ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet48b12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chloroph... 593 e-166
2ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group... 121 1e-24
3ref|XM_478692.1| Oryza sativa (japonica cultivar-group), mRNA 121 1e-24
4ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group... 121 1e-24
5ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group... 121 1e-24
6ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group... 121 1e-24
7dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 121 1e-24
8dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 121 1e-24
9dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 1e-24
10dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 1e-24
11dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 1e-24
12dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 1e-24
13dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 1e-24
14dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 1e-24
15gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding prot... 121 1e-24
16gb|AY103995.1| Zea mays PCO102677 mRNA sequence 117 2e-23
17emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding p... 109 5e-21
18gb|AF139466.2|AF139466 Vigna radiata chlorophyll a/b binding pro... 68 2e-08
19emb|BX822730.1|CNS0A5TB Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
20ref|NM_111728.2| Arabidopsis thaliana LHCB4.2 AT3G08940 (LHCB4.2... 54 3e-04
21ref|NM_180214.1| Arabidopsis thaliana LHCB4.2; chlorophyll bindi... 54 3e-04
22gb|AC010871.7|ATAC010871 Arabidopsis thaliana chromosome III BAC... 54 3e-04
23gb|AY081608.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 54 3e-04
24gb|AY065140.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 54 3e-04
25emb|BX822436.1|CNS0A619 Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
26emb|BX823814.1|CNS0A5CT Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
27emb|BX823751.1|CNS0A5AT Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
28emb|BX823498.1|CNS0A5AS Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
29emb|BX823817.1|CNS0A4NR Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
30emb|BX823629.1|CNS0A4ND Arabidopsis thaliana Full-length cDNA Co... 54 3e-04
31gb|AF134127.1| Arabidopsis thaliana Lhcb4.2 protein (Lhcb4.2) mR... 54 3e-04
32emb|BX823387.1|CNS0A5AY Arabidopsis thaliana Full-length cDNA Co... 46 0.068
33ref|NM_120231.3| Arabidopsis thaliana chlorophyll binding AT5G01... 42 1.1
34gb|AY245372.1| Iris fulva clone LFR3-3 IRRE retrotransposon, par... 42 1.1
35gb|BT000363.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.1
36emb|AL161946.1|ATF7A7 Arabidopsis thaliana DNA chromosome 5, BAC... 42 1.1
37gb|AY133566.1| Arabidopsis thaliana At5g01530/F7A7_50 mRNA, comp... 42 1.1
38gb|AY092980.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.1
39gb|AC003680.3| Arabidopsis thaliana chromosome 2 BAC F17K2 genom... 42 1.1
40gb|AY081680.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.1
41gb|AY059861.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.1
42gb|AY057641.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, comp... 42 1.1
43dbj|AK221043.1| Arabidopsis thaliana mRNA for Lhcb4- protein, pa... 42 1.1
44gb|AY048300.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, comp... 42 1.1
45gb|AF370474.1|AF370474 Arabidopsis thaliana chlorophyll a/b-bind... 42 1.1
46emb|BX833597.1|CNS0A1R6 Arabidopsis thaliana Full-length cDNA Co... 42 1.1
47emb|BX831442.1|CNS0A1WM Arabidopsis thaliana Full-length cDNA Co... 42 1.1
48emb|BX830127.1|CNS0A1XL Arabidopsis thaliana Full-length cDNA Co... 42 1.1
49emb|BX830573.1|CNS0A06T Arabidopsis thaliana Full-length cDNA Co... 42 1.1
50emb|BX831299.1|CNS09ZIA Arabidopsis thaliana Full-length cDNA Co... 42 1.1
51emb|BX831064.1|CNS09ZJ3 Arabidopsis thaliana Full-length cDNA Co... 42 1.1
52emb|BX830905.1|CNS09ZE8 Arabidopsis thaliana Full-length cDNA Co... 42 1.1
53emb|BX830685.1|CNS09ZE5 Arabidopsis thaliana Full-length cDNA Co... 42 1.1
54emb|X71878.1|ATLHCB4 A.thaliana Lhcb4 gene 42 1.1
55ref|XM_477163.1| Oryza sativa (japonica cultivar-group), mRNA 40 4.2
56gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, co... 40 4.2
57gb|AY313897.1| Danio rerio ion channel NompC (nompc) mRNA, compl... 40 4.2
58emb|BX842653.1| Bdellovibrio bacteriovorus complete genome, stra... 40 4.2
59gb|AC026101.24| Homo sapiens 3 BAC RP11-441D23 (Roswell Park Can... 40 4.2
60ref|NM_204787.1| Gallus gallus proteoglycan (PG-M), mRNA 40 4.2
61dbj|AP005764.5| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
62dbj|AP000805.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 4.2
63ref|NM_183349.1| Danio rerio transient receptor potential cation... 40 4.2
64gb|AC133110.2| Homo sapiens BAC clone RP11-761N10 from 4, comple... 40 4.2
65dbj|D13542.1|CHKPRGL Chicken mRNA for proteoglycan, complete cds 40 4.2 
>emb|AJ006296.1|HVU6296 Hordeum vulgare partial mRNA for chlorophyll a/b-binding protein
          Length = 470

