ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet45c02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z48729.1|HVBSI1 H.vulgare Bsi1 gene for putative protease in... 724 0.0
2gb|AY549888.2| Triticum aestivum putative proteinase inhibitor-r... 258 1e-65
3gb|L11882.1|WHTWALI5A Triticum aestivum protein of unknown funct... 252 8e-64
4gb|L11881.1|WHTWALI3A Triticum aestivum protein of unknown funct... 78 2e-11
5gb|L28009.1|WHTWALIA Triticum aestivum (wali6) mRNA, complete cds 70 6e-09
6gb|AY641412.1| Hordeum vulgare subsp. vulgare retrotransposon Sa... 48 0.022
7gb|AY618464.1| Glomerella graminicola isolate 43 18S ribosomal R... 42 1.4
8emb|Z94139.1| Plectosphaerella sp. C99 partial 18S rRNA gene, st... 42 1.4
9emb|AL626775.11| Mouse DNA sequence from clone RP23-325M14 on ch... 42 1.4
10ref|XM_580317.2| PREDICTED: Bos taurus collagen, type IV, alpha ... 40 5.3
11gb|AC157769.3| Mus musculus chromosome 1, clone RP24-314L7, comp... 40 5.3
12dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 5.3
13gb|AF042096.3|AF042096 Bradyrhizobium japonicum UbiE (ubiE) gene... 40 5.3
14gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 5.3

>emb|Z48729.1|HVBSI1 H.vulgare Bsi1 gene for putative protease inhibitor
          Length = 498

 Score =  724 bits (365), Expect = 0.0
 Identities = 396/403 (98%), Gaps = 5/403 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cacgggggatatttctcgagaaagaaaccacggtgacaaagacacgacggaacagtatac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 cacgggggatatttctcgagaaagaaaccacggtgacaaagacacgacggaacagtatac 392

                                                                       
Query: 61  atattgttg---gccacgcacacacgcataggcaagatgagtccggtcatctcatccgag 117
           |||||||||   ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391 atattgttgttggccacacacacacgcataggcaagatgagtccggtcatctcatccgag 332

                                                                       
Query: 118 cttttattttaggcgccaagcggaacaatagtctcatgtgagcctgagccgatcagtact 177
           |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 331 cttttattttaggcgccaagcg-aacaatagtctcatgtgagcctgagc-gatcagtact 274

                                                                       
Query: 178 tcttgcatggcccgccgcaggtgccgtcgacggtggctttcatgtcggcgcagcggaacg 237
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 273 tcttgcatggcccgccgcaggtgccgtcgacggtggctttcatgtcggcgcagcggaacg 214

                                                                       
Query: 238 tctgggggttcgtggtcaccacgcggcacgccgagcagccggtggggcactgcggatggg 297
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 213 tctgggggttcgtggtcaccacgcggcacgccgagcagccggtggggcactgcggatggg 154

                                                                       
Query: 298 cgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcagcacgtggggaaat 357
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 153 cgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcagcacgtggggaaat 94

                                                      
Query: 358 agtcggcgttcacgtgcgagaggactcccatgaccaggacggc 400
           || ||||||||||||||||||||||||||||||||||||||||
Sbjct: 93  agacggcgttcacgtgcgagaggactcccatgaccaggacggc 51



to top

>gb|AY549888.2| Triticum aestivum putative proteinase inhibitor-related protein
           (wrsi5-1) mRNA, complete cds
          Length = 608

 Score =  258 bits (130), Expect = 1e-65
 Identities = 210/236 (88%), Gaps = 3/236 (1%)
 Strand = Plus / Minus

                                                                       
Query: 168 gatcagtacttcttgcatggcccgccgcaggtgccgtcgacggtggctttcatgtcggcg 227
           ||||||| ||| ||||||||||||||||||||||| |||||||||   ||||||||||||
Sbjct: 361 gatcagtgctttttgcatggcccgccgcaggtgccatcgacggtgctcttcatgtcggcg 302

