  gggggcgaagttggtggcgaaggcccacgcgttgtt 148
            ||||| ||| ||||||||||||||  ||||||||||
Sbjct: 1653 gggggtgaacttggtggcgaaggcgaacgcgttgtt 1618



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 109  ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtc 160
            |||||||| | ||||| |||||  ||||||| ||||||||||| || |||||
Sbjct: 2703 ttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 2652



to top

>gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, complete sequence
          Length = 236143

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 77     ggacagacggatggctgct 95
              |||||||||||||||||||
Sbjct: 115211 ggacagacggatggctgct 115193



to top

>gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome 5, complete sequence
          Length = 224181

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    tacaagtacacatgcatat 66
             |||||||||||||||||||
Sbjct: 52160 tacaagtacacatgcatat 52142



to top

>gb|AC125213.3| Mus musculus BAC clone RP23-136A14 from 7, complete sequence
          Length = 194309

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    tacaagtacacatgcatat 66
             |||||||||||||||||||
Sbjct: 94097 tacaagtacacatgcatat 94115



to top

>gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete sequence
          Length = 206570

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 48     tacaagtacacatgcatat 66
              |||||||||||||||||||
Sbjct: 109745 tacaagtacacatgcatat 109763



to top

>emb|AL365321.16| Human DNA sequence from clone RP11-324J2 on chromosome 1 Contains the
             5' end of the PHTF1 gene for putative homeodomain
             transcription factor 1,  the 3' end of the gene for a
             novel protein (FLJ11220 and FLJ12104) and a CpG island,
             complete sequence
          Length = 40891

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 94    ctaaacacatttaacttcc 112
             |||||||||||||||||||
Sbjct: 30781 ctaaacacatttaacttcc 30799



to top

>gb|BC056343.1| Mus musculus sortilin 1, mRNA (cDNA clone MGC:73925 IMAGE:5704346),
            complete cds
          Length = 6804

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 77   ggacagacggatggctgct 95
            |||||||||||||||||||
Sbjct: 2003 ggacagacggatggctgct 1985



to top

>dbj|AK147442.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN
            full-length enriched library, clone:M5C1042I07
            product:sortilin 1, full insert sequence
          Length = 6837

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 77   ggacagacggatggctgct 95
            |||||||||||||||||||
Sbjct: 2054 ggacagacggatggctgct 2036



to top

>gb|AC018929.12| Oryza sativa chromosome 10 BAC OSJNBa0027L23 genomic sequence, complete
             sequence
          Length = 143961

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 119   gaagttggtggcgaaggcccacg 141
             |||| ||||||||||||||||||
Sbjct: 18054 gaaggtggtggcgaaggcccacg 18032



to top

>gb|BC034129.1| Mus musculus sortilin 1, mRNA (cDNA clone IMAGE:4920258), partial cds
          Length = 2810

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 77   ggacagacggatggctgct 95
            |||||||||||||||||||
Sbjct: 1504 ggacagacggatggctgct 1486



to top

>emb|BX284646.4| Zebrafish DNA sequence from clone CH211-49J11 in linkage group 5,
             complete sequence
          Length = 182774

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     aaataaacacacaaagtac 21
             |||||||||||||||||||
Sbjct: 42959 aaataaacacacaaagtac 42977



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 119      gaagttggtggcgaaggcccacg 141
                |||| ||||||||||||||||||
Sbjct: 22366031 gaaggtggtggcgaaggcccacg 22366009



to top

>dbj|AK177805.1| Mus musculus cDNA, clone:Y0G0104F07, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000016188, based on BLAT search
          Length = 230

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 77  ggacagacggatggctgct 95
           |||||||||||||||||||
Sbjct: 145 ggacagacggatggctgct 127



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 141 gcgttgttgttcactgggtcggc 163
           ||||||||||| |||||||||||
Sbjct: 997 gcgttgttgttaactgggtcggc 975



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 126 gtggcgaaggcccacgcgttgttgttcactgggtc 160
           ||||| ||||||||||| |||||||| || |||||
Sbjct: 900 gtggcaaaggcccacgcattgttgttaacggggtc 866



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                          
Query: 118 cgaagttggtggcgaaggcccacgcgttgtt 148
           ||||||||||||| |||||||| || |||||
Sbjct: 859 cgaagttggtggcaaaggcccaggcattgtt 829



to top

>gb|AF175279.1|AF175279 Mus musculus neurotensin receptor 3 mRNA, complete cds
          Length = 2484

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 77   ggacagacggatggctgct 95
            |||||||||||||||||||
Sbjct: 2000 ggacagacggatggctgct 1982



to top

>gb|AC172744.2| Medicago truncatula chromosome 2 BAC clone mth2-33p17, complete
             sequence
          Length = 116124

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    acgtacaagtacacatgca 63
             |||||||||||||||||||
Sbjct: 23399 acgtacaagtacacatgca 23417



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 119      gaagttggtggcgaaggcccacg 141
                |||| ||||||||||||||||||
Sbjct: 22378099 gaaggtggtggcgaaggcccacg 22378077



to top

>ref|NM_019972.2| Mus musculus sortilin 1 (Sort1), mRNA
          Length = 6804

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 77   ggacagacggatggctgct 95
            |||||||||||||||||||
Sbjct: 2003 ggacagacggatggctgct 1985



to top

>emb|AL954144.6| Zebrafish DNA sequence from clone CH211-206L15, complete sequence
          Length = 156893

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    ccgatggacagacggatgg 90
             |||||||||||||||||||
Sbjct: 91971 ccgatggacagacggatgg 91989



to top

>emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chromosome 3, complete
             sequence
          Length = 132775

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    ggacagacggatggctgct 95
             |||||||||||||||||||
Sbjct: 86844 ggacagacggatggctgct 86826



to top

>emb|AL663032.9| Mouse DNA sequence from clone RP23-27I6 on chromosome X, complete
              sequence
          Length = 162995

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 85     ggatggctgctaaacacatttaa 107
              |||||||||| ||||||||||||
Sbjct: 101941 ggatggctgccaaacacatttaa 101919



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 111 ccgggggcgaagttggtggcgaaggcccacgcgttgttg 149
           |||||| |||||||||||||| | | ||| |||||||||
Sbjct: 817 ccggggacgaagttggtggcgtatgaccaggcgttgttg 779


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,301,139
Number of Sequences: 3902068
Number of extensions: 1301139
Number of successful extensions: 92444
Number of sequences better than 10.0: 204
Number of HSP's better than 10.0 without gapping: 204
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 91929
Number of HSP's gapped (non-prelim): 516
length of query: 168
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 146
effective length of database: 17,147,199,772
effective search space: 2503491166712
effective search space used: 2503491166712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top