 Score =  593 bits (299), Expect = e-166
 Identities = 315/319 (98%), Gaps = 1/319 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   gatgtacaagtggatgcatt-gagtcaccattggttcatattttacaaatcaccaagtcc 59
           ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 456 gatgtacaagtggatccatttgagtcaccattggttcatattttacaaatcaccaagtcc 397

                                                                       
Query: 60  cagcagctctcctatgtgatcggaccagcattataatcaacaaaggatctttgcgatacc 119
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 396 cagcagctctcctatgtgatcggaccagcattataatcaacaaaggatctttgcgatacc 337

                                                                       
Query: 120 ctctcatccatcactcgtcatacaaaaccaaagcacgttcgttacacggacgcgcgttcg 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 336 ctctcatccatcactcgtcatacaaaaccaaagcacgttcgttacacggacgcgcgttcg 277

                                                                       
Query: 180 tccattttgcagctgagctgacagaaactgctcgaccaccgaccacttaagaggagccga 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 276 tccattttgcagctgagctgacagaaactgctcgaccaccgaccacttaagaggagccga 217

                                                                       
Query: 240 aggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcg 299
           ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 aggtgtcgaagatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcg 157

                              
Query: 300 gacccttgccggtggcggc 318
           |||||||||||||||||||
Sbjct: 156 gacccttgccggtggcggc 138
to top
>ref|XM_507368.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1156

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 902 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 843

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 842 gggccccttgccggtggcggc 822



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1156 gatgtacaagtggatgcatt 1137
to top
>ref|XM_478692.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1152

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 897 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 838

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 837 gggccccttgccggtggcggc 817



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1151 gatgtacaagtggatgcatt 1132
to top
>ref|XM_507367.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1162

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggc 824



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1158 gatgtacaagtggatgcatt 1139
to top
>ref|XM_507366.1| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1183

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggc 824



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1158 gatgtacaagtggatgcatt 1139
to top
>ref|XM_506405.2| PREDICTED Oryza sativa (japonica cultivar-group), P0567H04.15 mRNA
          Length = 1221

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 918 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 859

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 858 gggccccttgccggtggcggc 838



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1172 gatgtacaagtggatgcatt 1153
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Plus

                                                                            
Query: 238      gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
                ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 22263067 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 22263126

                                     
Query: 298      cggacccttgccggtggcggc 318
                 || |||||||||||||||||
Sbjct: 22263127 gggccccttgccggtggcggc 22263147



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 1        gatgtacaagtggatgcatt 20
                ||||||||||||||||||||
Sbjct: 22262813 gatgtacaagtggatgcatt 22262832



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                           
Query: 157     ttcgttacacggacgcgcgttcgtccat 184
               ||||||||||||||| ||||||||||||
Sbjct: 7208546 ttcgttacacggacg-gcgttcgtccat 7208572
to top
>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0567H04
          Length = 181420

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Plus

                                                                         
Query: 238   gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
             ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 68313 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 68372

                                  
Query: 298   cggacccttgccggtggcggc 318
              || |||||||||||||||||
Sbjct: 68373 gggccccttgccggtggcggc 68393



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gatgtacaagtggatgcatt 20
             ||||||||||||||||||||
Sbjct: 68059 gatgtacaagtggatgcatt 68078
to top
>dbj|AK119534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B02, full
           insert sequence
          Length = 1234

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggc 824



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1158 gatgtacaagtggatgcatt 1139
to top
>dbj|AK104619.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F11, full
           insert sequence
          Length = 1152

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 897 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 838

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 837 gggccccttgccggtggcggc 817