                                                                       
Query: 228 cagcggaacgtctgg---gggttcgtggtcaccacgcggcacgccgagcagccggtgggg 284
           || |||||||||| |   ||| | |  |||||||||||||| |||||||||||  |||||
Sbjct: 301 caccggaacgtcttgtgagggctgggcgtcaccacgcggcaggccgagcagcccttgggg 242

                                                                       
Query: 285 cactgcggatgggcgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcag 344
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 cactgggggtgggcgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcag 182

                                                                   
Query: 345 cacgtggggaaatagtcggcgttcacgtgcgagaggactcccatgaccaggacggc 400
           ||| |||||||  |||||||||||||||| |||||||  |||||||||||||||||
Sbjct: 181 cacttggggaagaagtcggcgttcacgtgtgagaggatccccatgaccaggacggc 126



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 53  cagtatacatattgttggcc 72
           ||||||||||||||||||||
Sbjct: 482 cagtatacatattgttggcc 463



to top

>gb|L11882.1|WHTWALI5A Triticum aestivum protein of unknown function (wali5) mRNA,
           complete cds
          Length = 520

 Score =  252 bits (127), Expect = 8e-64
 Identities = 208/235 (88%)
 Strand = Plus / Minus

                                                                       
Query: 166 ccgatcagtacttcttgcatggcccgccgcaggtgccgtcgacggtggctttcatgtcgg 225
           ||||||||||||||||||| || || |||||||||||||||||||||| |||||| || |
Sbjct: 346 ccgatcagtacttcttgcagggtccaccgcaggtgccgtcgacggtggatttcatatccg 287

                                                                       
Query: 226 cgcagcggaacgtctgggggttcgtggtcaccacgcggcacgccgagcagccggtggggc 285
           |||||||  || | | |||| |||| | ||||||||||||||||||||||||   ||| |
Sbjct: 286 cgcagcgccacatttcggggctcgtcgacaccacgcggcacgccgagcagccctggggac 227

                                                                       
Query: 286 actgcggatgggcgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcagc 345
           |||  || |||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 226 acttggggtgggcgtcgtcgcagacgtcgacccccgagaaggacctgcagttgttgcagc 167

                                                                  
Query: 346 acgtggggaaatagtcggcgttcacgtgcgagaggactcccatgaccaggacggc 400
           || |||||||| | |||||||||||||| ||||||| ||||||||||||||||||
Sbjct: 166 acttggggaaaaaatcggcgttcacgtgtgagaggagtcccatgaccaggacggc 112



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 63  attgttggccacgcacacacgcataggcaagatgagtccggtcatctcatccgagctttt 122
           |||||||||||| |||||||||||||||| |||||  | | |||||||  | ||||||||
Sbjct: 443 attgttggccacacacacacgcataggcacgatgacgctgctcatctcgcctgagctttt 384

                 
Query: 123 atttta 128
           ||||||
Sbjct: 383 atttta 378



to top

>gb|L11881.1|WHTWALI3A Triticum aestivum protein of unknown function (wali3) mRNA,
           complete cds
          Length = 564

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 89/105 (84%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 296 ggcgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcagcacgtggggaa 355
           |||||| ||||||||  || |||| |||||| |||||||||||| ||||||| |||||| 
Sbjct: 195 ggcgtcatcgcagaccacggcccccgagaagaacctgcagttgtcgcagcacttgggga- 137

                                                        
Query: 356 atagtcggcgttcacgtgcgagaggactcccatgaccaggacggc 400
             | ||||||||| | || ||||||| ||||||||||||||||||
Sbjct: 136 --actcggcgttcgcctgtgagaggattcccatgaccaggacggc 94



to top

>gb|L28009.1|WHTWALIA Triticum aestivum (wali6) mRNA, complete cds
          Length = 585

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 88/105 (83%), Gaps = 3/105 (2%)
 Strand = Plus / Minus