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1151 gatgtacaagtggatgcatt 1132
to top
>dbj|AK104309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D03, full
           insert sequence
          Length = 1169

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 911 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 852

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 851 gggccccttgccggtggcggc 831



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1165 gatgtacaagtggatgcatt 1146
to top
>dbj|AK103924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-C12, full
           insert sequence
          Length = 1183

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 904 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 845

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 844 gggccccttgccggtggcggc 824



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1158 gatgtacaagtggatgcatt 1139
to top
>dbj|AK098992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H13, full
           insert sequence
          Length = 1156

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 902 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 843

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 842 gggccccttgccggtggcggc 822
to top
>dbj|AK058293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-F01, full
           insert sequence
          Length = 1221

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 918 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 859

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 858 gggccccttgccggtggcggc 838



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1172 gatgtacaagtggatgcatt 1153
to top
>gb|AF058796.1|AF058796 Oryza sativa chlorophyll a/b-binding protein (RCABP69) mRNA,
           complete cds
          Length = 1178

 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           ||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 902 gaaggtgtcgaagatggtggtgtggagcgggtcgctgaggtgggtggcccagttgttgag 843

                                
Query: 298 cggacccttgccggtggcggc 318
            || |||||||||||||||||
Sbjct: 842 gggccccttgccggtggcggc 822



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gatgtacaagtggatgcatt 20
            ||||||||||||||||||||
Sbjct: 1156 gatgtacaagtggatgcatt 1137
to top
>gb|AY103995.1| Zea mays PCO102677 mRNA sequence
          Length = 1225

 Score =  117 bits (59), Expect = 2e-23
 Identities = 77/83 (92%)
 Strand = Plus / Minus

                                                                       
Query: 236 ccgaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttg 295
           ||||| ||||| || ||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 918 ccgaacgtgtcgaagatggtggtgtggagcgggtcgctcaggtgggtggcccagttgttg 859

                                  
Query: 296 agcggacccttgccggtggcggc 318
           ||||| |||||||||||||||||
Sbjct: 858 agcggccccttgccggtggcggc 836



 Score = 44.1 bits (22), Expect = 0.27
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 30   ttggttcatattttacaaatcaccaagtcccagc 63
            |||| |||||| ||||||| ||||||||||||||
Sbjct: 1153 ttggatcatatattacaaaccaccaagtcccagc 1120
to top
>emb|Z50801.1|ZMCABCP29 Z.mays mRNA for chlorophyll a/b-binding protein CP29
          Length = 1162

 Score =  109 bits (55), Expect = 5e-21
 Identities = 76/83 (91%)
 Strand = Plus / Minus

                                                                       
Query: 236 ccgaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttg 295
           ||||| ||||| || ||||| ||||| ||||||||||| |||||||||||||||||||||
Sbjct: 873 ccgaacgtgtcgaagatggtagtgtggagcgggtcgctcaggtgggtggcccagttgttg 814

                                  
Query: 296 agcggacccttgccggtggcggc 318
           ||||| |||||||||||||||||
Sbjct: 813 agcggccccttgccggtggcggc 791



 Score = 44.1 bits (22), Expect = 0.27
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 30   ttggttcatattttacaaatcaccaagtcccagc 63
            |||| |||||| ||||||| ||||||||||||||
Sbjct: 1104 ttggatcatatattacaaaccaccaagtcccagc 1071
to top
>gb|AF139466.2|AF139466 Vigna radiata chlorophyll a/b binding protein CP29 (CipCp29) mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 1118

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 gaaggtgtcaaaaatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgag 297
           |||||||||||  ||||| ||||| || ||||| || | |||||||||||||||||||||
Sbjct: 918 gaaggtgtcaatgatggttgtgtgaagtgggtcactcaagtgggtggcccagttgttgag 859

                             
Query: 298 cggacccttgccggtggc 315
            || |||||||| |||||
Sbjct: 858 tgggcccttgccagtggc 841
to top
>emb|BX822730.1|CNS0A5TB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB5ZH12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 971

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| ||||||||||||||||||||
Sbjct: 851 aatggtggtgtgaagtgggtcactaaggtgagtggcccagttgttgagcgg 801
to top
>ref|NM_111728.2| Arabidopsis thaliana LHCB4.2 AT3G08940 (LHCB4.2) transcript variant
           AT3G08940.2 mRNA, complete cds
          Length = 1109

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 881 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 831
to top
>ref|NM_180214.1| Arabidopsis thaliana LHCB4.2; chlorophyll binding AT3G08940
           (LHCB4.2) transcript variant AT3G08940.1 mRNA, complete
           cds
          Length = 1194

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 966 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 916
to top
>gb|AC010871.7|ATAC010871 Arabidopsis thaliana chromosome III BAC T16O11 genomic sequence,
             complete sequence
          Length = 80381

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                
Query: 250   aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
             |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 37904 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 37954
to top
>gb|AY081608.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At3g08940) mRNA, complete cds
          Length = 881

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 840 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 790
to top
>gb|AY065140.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At3g08940; T16O11.12) mRNA, complete cds
          Length = 1023

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 881 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 831
to top
>emb|BX822436.1|CNS0A619 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB38ZB11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1004

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 862 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 812
to top
>emb|BX823814.1|CNS0A5CT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS78ZG07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 688

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 543 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 493
to top
>emb|BX823751.1|CNS0A5AT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 981

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 861 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 811
to top
>emb|BX823498.1|CNS0A5AS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS44ZD12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 990

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 871 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 821
to top
>emb|BX823817.1|CNS0A4NR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS7ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 691

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 546 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 496
to top
>emb|BX823629.1|CNS0A4ND Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZA12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 992

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 865 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 815
to top
>gb|AF134127.1| Arabidopsis thaliana Lhcb4.2 protein (Lhcb4.2) mRNA, complete cds
          Length = 1040

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||| || ||||| || ||||| || |||||||||||||||||
Sbjct: 884 aatggtggtgtgaagtgggtcactaaggtgagtcgcccagttgttgagcgg 834
to top
>emb|BX823387.1|CNS0A5AY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS31ZA02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 918

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 250 aatggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcgg 300
           |||||||||||  || ||||| || ||||| || |||||||||||||||||
Sbjct: 866 aatggtggtgttaagtgggtcactaaggtgagtcgcccagttgttgagcgg 816
to top
>ref|NM_120231.3| Arabidopsis thaliana chlorophyll binding AT5G01530 mRNA, complete
           cds
          Length = 1222

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 995 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 943
to top
>gb|AY245372.1| Iris fulva clone LFR3-3 IRRE retrotransposon, partial sequence
          Length = 3850

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 267  ggtcgctgaggtgggtggccc 287
            |||||||||||||||||||||
Sbjct: 2333 ggtcgctgaggtgggtggccc 2353
to top
>gb|BT000363.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530) mRNA, complete cds
          Length = 966

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 848 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 796
to top
>emb|AL161946.1|ATF7A7 Arabidopsis thaliana DNA chromosome 5, BAC clone F7A7 (ESSA project)
          Length = 86690

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                  
Query: 251   atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
             ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 17877 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 17825
to top
>gb|AY133566.1| Arabidopsis thaliana At5g01530/F7A7_50 mRNA, complete cds
          Length = 873

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 848 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 796
to top
>gb|AY092980.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530) mRNA, complete cds
          Length = 1094

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 883 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 831
to top
>gb|AC003680.3| Arabidopsis thaliana chromosome 2 BAC F17K2 genomic sequence, complete
             sequence
          Length = 91854

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 28    cattggttcatattttacaaa 48
             |||||||||||||||||||||
Sbjct: 52509 cattggttcatattttacaaa 52489
to top
>gb|AY081680.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530) mRNA, complete cds
          Length = 947

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 848 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 796
to top
>gb|AY059861.1| Arabidopsis thaliana chlorophyll a/b-binding protein CP29
           (At5g01530; F7A7_50) mRNA, complete cds
          Length = 1023

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 884 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 832
to top
>gb|AY057641.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, complete cds
          Length = 1113

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 883 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 831
to top
>dbj|AK221043.1| Arabidopsis thaliana mRNA for Lhcb4- protein, partial cds, clone:
           RAFL22-74-I16
          Length = 212

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 94  atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 42
to top
>gb|AY048300.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, complete cds
          Length = 1074

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 885 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 833
to top
>gb|AF370474.1|AF370474 Arabidopsis thaliana chlorophyll a/b-binding protein CP29 (F7A7_50)
           mRNA, complete cds
          Length = 1064

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 908 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 856
to top
>emb|BX833597.1|CNS0A1R6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZB03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 970