                                                                       
Query: 296 ggcgtcgtcgcagacgtcgaccccggagaaggacctgcagttgttgcagcacgtggggaa 355
           |||||||||||||||  || |||| |||||| |||||||||||| ||||||  | |||| 
Sbjct: 216 ggcgtcgtcgcagaccacggcccccgagaagaacctgcagttgtcgcagcatttcggga- 158

                                                        
Query: 356 atagtcggcgttcacgtgcgagaggactcccatgaccaggacggc 400
             | ||||||||| | || ||||||| ||||||||||||||||||
Sbjct: 157 --actcggcgttcgcctgtgagaggattcccatgaccaggacggc 115



to top

>gb|AY641412.1| Hordeum vulgare subsp. vulgare retrotransposon Sandra5, complete
             sequence; splicing factor SF2-like protein (SF2) and
             universal stress protein (USP1) genes and Hv
             receptor-kinase-like pseudogene, complete cds; and
             retrotransposons Sandra6 and Sandra7, complete sequence
          Length = 82293

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 260   gcggcacgccgagcagccggtggggcac 287
             |||||||||||||||||||| |||||||
Sbjct: 72099 gcggcacgccgagcagccggcggggcac 72072



to top

>gb|AY618464.1| Glomerella graminicola isolate 43 18S ribosomal RNA gene, partial
           sequence
          Length = 518

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 312 tcgaccccggagaaggacctg 332
           |||||||||||||||||||||
Sbjct: 176 tcgaccccggagaaggacctg 156



to top

>emb|Z94139.1| Plectosphaerella sp. C99 partial 18S rRNA gene, strain C99
          Length = 421

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 312 tcgaccccggagaaggacctg 332
           |||||||||||||||||||||
Sbjct: 323 tcgaccccggagaaggacctg 343



to top

>emb|AL626775.11| Mouse DNA sequence from clone RP23-325M14 on chromosome 4, complete
              sequence
          Length = 190641

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 374    cgagaggactcccatgaccag 394
              |||||||||||||||||||||
Sbjct: 102390 cgagaggactcccatgaccag 102410



to top

>ref|XM_580317.2| PREDICTED: Bos taurus collagen, type IV, alpha 1 (COL4A1), mRNA
          Length = 4920

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 273  cagccggtggggcactgcgg 292
            ||||||||||||||||||||
Sbjct: 4709 cagccggtggggcactgcgg 4690



to top

>gb|AC157769.3| Mus musculus chromosome 1, clone RP24-314L7, complete sequence
          Length = 131045

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     gcacacacgcataggcaaga 94
              ||||||||||||||||||||
Sbjct: 114779 gcacacacgcataggcaaga 114798



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    tcatgtcggcgcagcggaac 236
              ||||||||||||||||||||
Sbjct: 807692 tcatgtcggcgcagcggaac 807673



to top

>gb|AF042096.3|AF042096 Bradyrhizobium japonicum UbiE (ubiE) gene, partial cds; AarF (aarF),
            panthotenate metabolism flavoprotein (dfp),
            deoxyuridine-triphosphatase (dut), putative sensor
            protein (bdfA), GalF-like (galF), hypothetical protein
            genes, complete cds; putative helicase 2 gene, partial
            cds; and unknown genes
          Length = 13289

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 217  tcatgtcggcgcagcggaac 236
            ||||||||||||||||||||
Sbjct: 8347 tcatgtcggcgcagcggaac 8366



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 260    gcggcacgccgagcagccgg 279
              ||||||||||||||||||||
Sbjct: 369398 gcggcacgccgagcagccgg 369417


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,457,129
Number of Sequences: 3902068
Number of extensions: 2457129
Number of successful extensions: 44325
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44186
Number of HSP's gapped (non-prelim): 134
length of query: 400
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 378
effective length of database: 17,147,199,772
effective search space: 6481641513816
effective search space used: 6481641513816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top