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 869 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|BX831442.1|CNS0A1WM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS90ZH01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 954

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 853 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 801
to top
>emb|BX830127.1|CNS0A1XL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 846 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 794
to top
>emb|BX830573.1|CNS0A06T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB90ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1043

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 972 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 920
to top
>emb|BX831299.1|CNS09ZIA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS77ZA02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 870 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 818
to top
>emb|BX831064.1|CNS09ZJ3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1077

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 869 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|BX830905.1|CNS09ZE8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 941

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 869 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|BX830685.1|CNS09ZE5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZD06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 940

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 251 atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
           ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 869 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 817
to top
>emb|X71878.1|ATLHCB4 A.thaliana Lhcb4 gene
          Length = 2100

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 251  atggtggtgtgcagcgggtcgctgaggtgggtggcccagttgttgagcggacc 303
            ||||||||||| || || || |||||||| || ||||| |||||||| |||||
Sbjct: 1978 atggtggtgtggagtggatcactgaggtgagtagcccaattgttgagtggacc 1926
to top
>ref|XM_477163.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 267

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 157 ttcgttacacggacgcgcgttcgtccat 184
           ||||||||||||||| ||||||||||||
Sbjct: 27  ttcgttacacggacg-gcgttcgtccat 1
to top
>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence
          Length = 152414

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 271   gctgaggtgggtggcccagttgtt 294
             ||||||||||||||||||| ||||
Sbjct: 23315 gctgaggtgggtggcccagatgtt 23292
to top
>gb|AY313897.1| Danio rerio ion channel NompC (nompc) mRNA, complete cds
          Length = 5533

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 199  gacagaaactgctcgaccaccgac 222
            ||||||||||||| ||||||||||
Sbjct: 4952 gacagaaactgctggaccaccgac 4929
to top
>emb|BX842653.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 8/11
          Length = 347636

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 144    aaaccaaagcacgttcgtta 163
              ||||||||||||||||||||
Sbjct: 227818 aaaccaaagcacgttcgtta 227837
to top
>gb|AC026101.24| Homo sapiens 3 BAC RP11-441D23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 164728

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ttcatattttacaaatcacc 53
              ||||||||||||||||||||
Sbjct: 147265 ttcatattttacaaatcacc 147246
to top
>ref|NM_204787.1| Gallus gallus proteoglycan (PG-M), mRNA
          Length = 12307

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 187  tgcagctgagctgacagaaactgc 210
            |||||| |||||||||||||||||
Sbjct: 7500 tgcagcagagctgacagaaactgc 7523
to top
>dbj|AP005764.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0016A21
          Length = 144076

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                         
Query: 157   ttcgttacacggacgcgcgttcgtccat 184
             ||||||||||||||| ||||||||||||
Sbjct: 49030 ttcgttacacggacg-gcgttcgtccat 49056
to top
>dbj|AP000805.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-698L23, complete
             sequence
          Length = 180996

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    caccaagtcccagcagctct 69
             ||||||||||||||||||||
Sbjct: 38344 caccaagtcccagcagctct 38325
to top
>ref|NM_183349.1| Danio rerio transient receptor potential cation channel, subfamily N,
            member 1 (trpn1), mRNA
          Length = 5533

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 199  gacagaaactgctcgaccaccgac 222
            ||||||||||||| ||||||||||
Sbjct: 4952 gacagaaactgctggaccaccgac 4929
to top
>gb|AC133110.2| Homo sapiens BAC clone RP11-761N10 from 4, complete sequence
          Length = 59902

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 273  tgaggtgggtggcccagttg 292
            ||||||||||||||||||||
Sbjct: 9918 tgaggtgggtggcccagttg 9899
to top
>dbj|D13542.1|CHKPRGL Chicken mRNA for proteoglycan, complete cds
          Length = 12307

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 187  tgcagctgagctgacagaaactgc 210
            |||||| |||||||||||||||||
Sbjct: 7500 tgcagcagagctgacagaaactgc 7523


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,855,019
Number of Sequences: 3902068
Number of extensions: 2855019
Number of successful extensions: 79016
Number of sequences better than 10.0: 65
Number of HSP's better than 10.0 without gapping: 63
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 78873
Number of HSP's gapped (non-prelim): 145
length of query: 318
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 296
effective length of database: 17,147,199,772
effective search space: 5075571132512
effective search space used: 5075571132512
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top